Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SBK3 Gene

Aliases for SBK3 Gene

  • SH3 Domain Binding Kinase Family Member 3 2 3 5
  • SH3 Domain Binding Kinase Family, Member 3 2 3
  • SH3-Binding Domain Kinase Family Member 3 3 4
  • Sugen Kinase 110 3 4
  • SGK110 3 4
  • EC 4

External Ids for SBK3 Gene

Previous GeneCards Identifiers for SBK3 Gene

  • GC19M056055

Summaries for SBK3 Gene

GeneCards Summary for SBK3 Gene

SBK3 (SH3 Domain Binding Kinase Family Member 3) is a Protein Coding gene. GO annotations related to this gene include transferase activity, transferring phosphorus-containing groups and protein tyrosine kinase activity. An important paralog of this gene is SBK2.

No data available for Entrez Gene Summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SBK3 Gene

Genomics for SBK3 Gene

Regulatory Elements for SBK3 Gene

Enhancers for SBK3 Gene
GeneHancer Identifier Score Enhancer Sources TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Other Gene Targets for Enhancer

Enhancers around SBK3 on UCSC Golden Path with GeneCards custom track

Genomic Location for SBK3 Gene

55,540,559 bp from pter
55,545,543 bp from pter
4,985 bases
Minus strand

Genomic View for SBK3 Gene

Genes around SBK3 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SBK3 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SBK3 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SBK3 Gene

Proteins for SBK3 Gene

  • Protein details for SBK3 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Uncharacterized serine/threonine-protein kinase SBK3
    Protein Accession:

    Protein attributes for SBK3 Gene

    359 amino acids
    Molecular mass:
    38488 Da
    Quaternary structure:
    No Data Available

neXtProt entry for SBK3 Gene

Proteomics data for SBK3 Gene at MOPED

Post-translational modifications for SBK3 Gene

No Post-translational modifications

Other Protein References for SBK3 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for SBK3 Gene

Domains & Families for SBK3 Gene

Protein Domains for SBK3 Gene

Suggested Antigen Peptide Sequences for SBK3 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Contains 1 protein kinase domain.
  • Belongs to the protein kinase superfamily. Ser/Thr protein kinase family. STKL subfamily.
  • Contains 1 protein kinase domain.
  • Belongs to the protein kinase superfamily. Ser/Thr protein kinase family. STKL subfamily.
genes like me logo Genes that share domains with SBK3: view

No data available for Gene Families for SBK3 Gene

Function for SBK3 Gene

Molecular function for SBK3 Gene

UniProtKB/Swiss-Prot CatalyticActivity:
ATP + a protein = ADP + a phosphoprotein.

Enzyme Numbers (IUBMB) for SBK3 Gene

Gene Ontology (GO) - Molecular Function for SBK3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005524 ATP binding IEA --
genes like me logo Genes that share ontologies with SBK3: view

Animal Model Products

  • Taconic Biosciences Mouse Models for SBK3

No data available for Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for SBK3 Gene

Localization for SBK3 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for SBK3 Gene

Pathways & Interactions for SBK3 Gene

SuperPathways for SBK3 Gene

No Data Available

Interacting Proteins for SBK3 Gene

Gene Ontology (GO) - Biological Process for SBK3 Gene


No data available for Pathways by source and SIGNOR curated interactions for SBK3 Gene

Drugs & Compounds for SBK3 Gene

No Compound Related Data Available

Transcripts for SBK3 Gene

mRNA/cDNA for SBK3 Gene

(2) REFSEQ mRNAs :
(2) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Alternative Splicing Database (ASD) splice patterns (SP) for SBK3 Gene

No ASD Table

Relevant External Links for SBK3 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for SBK3 Gene

mRNA expression in normal human tissues for SBK3 Gene

mRNA differential expression in normal tissues according to GTEx for SBK3 Gene

This gene is overexpressed in Heart - Atrial Appendage (x30.8), Muscle - Skeletal (x6.7), and Heart - Left Ventricle (x5.1).
genes like me logo Genes that share expression patterns with SBK3: view

In Situ Assay Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , mRNA Expression by UniProt/SwissProt and Protein tissue co-expression partners for SBK3 Gene

Orthologs for SBK3 Gene

This gene was present in the common ancestor of animals.

Orthologs for SBK3 Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia SBK3 35
  • 82.96 (n)
  • 83.52 (a)
(Canis familiaris)
Mammalia SGK110 35
  • 82.82 (n)
  • 83.01 (a)
SBK3 36
  • 78 (a)
(Mus musculus)
Mammalia Sbk3 35
  • 81.05 (n)
  • 86.93 (a)
Sbk3 16
Gm1078 36
  • 76 (a)
(Rattus norvegicus)
Mammalia Sbk3 35
  • 81.05 (n)
  • 84.87 (a)
(Monodelphis domestica)
Mammalia SBK3 36
  • 60 (a)
(Ornithorhynchus anatinus)
Mammalia SBK3 36
  • 52 (a)
(Pan troglodytes)
Mammalia SBK3 36
  • 100 (a)
(Gallus gallus)
Aves LOC101748417 35
  • 57.59 (n)
  • 48.17 (a)
SBK3 36
  • 47 (a)
(Anolis carolinensis)
Reptilia SBK3 36
  • 30 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia LOC100135243 35
  • 48.73 (n)
  • 38.24 (a)
(Danio rerio)
Actinopterygii CABZ01038514.1 36
  • 26 (a)
si:ch211-171h4.3 36
  • 28 (a)
zgc:172086 36
  • 31 (a)
fruit fly
(Drosophila melanogaster)
Insecta CG11221 36
  • 19 (a)
CG4945 36
  • 15 (a)
(Caenorhabditis elegans)
Secernentea C01C4.3 36
  • 18 (a)
Species with no ortholog for SBK3:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for SBK3 Gene

Gene Tree for SBK3 (if available)
Gene Tree for SBK3 (if available)

Paralogs for SBK3 Gene

Paralogs for SBK3 Gene

(5) SIMAP similar genes for SBK3 Gene using alignment to 3 proteins:

genes like me logo Genes that share paralogs with SBK3: view

Variants for SBK3 Gene

Sequence variations from dbSNP and Humsavar for SBK3 Gene

SNP ID Clin Chr 19 pos Sequence Context AA Info Type
rs7256162 -- 55,544,030(+) GGAGA(C/T)AGAGA intron-variant
rs12979212 -- 55,545,930(+) TCTCT(A/C)CCCGT upstream-variant-2KB
rs67637375 -- 55,547,077(+) CAGGC(-/T)CCCAG upstream-variant-2KB
rs71181787 -- 55,547,071(-) TCTGT(-/ACTCCTGGGTCTGAGGGAGAAGGGGCTGGGAGCCTGG)ACTCC upstream-variant-2KB
rs28363846 -- 55,546,649(+) CCTCC(A/G)TCCTC upstream-variant-2KB

Variation tolerance for SBK3 Gene

Gene Damage Index Score: 3.81; 58.43% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for SBK3 Gene

HapMap Linkage Disequilibrium report

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Structural Variations from Database of Genomic Variants (DGV) for SBK3 Gene

Disorders for SBK3 Gene

Relevant External Links for SBK3

Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for SBK3 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for SBK3 Gene

Publications for SBK3 Gene

  1. The DNA sequence and biology of human chromosome 19. (PMID: 15057824) Grimwood J. … Lucas S.M. (Nature 2004) 3 4 67
  2. Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes. (PMID: 16344560) Kimura K. … Sugano S. (Genome Res. 2006) 3
  3. The protein kinase complement of the human genome. (PMID: 12471243) Manning G. … Sudarsanam S. (Science 2002) 3

Products for SBK3 Gene

Sources for SBK3 Gene
