Free for academic non-profit institutions. Other users need a Commercial license

Aliases for SBK1 Gene

Aliases for SBK1 Gene

  • SH3 Domain Binding Kinase 1 2 3 5
  • SH3-Binding Domain Kinase 1 2 3
  • EC 2.7.11.1 4 61
  • Serine/Threonine-Protein Kinase SBK1 3
  • SH3-Binding Kinase 1 4
  • EC 2.7.11 61
  • SBK 3

External Ids for SBK1 Gene

Previous GeneCards Identifiers for SBK1 Gene

  • GC16P028160
  • GC16P026395

Summaries for SBK1 Gene

GeneCards Summary for SBK1 Gene

SBK1 (SH3 Domain Binding Kinase 1) is a Protein Coding gene. Diseases associated with SBK1 include Punctate Epithelial Keratoconjunctivitis. GO annotations related to this gene include transferase activity, transferring phosphorus-containing groups and protein tyrosine kinase activity. An important paralog of this gene is SBK2.

UniProtKB/Swiss-Prot for SBK1 Gene

  • May be involved in signal-transduction pathways related to the control of brain development.

No data available for Entrez Gene Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for SBK1 Gene

Genomics for SBK1 Gene

Regulatory Elements for SBK1 Gene

Enhancers for SBK1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH16F028321 0.2 ENCODE 12.1 +63.2 63232 0.2 CTCF MAZ TRIM22 THRB SMARCB1 RAD21 SMC3 ZNF143 CREM ENSG00000246465 SBK1 GSG1L GC16P028321 ENSG00000277191
GH16F028324 0.2 ENCODE 12.1 +66.1 66050 1.2 ELF3 DNMT3B ZNF121 FOS MIXL1 THAP11 SP5 CEBPB SSRP1 MIER3 ENSG00000246465 SBK1 GSG1L EIF3C GC16P028321 ENSG00000277191
GH16F028327 0.6 ENCODE 12.1 +68.4 68382 0.2 CTCF ARID4B CEBPG ZNF644 RAD21 YY1 ZNF143 SMC3 PRDM10 THAP11 ENSG00000246465 SBK1 GSG1L GC16P028321 ENSG00000277191
GH16F028185 1.5 FANTOM5 Ensembl ENCODE 11.7 -67.0 -66961 12.3 HDGF PKNOX1 FEZF1 BRCA1 ZNF121 ELK1 CBX5 ZNF207 FOS ZNF263 SBK1 ENSG00000261766 NPIPB9 XPO6 ENSG00000246465 SGF29 APOBR GC16M028181 RNY1P10
GH16F028329 1 Ensembl ENCODE 11.6 +71.6 71564 0.8 ZNF316 RAD51 NFYC EMSY ENSG00000246465 SBK1 GC16P028321 ENSG00000277191
- Elite enhancer/Elite enhancer-gene association Download Table
Download GeneHancer data dump

Enhancers around SBK1 on UCSC Golden Path with GeneCards custom track

Genomic Location for SBK1 Gene

Chromosome:
16
Start:
28,258,703 bp from pter
End:
28,323,849 bp from pter
Size:
65,147 bases
Orientation:
Plus strand

Genomic View for SBK1 Gene

Genes around SBK1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
SBK1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for SBK1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for SBK1 Gene

Proteins for SBK1 Gene

  • Protein details for SBK1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q52WX2-SBK1_HUMAN
    Recommended name:
    Serine/threonine-protein kinase SBK1
    Protein Accession:
    Q52WX2

    Protein attributes for SBK1 Gene

    Size:
    424 amino acids
    Molecular mass:
    46252 Da
    Quaternary structure:
    No Data Available

neXtProt entry for SBK1 Gene

Selected DME Specific Peptides for SBK1 Gene

Post-translational modifications for SBK1 Gene

  • Ubiquitination at Lys 176
  • Modification sites at PhosphoSitePlus

Other Protein References for SBK1 Gene

ENSEMBL proteins:
REFSEQ proteins:

Domains & Families for SBK1 Gene

Gene Families for SBK1 Gene

Protein Domains for SBK1 Gene

Suggested Antigen Peptide Sequences for SBK1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q52WX2

UniProtKB/Swiss-Prot:

SBK1_HUMAN :
  • Contains 1 protein kinase domain.
  • Belongs to the protein kinase superfamily. Ser/Thr protein kinase family.
Domain:
  • Contains 1 protein kinase domain.
Family:
  • Belongs to the protein kinase superfamily. Ser/Thr protein kinase family.
genes like me logo Genes that share domains with SBK1: view

Function for SBK1 Gene

Molecular function for SBK1 Gene

UniProtKB/Swiss-Prot CatalyticActivity:
ATP + a protein = ADP + a phosphoprotein.
UniProtKB/Swiss-Prot Function:
May be involved in signal-transduction pathways related to the control of brain development.

Enzyme Numbers (IUBMB) for SBK1 Gene

Gene Ontology (GO) - Molecular Function for SBK1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004672 protein kinase activity IEA --
GO:0004674 protein serine/threonine kinase activity IEA,IBA --
GO:0005524 ATP binding IEA --
GO:0016301 kinase activity IEA --
GO:0016740 transferase activity IEA --
genes like me logo Genes that share ontologies with SBK1: view
genes like me logo Genes that share phenotypes with SBK1: view

Animal Model Products

Inhibitory RNA Products

Flow Cytometry Products

No data available for Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for SBK1 Gene

Localization for SBK1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for SBK1 Gene

Cytoplasm.

Subcellular locations from

COMPARTMENTS
Jensen Localization Image for SBK1 Gene COMPARTMENTS Subcellular localization image for SBK1 gene
Compartment Confidence
cytosol 2

Gene Ontology (GO) - Cellular Components for SBK1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005737 cytoplasm IEA --
genes like me logo Genes that share ontologies with SBK1: view

Pathways & Interactions for SBK1 Gene

SuperPathways for SBK1 Gene

No Data Available

Gene Ontology (GO) - Biological Process for SBK1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006468 protein phosphorylation IEA --
GO:0016310 phosphorylation IEA --
GO:0018105 peptidyl-serine phosphorylation IBA --
GO:0018107 peptidyl-threonine phosphorylation IBA --
genes like me logo Genes that share ontologies with SBK1: view

No data available for Pathways by source and SIGNOR curated interactions for SBK1 Gene

Drugs & Compounds for SBK1 Gene

(1) Drugs for SBK1 Gene - From: HMDB

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Adenosine triphosphate Approved Nutra 0

(1) Additional Compounds for SBK1 Gene - From: HMDB

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
ADP
  • Adenosindiphosphorsaeure
  • Adenosine 5'-pyrophosphate
  • Adenosine diphosphate
  • Adenosine pyrophosphate
  • Adenosine-5'-diphosphate
Full agonist, Agonist 58-64-0
genes like me logo Genes that share compounds with SBK1: view

Transcripts for SBK1 Gene

mRNA/cDNA for SBK1 Gene

(2) REFSEQ mRNAs :
(2) Additional mRNA sequences :
(1) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for SBK1 Gene

SH3-binding domain kinase 1:
Representative Sequences:

Inhibitory RNA Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for SBK1 Gene

No ASD Table

Relevant External Links for SBK1 Gene

GeneLoc Exon Structure for
SBK1
ECgene alternative splicing isoforms for
SBK1

Expression for SBK1 Gene

mRNA expression in normal human tissues for SBK1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for SBK1 Gene

This gene is overexpressed in Brain - Cerebellum (x9.0) and Brain - Cerebellar Hemisphere (x6.6).

Protein differential expression in normal tissues from HIPED for SBK1 Gene

This gene is overexpressed in Cerebrospinal fluid (67.8).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for SBK1 Gene



Protein tissue co-expression partners for SBK1 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of SBK1 Gene:

SBK1

SOURCE GeneReport for Unigene cluster for SBK1 Gene:

Hs.97837
genes like me logo Genes that share expression patterns with SBK1: view

Primer Products

No data available for mRNA Expression by UniProt/SwissProt for SBK1 Gene

Orthologs for SBK1 Gene

This gene was present in the common ancestor of animals.

Orthologs for SBK1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia SBK1 34 35
  • 99.11 (n)
dog
(Canis familiaris)
Mammalia SBK1 34 35
  • 94.03 (n)
cow
(Bos Taurus)
Mammalia SBK1 34 35
  • 88.8 (n)
mouse
(Mus musculus)
Mammalia Sbk1 34 16 35
  • 87.61 (n)
rat
(Rattus norvegicus)
Mammalia Sbk1 34
  • 87.37 (n)
oppossum
(Monodelphis domestica)
Mammalia SBK1 35
  • 83 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia SBK1 35
  • 76 (a)
OneToOne
chicken
(Gallus gallus)
Aves SBK1 34 35
  • 82.26 (n)
lizard
(Anolis carolinensis)
Reptilia SBK1 35
  • 74 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia LOC100125030 34
  • 69.61 (n)
Str.12367 34
zebrafish
(Danio rerio)
Actinopterygii si:ch211-183d21.3 34
  • 65.74 (n)
SBK1 35
  • 58 (a)
OneToOne
fruit fly
(Drosophila melanogaster)
Insecta CG11221 35
  • 23 (a)
ManyToMany
CG4945 35
  • 19 (a)
ManyToMany
worm
(Caenorhabditis elegans)
Secernentea C01C4.3 35
  • 23 (a)
OneToMany
Species where no ortholog for SBK1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for SBK1 Gene

ENSEMBL:
Gene Tree for SBK1 (if available)
TreeFam:
Gene Tree for SBK1 (if available)

Paralogs for SBK1 Gene

Paralogs for SBK1 Gene

(6) SIMAP similar genes for SBK1 Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with SBK1: view

Variants for SBK1 Gene

Sequence variations from dbSNP and Humsavar for SBK1 Gene

SNP ID Clin Chr 16 pos Sequence Context AA Info Type
VAR_041068 An ovarian mucinous carcinoma sample
rs10609962 -- 28,282,927(+) TATTT(-/ATTT)GTTTG intron-variant
rs10618191 -- 28,282,648(+) GAATG(-/AATGAATGAATGAAT/AATGAATGAATGAATGAATC/AATGAATGAATGAATGAATG)GAGTG intron-variant
rs10658725 -- 28,282,626(+) AAGTG(-/TGAATGAA/TGAATGAATGAA/TGAATGAATGAATGAA/TGAATGAATGAATGAATGAA)TGAAT intron-variant
rs10701276 -- 28,282,823(+) TCCTC(-/TG)AGAAT intron-variant

Structural Variations from Database of Genomic Variants (DGV) for SBK1 Gene

Variant ID Type Subtype PubMed ID
esv2758640 CNV gain+loss 17122850
nsv516054 CNV loss 19592680
nsv526174 CNV gain 19592680

Variation tolerance for SBK1 Gene

Residual Variation Intolerance Score: 38.6% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.53; 11.40% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for SBK1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
SBK1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for SBK1 Gene

Disorders for SBK1 Gene

MalaCards: The human disease database

(1) MalaCards diseases for SBK1 Gene - From: DISEASES

Disorder Aliases PubMed IDs
punctate epithelial keratoconjunctivitis
  • punctate keratitis
- elite association - COSMIC cancer census association via MalaCards
Search SBK1 in MalaCards View complete list of genes associated with diseases

Relevant External Links for SBK1

Genetic Association Database (GAD)
SBK1
Human Genome Epidemiology (HuGE) Navigator
SBK1
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
SBK1
genes like me logo Genes that share disorders with SBK1: view

No data available for UniProtKB/Swiss-Prot and Genatlas for SBK1 Gene

Publications for SBK1 Gene

  1. Coeliac disease-associated risk variants in TNFAIP3 and REL implicate altered NF-kappaB signalling. (PMID: 19240061) Trynka G. … Wijmenga C. (Gut 2009) 3 46 64
  2. SR protein kinases promote splicing of nonconsensus introns. (PMID: 26167880) Lipp J.J. … Guthrie C. (Nat. Struct. Mol. Biol. 2015) 3 64
  3. Panorama of ancient metazoan macromolecular complexes. (PMID: 26344197) Wan C. … Emili A. (Nature 2015) 3 64
  4. Human SBK1 is dysregulated in multiple cancers and promotes survival of ovary cancer SK-OV-3 cells. (PMID: 21104019) Wang P. … Ma D. (Mol. Biol. Rep. 2011) 3 64
  5. Identification of interaction partners for individual SH3 domains of Fas ligand associated members of the PCH protein family in T lymphocytes. (PMID: 19041431) Linkermann A. … Janssen O. (Biochim. Biophys. Acta 2009) 3 64

Products for SBK1 Gene

Sources for SBK1 Gene

Content
Loading form....