Free for academic non-profit institutions. Other users need a Commercial license

Aliases for S1PR4 Gene

Aliases for S1PR4 Gene

  • Sphingosine-1-Phosphate Receptor 4 2 3 5
  • Endothelial Differentiation, Lysophosphatidic Acid G-Protein-Coupled Receptor, 6 2 3
  • Endothelial Differentiation, G-Protein-Coupled Receptor 6 2 3
  • Endothelial Differentiation G-Protein Coupled Receptor 6 3 4
  • Sphingosine 1-Phosphate Receptor Edg-6 3 4
  • S1P Receptor Edg-6 3 4
  • S1P Receptor 4 3 4
  • EDG6 3 4
  • S1P4 3 4
  • Endothelial Differentiation, G Protein Coupled Receptor 6 3
  • LPC1 3
  • SLP4 3

External Ids for S1PR4 Gene

Previous HGNC Symbols for S1PR4 Gene

  • EDG6

Previous GeneCards Identifiers for S1PR4 Gene

  • GC19P003130
  • GC19P002945

Summaries for S1PR4 Gene

Entrez Gene Summary for S1PR4 Gene

  • This gene is a member of the endothelial differentiation, G-protein-coupled (EDG)) receptor gene family. EDG receptors bind lysophospholipids or lysosphingolipids as ligands, and are involved in cell signalling in many different cell types. This EDG receptor gene is intronless and is specifically expressed in the lymphoid tissue. [provided by RefSeq, Jul 2008]

GeneCards Summary for S1PR4 Gene

S1PR4 (Sphingosine-1-Phosphate Receptor 4) is a Protein Coding gene. Among its related pathways are Peptide ligand-binding receptors and S1P3 pathway. GO annotations related to this gene include G-protein coupled receptor activity and sphingosine-1-phosphate receptor activity. An important paralog of this gene is LPAR1.

UniProtKB/Swiss-Prot for S1PR4 Gene

  • Receptor for the lysosphingolipid sphingosine 1-phosphate (S1P). S1P is a bioactive lysophospholipid that elicits diverse physiological effect on most types of cells and tissues. May be involved in cell migration processes that are specific for lymphocytes.

Tocris Summary for S1PR4 Gene

  • Sphingosine-1-phosphate (S1P) receptors are a group of G-protein-coupled receptors that are currently divided into five subtypes; S1P1, S1P2, S1P3, S1P4 and S1P5. They are expressed in a wide variety of tissues, with each subtype exhibiting a different cell specificity.

Gene Wiki entry for S1PR4 Gene

No data available for PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for S1PR4 Gene

Genomics for S1PR4 Gene

Regulatory Elements for S1PR4 Gene

Enhancers for S1PR4 Gene
GeneHancer Identifier Score Enhancer Sources TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Other Gene Targets for Enhancer

Enhancers around S1PR4 on UCSC Golden Path with GeneCards custom track

Genomic Location for S1PR4 Gene

Chromosome:
19
Start:
3,172,346 bp from pter
End:
3,180,332 bp from pter
Size:
7,987 bases
Orientation:
Plus strand

Genomic View for S1PR4 Gene

Genes around S1PR4 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
S1PR4 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for S1PR4 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for S1PR4 Gene

Proteins for S1PR4 Gene

  • Protein details for S1PR4 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    O95977-S1PR4_HUMAN
    Recommended name:
    Sphingosine 1-phosphate receptor 4
    Protein Accession:
    O95977
    Secondary Accessions:
    • D6W612

    Protein attributes for S1PR4 Gene

    Size:
    384 amino acids
    Molecular mass:
    41623 Da
    Quaternary structure:
    No Data Available

    Three dimensional structures from OCA and Proteopedia for S1PR4 Gene

neXtProt entry for S1PR4 Gene

Proteomics data for S1PR4 Gene at MOPED

Post-translational modifications for S1PR4 Gene

  • Glycosylation at Asn 2 and Asn 30
  • Modification sites at PhosphoSitePlus

Other Protein References for S1PR4 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for S1PR4 Gene

Domains & Families for S1PR4 Gene

Gene Families for S1PR4 Gene

Suggested Antigen Peptide Sequences for S1PR4 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

O95977

UniProtKB/Swiss-Prot:

S1PR4_HUMAN :
  • Belongs to the G-protein coupled receptor 1 family.
Family:
  • Belongs to the G-protein coupled receptor 1 family.
genes like me logo Genes that share domains with S1PR4: view

Function for S1PR4 Gene

Molecular function for S1PR4 Gene

UniProtKB/Swiss-Prot Function:
Receptor for the lysosphingolipid sphingosine 1-phosphate (S1P). S1P is a bioactive lysophospholipid that elicits diverse physiological effect on most types of cells and tissues. May be involved in cell migration processes that are specific for lymphocytes.
genes like me logo Genes that share phenotypes with S1PR4: view

Animal Models for S1PR4 Gene

MGI Knock Outs for S1PR4:

Animal Model Products

  • Taconic Biosciences Mouse Models for S1PR4

CRISPR Products

No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , miRNA , Transcription Factor Targets and HOMER Transcription for S1PR4 Gene

Localization for S1PR4 Gene

Subcellular locations from UniProtKB/Swiss-Prot for S1PR4 Gene

Cell membrane; Multi-pass membrane protein.

Subcellular locations from

COMPARTMENTS
Jensen Localization Image for S1PR4 Gene COMPARTMENTS Subcellular localization image for S1PR4 gene
Compartment Confidence
plasma membrane 5
cytosol 4
extracellular 1

Gene Ontology (GO) - Cellular Components for S1PR4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005829 cytosol TAS --
genes like me logo Genes that share ontologies with S1PR4: view

Pathways & Interactions for S1PR4 Gene

genes like me logo Genes that share pathways with S1PR4: view

Gene Ontology (GO) - Biological Process for S1PR4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007186 G-protein coupled receptor signaling pathway IEA,TAS 9790765
GO:0007189 adenylate cyclase-activating G-protein coupled receptor signaling pathway IEA --
GO:0007204 positive regulation of cytosolic calcium ion concentration TAS 10679247
genes like me logo Genes that share ontologies with S1PR4: view

No data available for SIGNOR curated interactions for S1PR4 Gene

Drugs & Compounds for S1PR4 Gene

(9) Drugs for S1PR4 Gene - From: ApexBio, DGIdb, IUPHAR, HMDB, and Tocris

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Sphingosine Experimental Pharma 0
Sphingosine-1-phosphate Pharma Full agonist, Agonist Endogenous agonist at S1P1-5 0
AFD(R) Pharma Agonist 0
compound 26 [PMID:16190743] Pharma Agonist 0
phytosphingosine 1-phosphate Pharma Agonist 0

(6) Additional Compounds for S1PR4 Gene - From: IUPHAR, Tocris, and Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
dihydrosp?aehingosine?ae-1-phosph?aeate
Full agonist, Agonist
CYM 5442 hydrochloride
1094042-01-9
RP 001 hydrochloride
1306761-53-4
SEW 2871
256414-75-2
TC-SP 14
1257093-40-5

(5) Tocris Compounds for S1PR4 Gene

Compound Action Cas Number
CYM 5442 hydrochloride Selective S1P1 receptor agonist 1094042-01-9
RP 001 hydrochloride Potent S1P1 agonist 1306761-53-4
SEW 2871 Cell-permeable, selective S1P1 receptor agonist 256414-75-2
Sphingosine-1-phosphate Endogenous agonist at S1P1-5 26993-30-6
TC-SP 14 Potent S1P1 receptor agonist 1257093-40-5

(1) ApexBio Compounds for S1PR4 Gene

Compound Action Cas Number
Fingolimod (FTY720) S1P receptors agonist 162359-56-0
genes like me logo Genes that share compounds with S1PR4: view

Transcripts for S1PR4 Gene

mRNA/cDNA for S1PR4 Gene

(1) REFSEQ mRNAs :
(3) Additional mRNA sequences :
(49) Selected AceView cDNA sequences:
(2) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for S1PR4 Gene

Sphingosine-1-phosphate receptor 4:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for S1PR4 Gene

No ASD Table

Relevant External Links for S1PR4 Gene

GeneLoc Exon Structure for
S1PR4
ECgene alternative splicing isoforms for
S1PR4

Expression for S1PR4 Gene

mRNA expression in normal human tissues for S1PR4 Gene

mRNA differential expression in normal tissues according to GTEx for S1PR4 Gene

This gene is overexpressed in Whole Blood (x43.1).

Protein differential expression in normal tissues from HIPED for S1PR4 Gene

This gene is overexpressed in Monocytes (39.2) and Peripheral blood mononuclear cells (21.8).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for S1PR4 Gene



SOURCE GeneReport for Unigene cluster for S1PR4 Gene Hs.662006

mRNA Expression by UniProt/SwissProt for S1PR4 Gene

O95977-S1PR4_HUMAN
Tissue specificity: Specifically expressed in fetal and adult lymphoid and hematopoietic tissue as well as in lung. Considerable level of expression in adult and fetal spleen as well as adult peripheral leukocytes and lung. Lower expression in adult thymus, lymph node, bone marrow, and appendix as well as in fetal liver, thymus, and lung.
genes like me logo Genes that share expression patterns with S1PR4: view

Protein tissue co-expression partners for S1PR4 Gene

- Elite partner

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery for S1PR4 Gene

Orthologs for S1PR4 Gene

This gene was present in the common ancestor of chordates.

Orthologs for S1PR4 Gene

Organism Taxonomy Gene Similarity Type Details
cow
(Bos Taurus)
Mammalia S1PR4 35
  • 85.5 (n)
  • 85.94 (a)
S1PR4 36
  • 86 (a)
OneToOne
dog
(Canis familiaris)
Mammalia S1PR4 35
  • 87.43 (n)
  • 86.39 (a)
S1PR4 36
  • 86 (a)
OneToOne
mouse
(Mus musculus)
Mammalia S1pr4 35
  • 81.17 (n)
  • 83.29 (a)
S1pr4 16
S1pr4 36
  • 82 (a)
OneToOne
chimpanzee
(Pan troglodytes)
Mammalia S1PR4 35
  • 99.65 (n)
  • 100 (a)
S1PR4 36
  • 100 (a)
OneToOne
rat
(Rattus norvegicus)
Mammalia S1pr4 35
  • 80.37 (n)
  • 83.55 (a)
oppossum
(Monodelphis domestica)
Mammalia S1PR4 36
  • 78 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia S1PR4 36
  • 71 (a)
OneToOne
chicken
(Gallus gallus)
Aves S1PR4 35
  • 65.22 (n)
  • 56.52 (a)
S1PR4 36
  • 54 (a)
OneToOne
lizard
(Anolis carolinensis)
Reptilia S1PR4 36
  • 50 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia s1pr4 35
  • 53.72 (n)
  • 52.07 (a)
zebrafish
(Danio rerio)
Actinopterygii s1pr4 35
  • 55.27 (n)
  • 49 (a)
s1pr4 36
  • 45 (a)
OneToOne
Species with no ortholog for S1PR4:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for S1PR4 Gene

ENSEMBL:
Gene Tree for S1PR4 (if available)
TreeFam:
Gene Tree for S1PR4 (if available)

Paralogs for S1PR4 Gene

Paralogs for S1PR4 Gene

(9) SIMAP similar genes for S1PR4 Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with S1PR4: view

Variants for S1PR4 Gene

Sequence variations from dbSNP and Humsavar for S1PR4 Gene

SNP ID Clin Chr 19 pos Sequence Context AA Info Type
rs3746072 - 3,179,886(-) GCGAG(A/C/T)GGGAG reference, missense
rs12977288 -- 3,178,247(+) ACGCA(C/T)CGGGC upstream-variant-2KB
rs12978223 -- 3,178,246(+) AACGC(A/C)CCGGG upstream-variant-2KB
rs12985494 -- 3,177,841(+) AGTTT(C/T)CCCTT upstream-variant-2KB
rs71164660 -- 3,178,267(+) TCAGT(-/TTCCCCTTCTGCAACGCATCGGGCTCTCTGGGCCTCAGTTTCCCCTTCTGCAACGCCTCGGGCTCTCTGGGCCTCAGT)TTCCT upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for S1PR4 Gene

Variant ID Type Subtype PubMed ID
nsv910697 CNV Loss 21882294
nsv509716 CNV Insertion 20534489
nsv910714 CNV Loss 21882294
dgv3648n71 CNV Loss 21882294

Variation tolerance for S1PR4 Gene

Residual Variation Intolerance Score: 85.6% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.43; 42.90% of all genes are more intolerant (likely to be disease-causing)

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Relevant External Links for S1PR4 Gene

Disorders for S1PR4 Gene

Relevant External Links for S1PR4

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
S1PR4

No disorders were found for S1PR4 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for S1PR4 Gene

Publications for S1PR4 Gene

  1. EDG6, a novel G protein-coupled receptor related to receptors for bioactive lysophospholipids, is specifically expressed in lymphoid tissue. (PMID: 9790765) Graeler M.H. … Lipp M. (Genomics 1998) 2 3 4 67
  2. A single amino acid determines preference between phospholipids and reveals length restriction for activation of the S1P4 receptor. (PMID: 15298705) Holdsworth G. … Parrill A.L. (BMC Biochem. 2004) 3 23
  3. Sphingosine 1-phosphate induces chemotaxis of immature and modulates cytokine-release in mature human dendritic cells for emergence of Th2 immune responses. (PMID: 11919175) Idzko M. … Norgauer J. (FASEB J. 2002) 3 23
  4. Sphingosine-1-phosphate is a ligand for the G protein-coupled receptor EDG-6. (PMID: 10753843) Van Brocklyn J.R. … Spiegel S. (Blood 2000) 3 23
  5. Sphingosine kinase 2 prevents the nuclear translocation of sphingosine 1-phosphate receptor-2 and tyrosine 416 phosphorylated c-Src and increases estrogen receptor negative MDA-MB-231 breast cancer cell growth: The role of sphingosine 1-phosphate receptor-4. (PMID: 24486401) Ohotski J. … Pyne N.J. (Cell. Signal. 2014) 3

Products for S1PR4 Gene

Sources for S1PR4 Gene

Content