Free for academic non-profit institutions. Other users need a Commercial license

Aliases for RXRA Gene

Aliases for RXRA Gene

  • Retinoid X Receptor, Alpha 2 3
  • Nuclear Receptor Subfamily 2 Group B Member 1 2 3 4
  • NR2B1 3 4
  • Retinoid X Nuclear Receptor Alpha 3
  • Retinoic Acid Receptor RXR-Alpha 3
  • Retinoid X Receptor Alpha 4

External Ids for RXRA Gene

Previous GeneCards Identifiers for RXRA Gene

  • GC09P128442
  • GC09P129062
  • GC09P130816
  • GC09P132732
  • GC09P132661
  • GC09P134519
  • GC09P136358
  • GC09P137208
  • GC09P106757

Summaries for RXRA Gene

Entrez Gene Summary for RXRA Gene

  • Retinoid X receptors (RXRs) and retinoic acid receptors (RARs) are nuclear receptors that mediate the biological effects of retinoids by their involvement in retinoic acid-mediated gene activation. These receptors function as transcription factors by binding as homodimers or heterodimers to specific sequences in the promoters of target genes. The protein encoded by this gene is a member of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]

GeneCards Summary for RXRA Gene

RXRA (Retinoid X Receptor, Alpha) is a Protein Coding gene. Diseases associated with RXRA include x-linked adrenal hypoplasia congenita and recessive dystrophic epidermolysis bullosa. Among its related pathways are PI3K-Akt signaling pathway and Pathways in cancer. GO annotations related to this gene include sequence-specific DNA binding transcription factor activity and protein heterodimerization activity. An important paralog of this gene is RXRG.

UniProtKB/Swiss-Prot for RXRA Gene

  • Receptor for retinoic acid. Retinoic acid receptors bind as heterodimers to their target response elements in response to their ligands, all-trans or 9-cis retinoic acid, and regulate gene expression in various biological processes. The RAR/RXR heterodimers bind to the retinoic acid response elements (RARE) composed of tandem 5-AGGTCA-3 sites known as DR1-DR5. The high affinity ligand for RXRs is 9-cis retinoic acid. RXRA serves as a common heterodimeric partner for a number of nuclear receptors. The RXR/RAR heterodimers bind to the retinoic acid response elements (RARE) composed of tandem 5-AGGTCA-3 sites known as DR1-DR5. In the absence of ligand, the RXR-RAR heterodimers associate with a multiprotein complex containing transcription corepressors that induce histone acetylation, chromatin condensation and transcriptional suppression. On ligand binding, the corepressors dissociate from the receptors and associate with the coactivators leading to transcriptional activation. The RXRA/PPARA heterodimer is required for PPARA transcriptional activity on fatty acid oxidation genes such as ACOX1 and the P450 system genes.

Tocris Summary for RXRA Gene

  • Retinoid X receptors (RXR) are members of the NR2B family of nuclear receptors and are common binding partners to many other nuclear receptors, including PPARs, liver X receptors (LXRs) and vitamin D receptors (VDR). RXR heterodimers act as ligand-dependent transcriptional regulators and increase the DNA-binding efficiency of its partner. Despite numerous studies, the physiological role of RXRs have yet to been fully elucidated and, as they can also exist as homodimers, there is the possibility that an independent RXR signaling pathway exists. There are three RXR subtypes; RXRalpha, RXRbeta and RXRgamma, each with two major isoforms (1 and 2). RXRalpha is expressed in the liver, kidney, epidermis and intestine, RXRbeta is widely distributed and RXRgamma is restricted to muscle, pituitary gland and certain parts of the brain.

Gene Wiki entry for RXRA Gene

No data available for PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for RXRA Gene

Genomics for RXRA Gene

Regulatory Elements for RXRA Gene

Epigenetics Products

  • DNA Methylation CpG Assay Predesigned for Pyrosequencing in human,mouse,rat

Genomic Location for RXRA Gene

134,317,098 bp from pter
134,440,585 bp from pter
123,488 bases
Plus strand

Genomic View for RXRA Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for RXRA Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for RXRA Gene

Proteins for RXRA Gene

  • Protein details for RXRA Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Retinoic acid receptor RXR-alpha
    Protein Accession:
    Secondary Accessions:
    • B3KY83
    • Q2NL52
    • Q2V504

    Protein attributes for RXRA Gene

    462 amino acids
    Molecular mass:
    50811 Da
    Quaternary structure:
    • Homodimer. Heterodimer with RARA; required for ligand-dependent retinoic acid receptor transcriptional activity. Heterodimer with PPARA (via the leucine-like zipper in the LBD); the interaction is required for PPARA transcriptional activity. Also heterodimerizes with PPARG. Interacts with NCOA3 and NCOA6 coactivators. Interacts with FAM120B (By similarity). Interacts with PELP1, SENP6, SFPQ, DNTTIP2 and RNF8. Interacts (via the DNA binding domain) with HCV core protein; the interaction enhances the transcriptional activities of the RXRA/RARA and the RXRA/PPARA heterodimers. Interacts with PRMT2. Interacts with ASXL1 (By similarity). Interacts with BHLHE40/DEC1, BHLHE41/DEC2, NCOR1 and NCOR2. Interacts in a ligand-dependent fashion with MED1 and NCOA1.

    Three dimensional structures from OCA and Proteopedia for RXRA Gene

    Alternative splice isoforms for RXRA Gene


neXtProt entry for RXRA Gene

Proteomics data for RXRA Gene at MOPED

Post-translational modifications for RXRA Gene

  • Phosphorylated on serine and threonine residues mainly in the N-terminal modulating domain. Constiutively phosphorylated on Ser-21 in the presence or absence of ligand. Under stress conditions, hyperphosphorylated by activated JNK on Ser-56, Ser-70, Thr-82 and Ser-260 (By similarity). Phosphorylated on Ser-27, in vitro, by PKA. This phosphorylation is required for repression of cAMP-mediated transcriptional activity of RARA.
  • Sumoylation negatively regulates transcriptional activity. Desumoylated specifically by SENP6.
  • Ubiquitination at Lys417
  • Modification sites at PhosphoSitePlus

Other Protein References for RXRA Gene

ENSEMBL proteins:
Reactome Protein details:
REFSEQ proteins:

Antibody Products

  • R&D Systems Antibodies for RXRA (RXR alpha/NR2B1)
  • Cell Signaling Technology (CST) Antibodies for RXRA (RXRA)

No data available for DME Specific Peptides for RXRA Gene

Domains for RXRA Gene

Gene Families for RXRA Gene

Graphical View of Domain Structure for InterPro Entry



  • Composed of three domains: a modulating N-terminal domain (AF1 domain), a DNA-binding domain and a C-terminal ligand-binding domain (AF2 domain)
  • Belongs to the nuclear hormone receptor family. NR2 subfamily.
  • Composed of three domains: a modulating N-terminal domain (AF1 domain), a DNA-binding domain and a C-terminal ligand-binding domain (AF2 domain)
  • Contains 1 nuclear receptor DNA-binding domain.
  • Belongs to the nuclear hormone receptor family. NR2 subfamily.
genes like me logo Genes that share domains with RXRA: view

Function for RXRA Gene

Molecular function for RXRA Gene

GENATLAS Biochemistry:
retinoic acid X receptor binding and activated by 9-cis-retinoic acid,only (9-cis-RA),alpha subunit,regulating cardiac morphogenesis,obligate member of heterodimeric nuclear receptors,steroid/thyroid/retinoic receptor superfamily
UniProtKB/Swiss-Prot Function:
Receptor for retinoic acid. Retinoic acid receptors bind as heterodimers to their target response elements in response to their ligands, all-trans or 9-cis retinoic acid, and regulate gene expression in various biological processes. The RAR/RXR heterodimers bind to the retinoic acid response elements (RARE) composed of tandem 5-AGGTCA-3 sites known as DR1-DR5. The high affinity ligand for RXRs is 9-cis retinoic acid. RXRA serves as a common heterodimeric partner for a number of nuclear receptors. The RXR/RAR heterodimers bind to the retinoic acid response elements (RARE) composed of tandem 5-AGGTCA-3 sites known as DR1-DR5. In the absence of ligand, the RXR-RAR heterodimers associate with a multiprotein complex containing transcription corepressors that induce histone acetylation, chromatin condensation and transcriptional suppression. On ligand binding, the corepressors dissociate from the receptors and associate with the coactivators leading to transcriptional activation. The RXRA/PPARA heterodimer is required for PPARA transcriptional activity on fatty acid oxidation genes such as ACOX1 and the P450 system genes.

Gene Ontology (GO) - Molecular Function for RXRA Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000977 RNA polymerase II regulatory region sequence-specific DNA binding IDA 7831303
GO:0003677 DNA binding IDA 12037571
GO:0003700 contributes_to sequence-specific DNA binding transcription factor activity IDA 17426122
GO:0003707 steroid hormone receptor activity IEA --
GO:0003708 retinoic acid receptor activity TAS 19374686
genes like me logo Genes that share ontologies with RXRA: view
genes like me logo Genes that share phenotypes with RXRA: view

Animal Models for RXRA Gene

MGI Knock Outs for RXRA:

Animal Model Products

miRNA for RXRA Gene

miRTarBase miRNAs that target RXRA
Targeted motifs for RXRA Gene
HOMER Transcription Factor Regulatory Elements motif RXRA
  • Consensus sequence: TAGGGCAAAGGTCA Submotif: DR1 Cell Type: 3T3L1 GEO ID: GSE13511

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for RXRA

In Situ Assay Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) and Transcription Factor Targets for RXRA Gene

Localization for RXRA Gene

Subcellular locations from UniProtKB/Swiss-Prot for RXRA Gene

Subcellular locations from

Jensen Localization Image for RXRA Gene COMPARTMENTS Subcellular localization image for RXRA gene
Compartment Confidence
nucleus 5
golgi apparatus 3
peroxisome 3
extracellular 1

Gene Ontology (GO) - Cellular Components for RXRA Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000790 nuclear chromatin IDA 18511497
GO:0005634 nucleus IDA 19917671
GO:0005654 nucleoplasm TAS --
GO:0043235 receptor complex IDA 17426122
GO:0090575 RNA polymerase II transcription factor complex IDA 17426122
genes like me logo Genes that share ontologies with RXRA: view

Pathways for RXRA Gene

genes like me logo Genes that share pathways with RXRA: view

PCR Array Products

Gene Ontology (GO) - Biological Process for RXRA Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000122 negative regulation of transcription from RNA polymerase II promoter IDA 17426122
GO:0001701 in utero embryonic development IEA --
GO:0001890 placenta development --
GO:0001893 maternal placenta development IEA --
GO:0006355 regulation of transcription, DNA-templated --
genes like me logo Genes that share ontologies with RXRA: view

Drugs for RXRA Gene

(11) Drugbank Compounds for RXRA Gene

Compound Status Synonyms Cas Number PubChem ID Type Actions PubMed IDs
  • (2e,4e,6Z,8e)-3,7-Dimethyl-9-(2,6,6-trimethyl-1-cyclohexen-1-yl)-2,4,6,8-nonatetraenoic acid
5300-03-8 Target agonist approved, investigational
  • 4-[1-(3,5,5,8,8-pentamethyltetralin-2-yl)ethenyl]benzoic acid
153559-49-0 82146 Target agonist approved, investigational
  • (+-)-1,8-Diethyl-1,3,4,9-tetrahydropyrano(3,4-b)indole-1-acetic acid
41340-25-4 3308 Target other approved, investigational
  • (all-e)-9-(4-Methoxy-2,3,6-trimethylphenyl)-3,7-dimethyl-2,4,6,8-nonatetraenoic acid
55079-83-9 Target agonist approved
  • 6-(3-(1-Adamantyl)-4-methoxyphenyl)-2-naphthoic acid
106685-40-9 60164 Target other/unknown approved

(5) Tocris Compounds for RXRA Gene

Compound Action Cas Number
CD 3254 Potent and selective RXRalpha agonist. [196961-43-0]
Docosahexaenoic acid RXR agonist [6217-54-5]
HX 531 Potent RXR antagonist [188844-34-0]
PA 452 RXR antagonist [457657-34-0]
UVI 3003 RXR antagonist [847239-17-2]

(3) ApexBio Compounds for RXRA Gene

Compound Action Cas Number
Acitretin Metabolite of etretinate [55079-83-9]
Adapalene RAR尾 and RAR纬 agonist [106685-40-9]
Bexarotene [153559-49-0]

(5) HMDB Compounds for RXRA Gene

Compound Synonyms Cas Number PubMed IDs
9-cis-Retinoic acid
  • 15-Apo-beta-caroten-15-oate
  • Acetretin
  • Adapaleno [INN-Spanish]
All-trans-retinoic acid
  • (all-E)-3,7-Dimethyl-9-(2,6,6-trimethyl-1-cyclohexen-1-yl)-2,4,6,8-nonatetraenoate

(8) IUPHAR Ligand for RXRA Gene

Ligand Type Action Affinity Pubmed IDs
9-cis-retinoic acid Agonist Agonist 9.7
AGN194204 Agonist Agonist 9.4
LG100268 Agonist Agonist 8.5
LG100754 Antagonist Antagonist 8.47
bexarotene Agonist Agonist 7.54
methoprene acid Agonist Agonist 5.7
SR11237 Agonist Agonist
PA451 Antagonist Antagonist

(34) Novoseek inferred chemical compound relationships for RXRA Gene

Compound -log(P) Hits PubMed IDs
retinoic acid 86.7 93
acyclic retinoid 83.9 2
retinoid 83.1 15
androstane 72.3 5
vitamin d 67.6 32
genes like me logo Genes that share compounds with RXRA: view

Transcripts for RXRA Gene

Unigene Clusters for RXRA Gene

Retinoid X receptor, alpha:
Representative Sequences:

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for RXRA

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for RXRA Gene

ExUns: 1 ^ 2a · 2b ^ 3a · 3b ^ 4a · 4b ^ 5 ^ 6 ^ 7 ^ 8a · 8b
SP1: -
SP2: - - - - - -

Relevant External Links for RXRA Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for RXRA Gene

mRNA expression in normal human tissues for RXRA Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for RXRA Gene

This gene is overexpressed in Whole Blood (4.6).

Protein differential expression in normal tissues for RXRA Gene

This gene is overexpressed in Liver (41.9) and Fetal gut (8.5).

Integrated Proteomics: protein expression from ProteomicsDB, PaxDb, MOPED, and MaxQB for RXRA Gene

SOURCE GeneReport for Unigene cluster for RXRA Gene Hs.590886

mRNA Expression by UniProt/SwissProt for RXRA Gene

Tissue specificity: Highly expressed in liver, also found in lung, kidney and heart
genes like me logo Genes that share expressions with RXRA: view

Primer Products

In Situ Assay Products

No data available for Expression partners for RXRA Gene

Orthologs for RXRA Gene

This gene was present in the common ancestor of animals.

Orthologs for RXRA Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia RXRA 35
  • 91.96 (n)
  • 96.74 (a)
  • 94 (a)
(Canis familiaris)
Mammalia RXRA 35
  • 91.89 (n)
  • 98.25 (a)
  • 92 (a)
(Mus musculus)
Mammalia Rxra 35
  • 88.96 (n)
  • 98.48 (a)
Rxra 16
Rxra 36
  • 97 (a)
(Pan troglodytes)
Mammalia RXRA 35
  • 99.54 (n)
  • 100 (a)
  • 100 (a)
(Rattus norvegicus)
Mammalia Rxra 35
  • 89.39 (n)
  • 98.48 (a)
(Monodelphis domestica)
Mammalia RXRA 36
  • 92 (a)
(Ornithorhynchus anatinus)
Mammalia RXRA 36
  • 97 (a)
(Gallus gallus)
Aves RXRA 35
  • 86.08 (n)
  • 96.32 (a)
  • 95 (a)
(Anolis carolinensis)
Reptilia RXRA 36
  • 92 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia rxra 35
  • 79.81 (n)
  • 91.41 (a)
Str.60 35
African clawed frog
(Xenopus laevis)
Amphibia rxra-A 35
(Danio rerio)
Actinopterygii rxraa 35
  • 77.11 (n)
  • 88.89 (a)
rxrg 35
rxraa 36
  • 81 (a)
rxrab 36
  • 89 (a)
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.9980 35
fruit fly
(Drosophila melanogaster)
Insecta usp 37
  • 47 (a)
usp 35
  • 62.59 (n)
  • 57.61 (a)
usp 36
  • 40 (a)
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP002095 35
  • 61.68 (n)
  • 57.78 (a)
(Caenorhabditis elegans)
Secernentea nhr-14 37
  • 31 (a)
nhr-17 37
  • 30 (a)
sea squirt
(Ciona intestinalis)
Ascidiacea Cin.304 35
sea squirt
(Ciona savignyi)
Ascidiacea CSA.10537 36
  • 54 (a)
Species with no ortholog for RXRA:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for RXRA Gene

Gene Tree for RXRA (if available)
Gene Tree for RXRA (if available)

Paralogs for RXRA Gene

Paralogs for RXRA Gene

genes like me logo Genes that share paralogs with RXRA: view

Variants for RXRA Gene

Sequence variations from dbSNP and Humsavar for RXRA Gene

SNP ID Clin Chr 09 pos Sequence Context AA Info Type MAF
rs34492271 -- 134,427,480(+) CCACG(G/T)TGATG intron-variant
rs34488070 -- 134,401,023(+) GCAGG(C/G)GCCGC intron-variant
rs34484722 -- 134,433,662(+) TTTCC(A/G)CAGGG intron-variant
rs34473418 -- 134,433,488(+) AGGCC(-/AGAGTGGCATTCACAGGGGGTCCGTGGGGGC)AAGGT intron-variant
rs34469011 -- 134,431,093(+) CACAG(C/G)GGAGA intron-variant

Structural Variations from Database of Genomic Variants (DGV) for RXRA Gene

Variant ID Type Subtype PubMed ID
esv2739138 CNV Deletion 23290073
nsv831750 CNV Gain+Loss 17160897
dgv8346n71 CNV Loss 21882294
nsv894159 CNV Gain 21882294
dgv8347n71 CNV Loss 21882294
nsv469908 CNV Loss 18288195
nsv466633 CNV Loss 19166990
nsv894163 CNV Loss 21882294
dgv8348n71 CNV Loss 21882294
nsv466634 CNV Loss 19166990
nsv894166 CNV Gain 21882294
nsv825150 CNV Gain 20364138
esv27796 CNV Loss 19812545
nsv511426 CNV Gain 21212237
dgv8349n71 CNV Loss 21882294
esv1003062 CNV Insertion 20482838
esv1103609 CNV Insertion 17803354
nsv894175 CNV Loss 21882294
esv2561499 CNV Insertion 19546169
nsv512999 CNV Insertion 21212237
nsv894176 CNV Loss 21882294
nsv894177 CNV Loss 21882294
nsv428227 CNV Gain 18775914
nsv831751 CNV Loss 17160897
nsv466635 CNV Loss 19166990
nsv831752 CNV Loss 17160897
esv2673192 CNV Deletion 23128226
nsv466636 CNV Loss 19166990
nsv894178 CNV Loss 21882294
esv2739209 CNV Deletion 23290073
esv2105964 CNV Deletion 18987734
nsv825151 CNV Gain 20364138
nsv825152 CNV Gain 20364138
nsv825153 CNV Loss 20364138

Relevant External Links for RXRA Gene

HapMap Linkage Disequilibrium report

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for RXRA Gene

Disorders for RXRA Gene

(17) Novoseek inferred disease relationships for RXRA Gene

Disease -log(P) Hits PubMed IDs
carcinoma embryonal 33.2 2
choriocarcinoma 29.8 1
hepatocellular carcinoma 27.1 5
cancer 23.2 4
colon cancer 3.54 2

Relevant External Links for RXRA

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
genes like me logo Genes that share disorders with RXRA: view

No data available for OMIM , UniProtKB/Swiss-Prot , University of Copenhagen DISEASES and Genatlas for RXRA Gene

Publications for RXRA Gene

  1. Vitamin D-related genes, serum vitamin D concentrations and prostate cancer risk. (PMID: 19255064) Ahn J. … Hayes R.B. (Carcinogenesis 2009) 3 23 48
  2. RXRA gene variations influence Alzheimer's disease risk and cholesterol metabolism. (PMID: 19374686) KAPlsch H. … Heun R. (J. Cell. Mol. Med. 2009) 3 23 48
  3. Nuclear receptor that identifies a novel retinoic acid response pathway. (PMID: 2159111) Mangelsdorf D.J. … Evans R.M. (Nature 1990) 2 3 4
  4. Analysis of SNPs and haplotypes in vitamin D pathway genes and renal cancer risk. (PMID: 19753122) Karami S. … Moore L.E. (PLoS ONE 2009) 3 23 48
  5. 9-cis-retinoic acid up-regulates expression of transcriptional coregulator PELP1, a novel coactivator of the retinoid X receptor alpha pathway. (PMID: 16574651) Singh R.R. … Kumar R. (J. Biol. Chem. 2006) 3 4 23

Products for RXRA Gene

  • Addgene plasmids for RXRA

Sources for RXRA Gene

Back to Top
