Free for academic non-profit institutions. Other users need a Commercial license

Aliases for RUNDC3A Gene

Aliases for RUNDC3A Gene

  • RUN Domain Containing 3A 2 3
  • RPIP8 3 4 6
  • Rap2-Interacting Protein 8 3 4
  • RAP2IP 3 4
  • RPIP-8 3 4
  • RUN Domain-Containing Protein 3A 3
  • RaP2 Interacting Protein 8 3

External Ids for RUNDC3A Gene

Previous GeneCards Identifiers for RUNDC3A Gene

  • GC17P039743
  • GC17P042385
  • GC17P038149

Summaries for RUNDC3A Gene

GeneCards Summary for RUNDC3A Gene

RUNDC3A (RUN Domain Containing 3A) is a Protein Coding gene. An important paralog of this gene is RUFY2.

UniProtKB/Swiss-Prot for RUNDC3A Gene

  • May act as an effector of RAP2A in neuronal cells.

Gene Wiki entry for RUNDC3A Gene

No data available for Entrez Gene Summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for RUNDC3A Gene

Genomics for RUNDC3A Gene

Regulatory Elements for RUNDC3A Gene

Epigenetics Products

  • DNA Methylation CpG Assay Predesigned for Pyrosequencing in human,mouse,rat

Genomic Location for RUNDC3A Gene

44,308,413 bp from pter
44,318,671 bp from pter
10,259 bases
Plus strand

Genomic View for RUNDC3A Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for RUNDC3A Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for RUNDC3A Gene

Proteins for RUNDC3A Gene

  • Protein details for RUNDC3A Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    RUN domain-containing protein 3A
    Protein Accession:
    Secondary Accessions:
    • B2R974
    • O15483
    • O60651
    • Q7Z3S2
    • Q9UF50

    Protein attributes for RUNDC3A Gene

    446 amino acids
    Molecular mass:
    49747 Da
    Quaternary structure:
    • Interacts with the GTP-bound form of RAP2A.
    • Sequence=BAD93039.1; Type=Erroneous initiation; Evidence={ECO:0000305};

    Alternative splice isoforms for RUNDC3A Gene


neXtProt entry for RUNDC3A Gene

Proteomics data for RUNDC3A Gene at MOPED

Post-translational modifications for RUNDC3A Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for RUNDC3A Gene

Antibody Products

No data available for DME Specific Peptides for RUNDC3A Gene

Domains for RUNDC3A Gene

Protein Domains for RUNDC3A Gene


Suggested Antigen Peptide Sequences for RUNDC3A Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Contains 1 RUN domain.
  • Belongs to the RUNDC3 family.
  • Contains 1 RUN domain.
  • Belongs to the RUNDC3 family.
genes like me logo Genes that share domains with RUNDC3A: view

No data available for Gene Families for RUNDC3A Gene

Function for RUNDC3A Gene

Molecular function for RUNDC3A Gene

UniProtKB/Swiss-Prot Function:
May act as an effector of RAP2A in neuronal cells.

Gene Ontology (GO) - Molecular Function for RUNDC3A Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 16189514
GO:0030250 guanylate cyclase activator activity IEA --
GO:0030695 GTPase regulator activity TAS 9523700
GO:0051428 peptide hormone receptor binding IEA --
genes like me logo Genes that share ontologies with RUNDC3A: view

Phenotypes for RUNDC3A Gene

genes like me logo Genes that share phenotypes with RUNDC3A: view

Animal Model Products

CRISPR Products

No data available for Enzyme Numbers (IUBMB) , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for RUNDC3A Gene

Localization for RUNDC3A Gene

Subcellular locations from

Jensen Localization Image for RUNDC3A Gene COMPARTMENTS Subcellular localization image for RUNDC3A gene
Compartment Confidence
cytosol 2
mitochondrion 2
cytoskeleton 1
endoplasmic reticulum 1
nucleus 1
peroxisome 1

Gene Ontology (GO) - Cellular Components for RUNDC3A Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005829 cytosol IEA --
GO:0005886 plasma membrane IEA --
genes like me logo Genes that share ontologies with RUNDC3A: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot for RUNDC3A Gene

Pathways for RUNDC3A Gene

SuperPathways for RUNDC3A Gene

No Data Available

Gene Ontology (GO) - Biological Process for RUNDC3A Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007264 small GTPase mediated signal transduction TAS 9523700
GO:0030828 positive regulation of cGMP biosynthetic process --
GO:0031284 positive regulation of guanylate cyclase activity IEA --
genes like me logo Genes that share ontologies with RUNDC3A: view

No data available for Pathways by source for RUNDC3A Gene

Drugs for RUNDC3A Gene

(1) HMDB Compounds for RUNDC3A Gene

Compound Synonyms Cas Number PubMed IDs
Guanosine triphosphate
  • 5'-GTP
genes like me logo Genes that share compounds with RUNDC3A: view

Transcripts for RUNDC3A Gene

Unigene Clusters for RUNDC3A Gene

RUN domain containing 3A:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for RUNDC3A

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for RUNDC3A Gene

ExUns: 1a · 1b · 1c · 1d ^ 2 ^ 3a · 3b · 3c ^ 4 ^ 5a · 5b ^ 6 ^ 7 ^ 8 ^ 9a · 9b · 9c ^ 10a · 10b ^ 11 ^ 12 ^ 13
SP1: -
SP2: -
SP3: -
SP4: -
SP6: - -
SP7: -

Relevant External Links for RUNDC3A Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for RUNDC3A Gene

mRNA expression in normal human tissues for RUNDC3A Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for RUNDC3A Gene

This gene is overexpressed in Brain - Cortex (6.1), Brain - Frontal Cortex (BA9) (5.2), Brain - Anterior cingulate cortex (BA24) (5.2), Brain - Hippocampus (4.5), and Brain - Amygdala (4.4).

Protein differential expression in normal tissues for RUNDC3A Gene

This gene is overexpressed in Frontal cortex (32.3), Fetal Brain (17.7), and Retina (15.5).

Integrated Proteomics: protein expression from ProteomicsDB, PaxDb, and MOPED for RUNDC3A Gene

SOURCE GeneReport for Unigene cluster for RUNDC3A Gene Hs.500197

genes like me logo Genes that share expressions with RUNDC3A: view

Expression partners for RUNDC3A Gene

* - Elite partner

Primer Products

In Situ Assay Products

No data available for mRNA Expression by UniProt/SwissProt for RUNDC3A Gene

Orthologs for RUNDC3A Gene

This gene was present in the common ancestor of animals.

Orthologs for RUNDC3A Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia RUNDC3A 35
  • 93.65 (n)
  • 97.28 (a)
  • 97 (a)
(Canis familiaris)
Mammalia RUNDC3A 35
  • 94.77 (n)
  • 97.76 (a)
  • 98 (a)
(Mus musculus)
Mammalia Rundc3a 35
  • 90.96 (n)
  • 96.41 (a)
Rundc3a 16
Rundc3a 36
  • 96 (a)
(Pan troglodytes)
Mammalia RUNDC3A 35
  • 97.41 (n)
  • 97.33 (a)
  • 99 (a)
(Rattus norvegicus)
Mammalia Rundc3a 35
  • 90.81 (n)
  • 96.64 (a)
(Monodelphis domestica)
Mammalia RUNDC3A 36
  • 86 (a)
(Ornithorhynchus anatinus)
Mammalia RUNDC3A 36
  • 73 (a)
(Gallus gallus)
Aves RUNDC3A 36
  • 83 (a)
(Anolis carolinensis)
Reptilia RUNDC3A 36
  • 81 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia rundc3a 35
  • 74.02 (n)
  • 80 (a)
African clawed frog
(Xenopus laevis)
Amphibia Xl.15517 35
(Danio rerio)
Actinopterygii rundc3ab 35
  • 69.24 (n)
  • 73.13 (a)
zgc55922 35
RUNDC3A (2 of 2) 36
  • 72 (a)
rundc3ab 36
  • 73 (a)
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.6033 35
fruit fly
(Drosophila melanogaster)
Insecta CG31064 36
  • 11 (a)
Species with no ortholog for RUNDC3A:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for RUNDC3A Gene

Gene Tree for RUNDC3A (if available)
Gene Tree for RUNDC3A (if available)

Paralogs for RUNDC3A Gene

Paralogs for RUNDC3A Gene

(2) SIMAP similar genes for RUNDC3A Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with RUNDC3A: view

Variants for RUNDC3A Gene

Sequence variations from dbSNP and Humsavar for RUNDC3A Gene

SNP ID Clin Chr 17 pos Sequence Context AA Info Type MAF
rs569311867 -- 44,311,329(+) TGCCA(A/G)GAGGC intron-variant, nc-transcript-variant
rs569158762 -- 44,316,797(+) AAGGC(A/C)TGTCC intron-variant
rs568817345 -- 44,313,896(+) AACTC(C/T)CAACC intron-variant, nc-transcript-variant
rs568627262 -- 44,316,985(+) GCGCA(-/GCTAATTTGTGTATTTTTAGTAGAGACGCGCG)GCTAA intron-variant
rs568120443 -- 44,314,680(+) GGGGG(C/G)GGGGG intron-variant, nc-transcript-variant

Structural Variations from Database of Genomic Variants (DGV) for RUNDC3A Gene

Variant ID Type Subtype PubMed ID
nsv908270 CNV Loss 21882294
nsv510713 CNV Loss 20534489
nsv908275 CNV Loss 21882294
dgv3175n71 CNV Loss 21882294
nsv908278 CNV Loss 21882294
nsv2061 CNV Insertion 18451855

Relevant External Links for RUNDC3A Gene

HapMap Linkage Disequilibrium report

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for RUNDC3A Gene

Disorders for RUNDC3A Gene

(1) University of Copenhagen DISEASES for RUNDC3A Gene

genes like me logo Genes that share disorders with RUNDC3A: view

No data available for MalaCards , OMIM , UniProtKB/Swiss-Prot , Novoseek inferred disease relationships , Genatlas and External Links for RUNDC3A Gene

Publications for RUNDC3A Gene

  1. Identification of a specific effector of the small GTP-binding protein Rap2. (PMID: 9523700) Janoueix-Lerosey I. … de Gunzburg J. (Eur. J. Biochem. 1998) 2 3 4 23
  2. Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. (PMID: 8125298) Maruyama K. … Sugano S. (Gene 1994) 3
  3. A "double adaptor" method for improved shotgun library construction. (PMID: 8619474) Andersson B. … Gibbs R.A. (Anal. Biochem. 1996) 3
  4. Large-scale concatenation cDNA sequencing. (PMID: 9110174) Yu W. … Gibbs R.A. (Genome Res. 1997) 3
  5. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PMID: 12477932) Strausberg R.L. … Marra M.A. (Proc. Natl. Acad. Sci. U.S.A. 2002) 3

Products for RUNDC3A Gene

Sources for RUNDC3A Gene

Back to Top
