Free for academic non-profit institutions. Other users need a Commercial license

Aliases for RSPH1 Gene

Aliases for RSPH1 Gene

  • Radial Spoke Head 1 Homolog 2 3 5
  • Meichroacidin 2 3 4
  • Male Meiotic Metaphase Chromosome-Associated Acidic Protein 3 4
  • Cancer/Testis Antigen 79 3 4
  • TSGA2 3 4
  • CT79 3 4
  • TSA2 3 4
  • Radial Spoke Head 1 Homolog (Chlamydomonas) 2
  • Testis Specific A2 Homolog (Mouse) 2
  • Testes Specific Gene A2 Homolog 3
  • Testis-Specific Gene A2 Protein 4
  • Testis Specific A2 Homolog 3
  • RSPH10A 3
  • RSP44 3

External Ids for RSPH1 Gene

Previous HGNC Symbols for RSPH1 Gene

  • TSGA2

Previous GeneCards Identifiers for RSPH1 Gene

  • GC21M042766
  • GC21M043892
  • GC21M029310

Summaries for RSPH1 Gene

Entrez Gene Summary for RSPH1 Gene

  • This gene encodes a male meiotic metaphase chromosome-associated acidic protein. This gene is expressed in tissues with motile cilia or flagella, including the trachea, lungs, airway brushings, and testes. Mutations in this gene result in primary ciliary dyskinesia-24. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]

GeneCards Summary for RSPH1 Gene

RSPH1 (Radial Spoke Head 1 Homolog) is a Protein Coding gene. Diseases associated with RSPH1 include Ciliary Dyskinesia, Primary, 24 and Ciliary Dyskinesia, Primary, 1. An important paralog of this gene is RSPH10B.

UniProtKB/Swiss-Prot for RSPH1 Gene

  • May play an important role in male meiosis (By similarity). It is necessary for proper building of the axonemal central pair and radial spokes.

Gene Wiki entry for RSPH1 Gene

Additional gene information for RSPH1 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for RSPH1 Gene

Genomics for RSPH1 Gene

GeneHancer (GH) Regulatory Elements for RSPH1 Gene

Promoters and enhancers for RSPH1 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH21I042490 Promoter/Enhancer 2.2 EPDnew Ensembl ENCODE dbSUPER 567.4 +2.5 2495 7.4 HDGF PKNOX1 ATF1 ARID4B NEUROD1 SIN3A YY1 GLIS2 ELK1 ZNF143 RSPH1 SLC37A1 ENSG00000235772 WDR4 PRDM15 LOC101930094 RNU6-1149P
GH21I042522 Enhancer 1.3 Ensembl ENCODE dbSUPER 24.8 -29.7 -29665 6.5 HDGF ATF1 FEZF1 ZNF48 YY1 ATF7 RUNX3 RXRA JUNB REST SLC37A1 ENSG00000235772 RSPH1 LOC101930094 TFF2 ENSG00000231867
GH21I042512 Promoter/Enhancer 1.9 Ensembl ENCODE dbSUPER 16 -19.8 -19762 6.7 HDGF PKNOX1 CLOCK NEUROD1 SIN3A BRCA1 ZNF121 GLIS2 ZNF207 FOS SLC37A1 ENSG00000235772 RSPH1 PKNOX1 TFF2 ENSG00000227698 ENSG00000231867
GH21I042457 Enhancer 1.6 FANTOM5 Ensembl ENCODE dbSUPER 17.9 +34.5 34458 8.7 HDGF ATF1 FOXA2 PKNOX1 YY1 TCF12 ZNF207 ATF7 FOS RUNX3 SLC37A1 RSPH1 ZBTB21 PRDM15 LOC101930094 ABCG1 TFF2 WDR4 UMODL1 UBASH3A
GH21I042531 Enhancer 1.6 FANTOM5 Ensembl ENCODE dbSUPER 12.8 -37.9 -37898 5 HDGF FOXA2 PKNOX1 ATF1 SMAD1 ATF7 RUNX3 RXRA JUNB REST SLC37A1 ENSG00000235772 RSPH1 LOC101928284 TFF2 ABCG1 PKNOX1 ENSG00000231867
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around RSPH1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the RSPH1 gene promoter:

Genomic Locations for RSPH1 Gene

Genomic Locations for RSPH1 Gene
chr21:42,472,486-42,496,354
(GRCh38/hg38)
Size:
23,869 bases
Orientation:
Minus strand
chr21:43,892,596-43,916,464
(GRCh37/hg19)

Genomic View for RSPH1 Gene

Genes around RSPH1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
RSPH1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for RSPH1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for RSPH1 Gene

Proteins for RSPH1 Gene

  • Protein details for RSPH1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q8WYR4-RSPH1_HUMAN
    Recommended name:
    Radial spoke head 1 homolog
    Protein Accession:
    Q8WYR4
    Secondary Accessions:
    • A8MWV0
    • B2RBN9
    • Q3MJA1

    Protein attributes for RSPH1 Gene

    Size:
    309 amino acids
    Molecular mass:
    35124 Da
    Quaternary structure:
    No Data Available

    Alternative splice isoforms for RSPH1 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for RSPH1 Gene

Post-translational modifications for RSPH1 Gene

No Post-translational modifications

Other Protein References for RSPH1 Gene

No data available for DME Specific Peptides for RSPH1 Gene

Domains & Families for RSPH1 Gene

Gene Families for RSPH1 Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins

Protein Domains for RSPH1 Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for RSPH1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with RSPH1: view

No data available for UniProtKB/Swiss-Prot for RSPH1 Gene

Function for RSPH1 Gene

Molecular function for RSPH1 Gene

UniProtKB/Swiss-Prot Function:
May play an important role in male meiosis (By similarity). It is necessary for proper building of the axonemal central pair and radial spokes.

Gene Ontology (GO) - Molecular Function for RSPH1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 25416956
genes like me logo Genes that share ontologies with RSPH1: view
genes like me logo Genes that share phenotypes with RSPH1: view

Human Phenotype Ontology for RSPH1 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for RSPH1 Gene

MGI Knock Outs for RSPH1:

Animal Model Products

miRNA for RSPH1 Gene

miRTarBase miRNAs that target RSPH1

Clone Products

No data available for Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Transcription Factor Targets and HOMER Transcription for RSPH1 Gene

Localization for RSPH1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for RSPH1 Gene

Cytoplasm. Cell projection, cilium. Note=Cytoplasmic in late spermatocytes, secondary spermatocytes and round spermatids. Gathered around metaphase chromosomes during meiotic divisions (By similarity). {ECO:0000250}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for RSPH1 gene
Compartment Confidence
nucleus 5
cytosol 5
cytoskeleton 3
extracellular 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for RSPH1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000794 condensed nuclear chromosome IEA --
GO:0001520 outer dense fiber IEA --
GO:0005634 nucleus IDA,HDA 16780588
GO:0005737 cytoplasm IEA --
GO:0005829 cytosol HDA,IDA 16780588
genes like me logo Genes that share ontologies with RSPH1: view

Pathways & Interactions for RSPH1 Gene

SuperPathways for RSPH1 Gene

No Data Available

Gene Ontology (GO) - Biological Process for RSPH1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007286 spermatid development IEA --
GO:0035082 axoneme assembly IMP 23993197
GO:0051321 meiotic cell cycle IEA --
genes like me logo Genes that share ontologies with RSPH1: view

No data available for Pathways by source and SIGNOR curated interactions for RSPH1 Gene

Drugs & Compounds for RSPH1 Gene

No Compound Related Data Available

Transcripts for RSPH1 Gene

Unigene Clusters for RSPH1 Gene

Radial spoke head 1 homolog (Chlamydomonas):
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for RSPH1 Gene

ExUns: 1a · 1b · 1c ^ 2 ^ 3 ^ 4a · 4b ^ 5 ^ 6 ^ 7 ^ 8 ^ 9
SP1: -
SP2: - -
SP3:

Relevant External Links for RSPH1 Gene

GeneLoc Exon Structure for
RSPH1
ECgene alternative splicing isoforms for
RSPH1

Expression for RSPH1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for RSPH1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for RSPH1 Gene

This gene is overexpressed in Brain - Caudate (basal ganglia) (x4.8), Brain - Nucleus accumbens (basal ganglia) (x4.5), Pituitary (x4.5), Testis (x4.3), and Brain - Hypothalamus (x4.0).

Protein differential expression in normal tissues from HIPED for RSPH1 Gene

This gene is overexpressed in Testis (57.6) and Ovary (11.4).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for RSPH1 Gene



Protein tissue co-expression partners for RSPH1 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of RSPH1 Gene:

RSPH1

SOURCE GeneReport for Unigene cluster for RSPH1 Gene:

Hs.661069

mRNA Expression by UniProt/SwissProt for RSPH1 Gene:

Q8WYR4-RSPH1_HUMAN
Tissue specificity: Expressed in trachea, lungs, airway brushings, and testes.

Evidence on tissue expression from TISSUES for RSPH1 Gene

  • Nervous system(4.3)
  • Lung(3.1)

Phenotype-based relationships between genes and organs from Gene ORGANizer for RSPH1 Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • cardiovascular
  • digestive
  • endocrine
  • immune
  • integumentary
  • lymphatic
  • nervous
  • reproductive
  • respiratory
  • skeleton
  • urinary
Organs:
Head and neck:
  • brain
  • cranial nerve
  • ear
  • epiglottis
  • eye
  • head
  • larynx
  • meninges
  • middle ear
  • mouth
  • neck
  • nose
  • olfactory bulb
  • outer ear
  • pharynx
  • sinus
  • skull
Thorax:
  • bronchus
  • lung
  • trachea
Abdomen:
  • spleen
Pelvis:
  • ovary
  • testicle
General:
  • blood
  • blood vessel
  • peripheral nervous system
  • white blood cell
genes like me logo Genes that share expression patterns with RSPH1: view

Orthologs for RSPH1 Gene

This gene was present in the common ancestor of animals.

Orthologs for RSPH1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia RSPH1 33 34
  • 98.81 (n)
cow
(Bos Taurus)
Mammalia RSPH1 33 34
  • 81.44 (n)
dog
(Canis familiaris)
Mammalia RSPH1 33 34
  • 81 (n)
mouse
(Mus musculus)
Mammalia Rsph1 33 16 34
  • 80.27 (n)
rat
(Rattus norvegicus)
Mammalia Rsph1 33
  • 78.64 (n)
oppossum
(Monodelphis domestica)
Mammalia RSPH1 34
  • 66 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia RSPH1 34
  • 61 (a)
OneToOne
chicken
(Gallus gallus)
Aves RSPH1 33 34
  • 66.14 (n)
lizard
(Anolis carolinensis)
Reptilia RSPH1 34
  • 63 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia LOC100489385 33
  • 65.66 (n)
African clawed frog
(Xenopus laevis)
Amphibia Xl.13352 33
zebrafish
(Danio rerio)
Actinopterygii LOC101886817 33
  • 65.53 (n)
RSPH1 34
  • 64 (a)
OneToOne
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.10498 33
fruit fly
(Drosophila melanogaster)
Insecta CG5458 34
  • 29 (a)
OneToOne
sea squirt
(Ciona savignyi)
Ascidiacea CSA.352 34
  • 52 (a)
OneToOne
sea squirt
(Ciona intestinalis)
Ascidiacea Cin.382 33
Species where no ortholog for RSPH1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for RSPH1 Gene

ENSEMBL:
Gene Tree for RSPH1 (if available)
TreeFam:
Gene Tree for RSPH1 (if available)

Paralogs for RSPH1 Gene

Paralogs for RSPH1 Gene

(3) SIMAP similar genes for RSPH1 Gene using alignment to 2 proteins:

genes like me logo Genes that share paralogs with RSPH1: view

Variants for RSPH1 Gene

Sequence variations from dbSNP and Humsavar for RSPH1 Gene

SNP ID Clin Chr 21 pos Variation AA Info Type
rs1064792947 pathogenic, Primary ciliary dyskinesia 42,482,620(-) CATGCTCCGCAACTTACCAT/CAT coding_sequence_variant, intron_variant, splice_donor_variant
rs116480603 benign, Primary ciliary dyskinesia 42,493,014(-) G/A coding_sequence_variant, intron_variant, synonymous_variant
rs117797631 benign, Primary ciliary dyskinesia 42,485,720(-) G/A coding_sequence_variant, synonymous_variant
rs137935071 uncertain-significance, Primary ciliary dyskinesia 42,477,291(-) T/C coding_sequence_variant, missense_variant
rs138007679 benign, Primary ciliary dyskinesia 42,477,368(-) A/C/G coding_sequence_variant, missense_variant

Structural Variations from Database of Genomic Variants (DGV) for RSPH1 Gene

Variant ID Type Subtype PubMed ID
dgv713e201 CNV deletion 23290073
esv2723549 CNV deletion 23290073
nsv522001 CNV gain 19592680
nsv587632 CNV loss 21841781
nsv587633 CNV gain 21841781
nsv819777 CNV loss 19587683
nsv834103 CNV gain 17160897

Variation tolerance for RSPH1 Gene

Residual Variation Intolerance Score: 94.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 4.10; 61.06% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for RSPH1 Gene

Human Gene Mutation Database (HGMD)
RSPH1
SNPedia medical, phenotypic, and genealogical associations of SNPs for
RSPH1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for RSPH1 Gene

Disorders for RSPH1 Gene

MalaCards: The human disease database

(6) MalaCards diseases for RSPH1 Gene - From: HGMD, OMIM, ClinVar, GTR, Swiss-Prot, DISEASES, and GeneCards

- elite association - COSMIC cancer census association via MalaCards
Search RSPH1 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

RSPH1_HUMAN
  • Ciliary dyskinesia, primary, 24 (CILD24) [MIM:615481]: A disorder characterized by abnormalities of motile cilia. Respiratory infections leading to chronic inflammation and bronchiectasis are recurrent, due to defects in the respiratory cilia. Situs inversus is not observed in CILD24 patients. {ECO:0000269 PubMed:23993197, ECO:0000269 PubMed:25186273}. Note=The disease is caused by mutations affecting the gene represented in this entry. RSPH1 mutations result in a primary ciliary diskinesia phenotype with defects of the radial spokes and the axonemal central pair of microtubules (PubMed:23993197). {ECO:0000269 PubMed:23993197}.

Additional Disease Information for RSPH1

genes like me logo Genes that share disorders with RSPH1: view

No data available for Genatlas for RSPH1 Gene

Publications for RSPH1 Gene

  1. Radial spoke protein 44 (human meichroacidin) is an axonemal alloantigen of sperm and cilia. (PMID: 17451891) Shetty J … Herr JC (Gene 2007) 2 3 22 58
  2. Molecular cloning and characterization of meichroacidin (male meiotic metaphase chromosome-associated acidic protein). (PMID: 9578619) Tsuchida J … Nishimune Y (Developmental biology 1998) 2 3 4 58
  3. Loss-of-function mutations in RSPH1 cause primary ciliary dyskinesia with central-complex and radial-spoke defects. (PMID: 23993197) Kott E … Amselem S (American journal of human genetics 2013) 3 4 58
  4. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 58
  5. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58

Products for RSPH1 Gene

Sources for RSPH1 Gene

Content
Loading form....