Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

RPSAP58 Gene

pseudogene   GIFtS: 33
GCID: GC19P023946

Ribosomal Protein SA Pseudogene 58

  Search for RPSAP58
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

This gene clusters with an RNA gene
Subcategory (RNA class): lncRNA

Quality score for the ORGUL clustered with this gene is 3

Aliases
Ribosomal Protein SA Pseudogene 581 2     67 KDa Laminin Receptor4
RPSA_30_16422     RPSA4
37 KDa Laminin Receptor Precursor4     Laminin Receptor 14
37/67 KDa Laminin Receptor4     Laminin-Binding Protein Precursor P404

External Ids:    HGNC: 368091   Entrez Gene: 3885242   Ensembl: ENSG000002052467   UniProtKB: A6NE094   UniProtKB: C9JQR94   
ORGUL members:         
NONCODE14:n406201      

Export aliases for RPSAP58 gene to outside databases

Previous GC identifers: GC19U901020 GC19P023490


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

GeneCards Summary for RPSAP58 Gene: 
RPSAP58 (ribosomal protein SA pseudogene 58) is a pseudogene, and is affiliated with the lncRNA class. An important paralog of this gene is RPSA.

UniProtKB/TrEMBL: C9JQR9
Function: Required for the assembly and/or stability of the 40S ribosomal subunit. Required for the processing of
the 20S rRNA-precursor to mature 18S rRNA in a late step of the maturation of 40S ribosomal subunits (By
similarity)




(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 73), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000019.9  NC_018930.2  NT_011295.11  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the RPSAP58 gene promoter:
         NF-YA   AREB6   NF-YB   CBF-A   CBF-B   CP1A   NF-Y   CBF(2)   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidRPSAP58 promoter sequence
   Search SABiosciences Chromatin IP Primers for RPSAP58

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat RPSAP58


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 19p12   Ensembl cytogenetic band:  19p12   HGNC cytogenetic band: 19p12

RPSAP58 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
RPSAP58 gene location

GeneLoc information about chromosome 19         GeneLoc Exon Structure

GeneLoc location for GC19P023946:  view genomic region     (about GC identifiers)

Start:
23,945,807 bp from pter      End:
24,010,937 bp from pter
Size:
65,131 bases      Orientation:
plus strand

(According to UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MAXQB RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Ontologies according to Gene Ontology Consortium 01 Oct 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

UniProtKB/TrEMBL: A6NE09 (See protein sequence)
Recommended Name: 40S ribosomal protein SA  
Size: 295 amino acids; 32909 Da
Subunit: Monomer (37LRP) and homodimer (67LR). Component of the small ribosomal subunit. Mature ribosomes consist
of a small (40S) and a large (60S) subunit. The 40S subunit contains about 33 different proteins and 1 molecule
of RNA (18S). The 60S subunit contains about 49 different proteins and 3 molecules of RNA (28S, 5.8S and 5S).
Interacts with RPS21. Interacts with several laminins including at least LAMB1. Interacts with MDK. The mature
dimeric form interacts with PPP1R16B (via its fourth ankyrin repeat). Interacts with PPP1CA only in the presence
of PPP1R16B (By similarity)
Subcellular location: Cell membrane. Cytoplasm. Nucleus. Note=67LR is found at the surface of the plasma membrane,
with its C-terminal laminin-binding domain accessible to extracellular ligands. 37LRP is found at the cell
surface, in the cytoplasm and in the nucleus. Co-localizes with PPP1R16B in the cell membrane (By similarity)
Miscellaneous: This protein appears to have acquired a second function as a laminin receptor specifically in the
vertebrate lineage (By similarity)
Caution: The sequence shown here is derived from an Ensembl automatic analysis pipeline and should be considered
as preliminary data

UniProtKB/TrEMBL: C9JQR9 (See protein sequence)

Recommended Name: Protein RPSAP58  
Size: 73 amino acids; 8250 Da
Caution: The sequence shown here is derived from an Ensembl automatic analysis pipeline and should be considered
as preliminary data

Explore proteomics data for RPSAP58 at MOPED 

Post-translational modifications:

  • UniProtKB: Acylated. Acylation may be a prerequisite for conversion of the monomeric 37 kDa laminin receptor precursor
    (37LRP) to the mature dimeric 67 kDa laminin receptor (67LR), and may provide a mechanism for membrane
    association (By similarity)
  • UniProtKB: Cleaved by stromelysin-3 (ST3) at the cell surface. Cleavage by stromelysin-3 may be a mechanism to alter
    cell-extracellular matrix interactions (By similarity)
  • View neXtProt modification sites for NX_C9JQR9

  • RPSAP58 Protein expression data from MOPED1, PaxDb2 and MAXQB3 :    About this image 

    RPSAP58 Protein Expression

    ENSEMBL proteins: 
     ENSP00000420173   ENSP00000417240   ENSP00000346598  

    Human Recombinant Protein Products for RPSAP58: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    Browse OriGene Protein Over-expression Lysates
    OriGene Custom MassSpec 
    OriGene Custom Protein Services for RPSAP58
    GenScript Custom Purified and Recombinant Proteins Services for RPSAP58
    Novus Biologicals RPSAP58 Protein
    Novus Biologicals RPSAP58 Lysate
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates 
    Browse ProSpec Recombinant Proteins
    Browse Proteins at Cloud-Clone Corp. 

    Gene Ontology (GO): 5/6 cellular component terms (GO ID links to tree view) (see all 6):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005622intracellular ----
    GO:0005634nucleus ----
    GO:0005840ribosome ----
    GO:0005886plasma membrane ----
    GO:0015935small ribosomal subunit ----

    RPSAP58 for ontologies           About GeneDecksing



    RPSAP58 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for RPSAP58
    GenScript Custom Superior Antibodies Services for RPSAP58
    Novus Biologicals RPSAP58 Antibodies
    Search for Antibodies for RPSAP58 at Abcam
    Browse Antibodies at Cloud-Clone Corp. 
    Search ThermoFisher Antibodies for RPSAP58
    Search LSBio for Antibodies for RPSAP58 

    Assay Products for RPSAP58: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for RPSAP58
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for RPSAP58
    Browse Enzo Life Sciences for kits & assays
    Browse ELISAs at Cloud-Clone Corp. 
    Browse CLIAs at Cloud-Clone Corp.


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section
    5/6 InterPro protein domains (see all 6):
     IPR018130 Ribosomal_S2_CS
     IPR027504 40S_ribosomal_SA
     IPR001865 Ribosomal_S2
     IPR023591 Ribosomal_S2_flav_dom
     IPR027498 Ribosomal_S2_euk

    Graphical View of Domain Structure for InterPro Entry A6NE09
    Graphical View of Domain Structure for InterPro Entry C9JQR9

    ProtoNet protein and cluster: A6NE09

    UniProtKB/TrEMBL: A6NE09
    Similarity: Belongs to the ribosomal protein S2P family

    UniProtKB/TrEMBL: C9JQR9
    Similarity: Belongs to the ribosomal protein S2P family


    RPSAP58 for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, Vector BioLabs, and Sirion Biotech, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene.)
    About This Section

    Molecular Function:

         UniProtKB/TrEMBL Summary: A6NE09
    Function: Required for the assembly and/or stability of the 40S ribosomal subunit. Required for the processing of
    the 20S rRNA-precursor to mature 18S rRNA in a late step of the maturation of 40S ribosomal subunits. Also
    functions as a cell surface receptor for laminin. Plays a role in cell adhesion to the basement membrane and in
    the consequent activation of signaling transduction pathways. May play a role in cell fate determination and
    tissue morphogenesis. Also acts as a receptor for several other ligands, including the pathogenic prion protein,
    viruses, and bacteria. Acts as a PPP1R16B-dependent substrate of PPP1CA (By similarity)

         UniProtKB/TrEMBL: C9JQR9
    Function: Required for the assembly and/or stability of the 40S ribosomal subunit. Required for the processing of
    the 20S rRNA-precursor to mature 18S rRNA in a late step of the maturation of 40S ribosomal subunits (By
    similarity)

         Gene Ontology (GO): 3 molecular function terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0003735structural constituent of ribosome ----
    GO:0005055laminin receptor activity ----
    GO:0043236laminin binding ----
         
    RPSAP58 for ontologies           About GeneDecksing


    Animal Models:
       inGenious Targeting Laboratory - Custom generated mouse model solutions for RPSAP58 
       inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for RPSAP58

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for RPSAP58 
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for RPSAP58 

    miRNA
    Products:
        
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat RPSAP58
    Search QIAGEN for miScript miRNA Assays for microRNAs that regulate RPSAP58
    SwitchGear 3'UTR luciferase reporter plasmidRPSAP58 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for RPSAP58
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat RPSAP58

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for RPSAP58
    Sirion Biotech Customized adenovirus for overexpression of RPSAP58

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    Browse OriGene untagged/tagged cDNA clones in CMV expression vector
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript Custom all cDNA clones Services for RPSAP58
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for RPSAP58
    Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat RPSAP58
    Sirion Biotech Customized lentivirus for stable overexpression of RPSAP58 
                         Customized lentivirus expression plasmids for stable overexpression of RPSAP58 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for RPSAP58
    Search LifeMap BioReagents cell lines for RPSAP58
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for RPSAP58


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene).
    About This Section



    Interactions:

        Search SABiosciences Gene Network CentralTM Interacting Genes and Proteins Networks for RPSAP58

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    5/42 Interacting proteins for RPSAP58 (ENSP000004172404) via UniProtKB, MINT, STRING, and/or I2D (see all 42)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    RPS5ENSP000001965514STRING: ENSP00000196551
    RPS3ENSP000002785724STRING: ENSP00000278572
    RPS14ENSP000003110284STRING: ENSP00000311028
    RPS13ENSP000002281404STRING: ENSP00000228140
    RPS9ENSP000003028964STRING: ENSP00000302896
    About this table

    Gene Ontology (GO): 3 biological process terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000028ribosomal small subunit assembly ----
    GO:0006412translation ----
    GO:0007155cell adhesion ----

    RPSAP58 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section
    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for RPSAP58

    Search CenterWatch for drugs/clinical trials and news about RPSAP58

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Sirion Biotech, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for RPSAP58 gene: 
    NM_001005472.1  

    Unigene Cluster for RPSAP58:

    Ribosomal protein SA pseudogene 58
    Hs.560655  [show with all ESTs]
    Unigene Representative Sequence: BF676042
    4 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000486528 ENST00000496398(uc002nrn.3) ENST00000462186 ENST00000354585

    miRNA
    Products:
         
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat RPSAP58
    Search QIAGEN for miScript miRNA Assays for microRNAs that regulate RPSAP58
    SwitchGear 3'UTR luciferase reporter plasmidRPSAP58 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for RPSAP58
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat RPSAP58
    Clone
    Products:
         
    Browse OriGene untagged/tagged cDNA clones in CMV expression vector
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript Custom all cDNA clones Services for RPSAP58
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for RPSAP58
    Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat RPSAP58
    Sirion Biotech Customized lentivirus for stable overexpression of RPSAP58 
                         Customized lentivirus expression plasmids for stable overexpression of RPSAP58 
    Primer
    Products:
        
    OriGene qSTAR qPCR primer pairs in human, mouse for RPSAP58
    Search SABiosciences RT2 qPCR Primer Assays in human, mouse, rat RPSAP58
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat RPSAP58
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat RPSAP58

    Additional mRNA sequence: 

    BC071971.1 NR_003662.2 

    24/96 DOTS entries (see all 96):

    DT.100860380  DT.87006252  DT.91786421  DT.102842173  DT.95378186  DT.85103296  DT.95377954  DT.100742512 
    DT.91786018  DT.100742475  DT.100742468  DT.91786361  DT.100801725  DT.97864862  DT.100742381  DT.100742496 
    DT.100742431  DT.95378228  DT.100837399  DT.100854981  DT.95378263  DT.100742502  DT.95378313  DT.100865110 

    24/2931 AceView cDNA sequences (see all 2931):

    AA679869 AA928554 T47353 BM785751 AA568575 T59594 BU735755 AI420723 
    AA866094 BG290085 AA569836 R97542 AA565023 T94916 CR614218 AA729128 
    N74153 T93505 T93482 AA355543 BX408621 BE743045 AI342035 R45263 

    GeneLoc Exon Structure


    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    RPSAP58 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: --
    RPSAP58 Expression
    About this image


    See RPSAP58 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for RPSAP58

    SOURCE GeneReport for Unigene cluster: Hs.560655
        SABiosciences Custom PCR Arrays for RPSAP58
    Primer
    Products:
    OriGene qSTAR qPCR primer pairs in human, mouse for RPSAP58
    Search SABiosciences RT2 qPCR Primer Assays in human, mouse, rat RPSAP58
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat RPSAP58
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat RPSAP58
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for RPSAP58

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of eukaryotes.

    Orthologs for RPSAP58 gene from 8/15 species (see all 15)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    chicken
    (Gallus gallus)
    Aves RPSA6
    40S ribosomal protein SA
    97(a)
    1 → many
    2(44935746-44940493)
    lizard
    (Anolis carolinensis)
    Reptilia --
    --
    Uncharacterized protein
    91(a)
    87(a)
    many ↔ many
    many ↔ many
    GL343224.1(2172674-2182114)
    4(126540318-126541058)
    zebrafish
    (Danio rerio)
    Actinopterygii zgc558312 similar to laminin receptor 1 (67kD, ribosomal protein more 82.58(n)   394027  AY391434.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta sta6
    stubarista
    54(a)
    1 → many
    X(1375830-1377446)
    worm
    (Caenorhabditis elegans)
    Secernentea rps-06
    40S ribosomal protein SA
    57(a)
    1 → many
    III(4752899-4754083)
    baker's yeast
    (Saccharomyces cerevisiae)
    Saccharomycetes RPS0B6
    RPS0A6
    Protein component of the small (40S) ribosomal sub...
    Protein component of the small (40S) ribosomal sub...
    54(a)
    54(a)
    many ↔ many
    many ↔ many
    XII(242232-243349)
    VII(920575-921788)
    soybean
    (Glycine max)
    eudicotyledons Gma.33282 Glycine max ribosome-associated protein p40 mRNA, complete more 72.72(n)    AF020553.1 
    rice
    (Oryza sativa)
    Liliopsida AK104620.12   -- 74.83(n)    AK104620.1 
            Species with no ortholog for RPSAP58

    ENSEMBL Gene Tree for RPSAP58 (if available)
    TreeFam Gene Tree for RPSAP58 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for RPSAP58 gene
    RPSA2  
    2 SIMAP similar genes for RPSAP58 using alignment to 2 protein entries:     A6NE09_HUMAN (see all proteins):
    RPSA    LAMR1P15

    RPSAP58 for paralogs           About GeneDecksing


    5/22 Pseudogenes.org Pseudogenes for RPSAP58 (see all 22)
    PGOHUM00000247862 PGOHUM00000248259 PGOHUM00000251208 PGOHUM00000237129 PGOHUM00000237164


    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/1755 SNPs in RPSAP58 are shown (see all 1755)    About this table     
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 19 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs1395191501,2
    --23943816(+) TGTGT-/GTGTGTATATATA
    TATACATATATATAGG
    GTATA
    1 -- us2k10--------
    rs561227151,2
    C--23943819(+) TGTGTA/GTATAT 1 -- us2k10--------
    rs1131131391,2
    C--23943821(+) TGTATA/GTATAT 1 -- us2k10--------
    rs560696201,2
    C--23943830(+) ATATAT/CACATA 1 -- us2k12Minor allele frequency- C:0.00NA 6
    rs1461453921,2
    C--23943844(+) TAGGG-/AA/TA 
            
    TATAT
    1 -- us2k10--------
    rs560878051,2
    C--23943851(+) TATAT-/AT    
       
    /TATG
    GTGTA
    1 -- us2k10--------
    rs713096461,2
    C--23943855(+) ATGTGTA/-TATAT 1 -- us2k11Minor allele frequency- -:0.50NA 2
    rs557620031,2
    C--23943867(+) TATAT-/AT/CACATATATATAGGGT
    ATATATGTGTATATATATATA
    GTTTG
    1 -- us2k11NA 2
    rs621186321,2
    C--23943890(+) TATATG/ATGTGT 1 -- us2k12Minor allele frequency- A:0.25WA NA 4
    rs1435533601,2
    C--23943890(+) ATATA-/TGTGTGT 1 -- us2k10--------

    HapMap Linkage Disequilibrium report for RPSAP58 (23945807 - 24010937 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 10/18 variations for RPSAP58 (see all 18):    About this table     
    Variant IDTypeSubtypePubMed ID
    esv2718381CNV Deletion23290073
    esv2718386CNV Deletion23290073
    esv2619335CNV Deletion19546169
    esv2718383CNV Deletion23290073
    esv2670676CNV Deletion23128226
    dgv556e201CNV Deletion23290073
    esv2677185CNV Deletion23128226
    esv2268001CNV Deletion18987734
    nsv2448CNV Insertion18451855
    nsv911474CNV Loss21882294

    SABiosciences Cancer Mutation PCR Assays
    Search QIAGEN SeqTarget long-range PCR primers for resequencing RPSAP58
    DNA2.0 Custom Variant and Variant Library Synthesis for RPSAP58

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section
      --

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for RPSAP58 gene integrated from 9 sources:
    (articles sorted by number of sources associating them with RPSAP58)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Comparative analysis of processed ribosomal protein p seudogenes in four mammalian genomes. (PubMed id 19123937)1, 3 Balasubramanian S....Gerstein M. (2009)
    2. Systematic and quantitative assessment of the ubiquiti n-modified proteome. (PubMed id 21906983)1 Kim W....Gygi S.P. (2011)
    3. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PubMed id 12477932)1 Strausberg R.L....Marra M.A. (2002)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 388524 HGNC: 36809 AceView: LOC388524 Ensembl:ENSG00000205246 euGenes: HUgn388524
    ECgene: RPSAP58 H-InvDB: RPSAP58

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
      --

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for RPSAP58 gene:
    Search GeneIP for patents involving RPSAP58

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Sirion Biotech, Cell lines from GenScript, and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Protease Activity Assays and Reagents   Browse Recombinant/Natural Proteins  
     Browse Stem Cell Products   Browse Tocris Biochemicals & Compounds  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for RPSAP58  
     Browse OriGene qPCR primer pairs and template standards   Browse OriGene Protein Over-expression Lysates  
     OriGene Custom Mass Spec   Browse OriGene clones  
     OriGene qSTAR qPCR primer pairs in human, mouse for RPSAP58   Browse OriGene full length recombinant human proteins expressed in human HEK293 cells  
     Browse OriGene ORF clones   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for RPSAP58   OriGene Custom Protein Services for RPSAP58  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat RPSAP58
     QIAGEN SeqTarget long-range PCR primers for resequencing RPSAP58
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat RPSAP58
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat RPSAP58
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat RPSAP58
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat RPSAP58
     GenScript Custom Purified and Recombinant Proteins Services for RPSAP58 GenScript Custom cDNA clones with any tag delivered in your preferred vector Services for RPSAP58
     GenScript Custom Assay Services for RPSAP58 GenScript Custom Superior Antibodies Services for RPSAP58
     GenScript Custom overexpressing Cell Line Services for RPSAP58 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in RPSAP58 promoter
     Search Chromatin IP Primers for RPSAP58
     Search RT2 qPCR Primer Assays in human, mouse, rat RPSAP58
     Search GNC Networks for RPSAP58
     SABiosciences Custom PCR Arrays for RPSAP58
     Search Tocris compounds for RPSAP58
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     RPSAP58 antibodies
     RPSAP58 proteins
     RPSAP58 lysates
     Search for Antibodies for RPSAP58 at Abcam
     See all of Abcam's Antibodies, Kits and Proteins for RPSAP58
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     Browse Proteins at Cloud-Clone Corp.
     Browse Antibodies at Cloud-Clone Corp.
     Browse ELISAs at Cloud-Clone Corp.
     Browse CLIAs at Cloud-Clone Corp.
     Search LifeMap BioReagents cell lines for RPSAP58
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for RPSAP58
     SwitchGear 3'UTR luciferase reporter plasmids for RPSAP58
     SwitchGear Promoter luciferase reporter plasmids for RPSAP58
     Search ThermoFisher Antibodies for RPSAP58
     Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat RPSAP58
     inGenious Targeting Laboratory - Custom generated mouse model solutions for RPSAP58
     inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for RPSAP58
    Customized:
     lentivirus for stable overexpression of RPSAP58
     lentivirus expression plasmids for stable overexpression of RPSAP58
     adenovirus for overexpression of RPSAP58
     Search LSBio for Antibodies for RPSAP58
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
           
    GeneCards Homepage - Last full update: 23 Oct 2013 - Incrementals: 4 Nov 2013 , 7 Nov 2013 , 23 Jan 2014

    View Random Gene

    Category
    (GIFtS: 73)
    transforming growth factor, beta 1
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      RPSAP58 gene at Home site.
    hostname: 356980-web2.xennexinc.com index build: 106 solr: 1.4