Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



RPSAP58 Gene

pseudogene   GIFtS: 32
GCID: GC19P023946

Ribosomal Protein SA Pseudogene 58

  Search for RPSAP58
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Aliases
Ribosomal Protein SA Pseudogene 581 2     67 KDa Laminin Receptor4
RPSA_30_16422     RPSA4
37 KDa Laminin Receptor Precursor4     Laminin Receptor 14
37/67 KDa Laminin Receptor4     Laminin-Binding Protein Precursor P404

External Ids:    HGNC: 368091   Entrez Gene: 3885242   Ensembl: ENSG000002052467   UniProtKB: A6NE094   UniProtKB: C9JQR94   

Export aliases for RPSAP58 gene to outside databases

Previous GC identifers: GC19U901020 GC19P023490


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

GeneCards Summary for RPSAP58 Gene:
RPSAP58 (ribosomal protein SA pseudogene 58) is a pseudogene. An important paralog of this gene is RPSA.

UniProtKB/TrEMBL: A6NE09
Function: Required for the assembly and/or stability of the 40S ribosomal subunit. Required for the processing of
the 20S rRNA-precursor to mature 18S rRNA in a late step of the maturation of 40S ribosomal subunits. Also
functions as a cell surface receptor for laminin. Plays a role in cell adhesion to the basement membrane and in
the consequent activation of signaling transduction pathways. May play a role in cell fate determination and
tissue morphogenesis. Also acts as a receptor for several other ligands, including the pathogenic prion protein,
viruses, and bacteria. Acts as a PPP1R16B-dependent substrate of PPP1CA (By similarity)




(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence:
NC_000019.10  NC_018930.2  NT_011295.12  
Regulatory elements:
   Regulatory transcription factor binding sites in the RPSAP58 gene promoter:
         NF-YA   AREB6   NF-YB   CBF-A   CBF-B   CP1A   NF-Y   CBF(2)   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidRPSAP58 promoter sequence
   Search Chromatin IP Primers for RPSAP58

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat RPSAP58


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 19p12   Ensembl cytogenetic band:  19p12   HGNC cytogenetic band: 19p12

RPSAP58 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
RPSAP58 gene location

GeneLoc information about chromosome 19         GeneLoc Exon Structure

GeneLoc location for GC19P023946:  view genomic region     (about GC identifiers)

Start:
23,945,807 bp from pter      End:
24,010,937 bp from pter
Size:
65,131 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

TryGeneCards Plus

UniProtKB/TrEMBL: A6NE09 (See protein sequence)
Recommended Name: 40S ribosomal protein SA  
Size: 295 amino acids; 32909 Da
Subunit: Monomer (37LRP) and homodimer (67LR). Component of the small ribosomal subunit. Mature ribosomes consist
of a small (40S) and a large (60S) subunit. The 40S subunit contains about 33 different proteins and 1 molecule
of RNA (18S). The 60S subunit contains about 49 different proteins and 3 molecules of RNA (28S, 5.8S and 5S).
Interacts with RPS21. Interacts with several laminins including at least LAMB1. Interacts with MDK. The mature
dimeric form interacts with PPP1R16B (via its fourth ankyrin repeat). Interacts with PPP1CA only in the presence
of PPP1R16B (By similarity)
Miscellaneous: This protein appears to have acquired a second function as a laminin receptor specifically in the
vertebrate lineage (By similarity)
Caution: The sequence shown here is derived from an Ensembl automatic analysis pipeline and should be considered
as preliminary data

UniProtKB/TrEMBL: C9JQR9 (See protein sequence)

Recommended Name: Protein RPSAP58  
Size: 73 amino acids; 8250 Da
Caution: The sequence shown here is derived from an Ensembl automatic analysis pipeline and should be considered
as preliminary data

Explore proteomics data for RPSAP58 at MOPED

Post-translational modifications: 

  • Acylated. Acylation may be a prerequisite for conversion of the monomeric 37 kDa laminin receptor precursor
    (37LRP) to the mature dimeric 67 kDa laminin receptor (67LR), and may provide a mechanism for membrane
    association (By similarity)1
  • Cleaved by stromelysin-3 (ST3) at the cell surface. Cleavage by stromelysin-3 may be a mechanism to alter
    cell-extracellular matrix interactions (By similarity)1
  • Modification sites at neXtProt

  • See RPSAP58 Protein Expression from SPIRE MOPED, PaxDB, and MaxQB


    ENSEMBL proteins: 
     ENSP00000420173   ENSP00000417240   ENSP00000346598  

    RPSAP58 Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    Browse OriGene Protein Over-expression Lysates
    OriGene Custom MassSpec
    OriGene Custom Protein Services for RPSAP58
    GenScript Custom Purified and Recombinant Proteins Services for RPSAP58
    Novus Biologicals RPSAP58 Protein
    Novus Biologicals RPSAP58 Lysate
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    Browse ProSpec Recombinant Proteins
    Browse Proteins at Cloud-Clone Corp.

    RPSAP58 Antibody Products:

    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for RPSAP58
    Novus Biologicals RPSAP58 Antibodies
    Search for Antibodies for RPSAP58 at Abcam
    Browse Antibodies at Cloud-Clone Corp.
    Search ThermoFisher Antibodies for RPSAP58
    Search LSBio for Antibodies for RPSAP58

    RPSAP58 Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for RPSAP58
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for RPSAP58
    Browse Enzo Life Sciences for kits & assays
    Browse ELISAs at Cloud-Clone Corp.
    Browse CLIAs at Cloud-Clone Corp.


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    Selected InterPro protein domains (see all 6):
     IPR018130 Ribosomal_S2_CS
     IPR027504 40S_ribosomal_SA
     IPR001865 Ribosomal_S2
     IPR023591 Ribosomal_S2_flav_dom
     IPR027498 Ribosomal_S2_euk

    Graphical View of Domain Structure for InterPro Entry A6NE09
    Graphical View of Domain Structure for InterPro Entry C9JQR9

    ProtoNet protein and cluster: A6NE09

    UniProtKB/TrEMBL: A6NE09
    Similarity: Belongs to the ribosomal protein S2P family

    UniProtKB/TrEMBL: C9JQR9
    Similarity: Belongs to the ribosomal protein S2P family


    RPSAP58 for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Molecular Function:

         UniProtKB/TrEMBL Summary: A6NE09
    Function: Required for the assembly and/or stability of the 40S ribosomal subunit. Required for the processing of
    the 20S rRNA-precursor to mature 18S rRNA in a late step of the maturation of 40S ribosomal subunits. Also
    functions as a cell surface receptor for laminin. Plays a role in cell adhesion to the basement membrane and in
    the consequent activation of signaling transduction pathways. May play a role in cell fate determination and
    tissue morphogenesis. Also acts as a receptor for several other ligands, including the pathogenic prion protein,
    viruses, and bacteria. Acts as a PPP1R16B-dependent substrate of PPP1CA (By similarity)

         Gene Ontology (GO): 3 molecular function terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0003735structural constituent of ribosome ----
    GO:0005055laminin receptor activity ----
    GO:0043236laminin binding ----
         
    RPSAP58 for ontologies           About GeneDecksing


    Animal Models:
       inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for RPSAP58
       inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for RPSAP58

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for RPSAP58
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for RPSAP58

    miRNA
    Products:
        
    Block miRNA regulation of human, mouse, rat RPSAP58 using miScript Target Protectors
    Search for qRT-PCR Assays for microRNAs that regulate RPSAP58
    SwitchGear 3'UTR luciferase reporter plasmidRPSAP58 3' UTR sequence
    Inhib. RNA
    Products:
        
    OriGene RNAi products in human, mouse, rat for RPSAP58
    Predesigned siRNA for gene silencing in human, mouse, rat RPSAP58

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for RPSAP58

    Clone
    Products:
         
    Browse OriGene untagged/tagged cDNA clones in CMV expression vector
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript Custom all cDNA clones Services for RPSAP58
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for RPSAP58
    Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat RPSAP58

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for RPSAP58
    Browse ESI BIO Cell Lines and PureStem Progenitors for RPSAP58 
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for RPSAP58


    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from UniProtKB/TrEMBL
    A6NE09 : Cell membrane. Cytoplasm. Nucleus. Note=67LR is found at the surface of the plasma membrane,
    with its C-terminal laminin-binding domain accessible to extracellular ligands. 37LRP is found at the cell
    surface, in the cytoplasm and in the nucleus. Co-localizes with PPP1R16B in the cell membrane (By similarity)
    Subcellular locations from COMPARTMENTS: 

    CompartmentConfidence
    cytosol3
    nucleus2
    cytoskeleton1

    Gene Ontology (GO): Selected cellular component terms (see all 6):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005622intracellular ----
    GO:0005634nucleus ----
    GO:0005840ribosome ----
    GO:0005886plasma membrane ----
    GO:0015935small ribosomal subunit ----

    RPSAP58 for ontologies           About GeneDecksing


    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus



        Custom Pathway & Disease-focused RT2 Profiler PCR Arrays for RPSAP58
    Interactions:

        Search GeneGlobe Interaction Network for RPSAP58

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    Selected Interacting proteins for RPSAP58 (ENSP000004172404) via UniProtKB, MINT, STRING, and/or I2D (see all 153)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    MRPS16ENSP000003620364STRING: ENSP00000362036
    RPS13ENSP000002281404STRING: ENSP00000228140
    RPS14ENSP000003110284STRING: ENSP00000311028
    RPS16ENSP000002514534STRING: ENSP00000251453
    RPS19ENSP000002219754STRING: ENSP00000221975
    About this table

    Gene Ontology (GO): 3 biological process terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000028ribosomal small subunit assembly ----
    GO:0006412translation ----
    GO:0007155cell adhesion ----

    RPSAP58 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for RPSAP58



    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, and/or QIAGEN )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for RPSAP58 gene: 
    NM_001005472.1  

    Unigene Cluster for RPSAP58:

    Ribosomal protein SA pseudogene 58
    Hs.560655  [show with all ESTs]
    Unigene Representative Sequence: BF676042
    4 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000486528 ENST00000496398(uc002nrn.3) ENST00000462186 ENST00000354585

    miRNA
    Products:
         
    Block miRNA regulation of human, mouse, rat RPSAP58 using miScript Target Protectors
    Search for qRT-PCR Assays for microRNAs that regulate RPSAP58
    SwitchGear 3'UTR luciferase reporter plasmidRPSAP58 3' UTR sequence
    Inhib. RNA
    Products:
         
    OriGene RNAi products in human, mouse, rat for RPSAP58
    Predesigned siRNA for gene silencing in human, mouse, rat RPSAP58
    Clone
    Products:
         
    Browse OriGene untagged/tagged cDNA clones in CMV expression vector
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript Custom all cDNA clones Services for RPSAP58
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for RPSAP58
    Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat RPSAP58
    Primer
    Products:
        
    OriGene qSTAR qPCR primer pairs in human, mouse for RPSAP58
    Search Pre-validated RT2 qPCR Primer Assays in human, mouse, rat RPSAP58
      QuantiTect SYBR Green Assays in human, mouse, rat RPSAP58
      QuantiFast Probe-based Assays in human, mouse, rat RPSAP58

    Additional mRNA sequence: 

    BC071971.1 NR_003662.2 

    Selected DOTS entries (see all 96):

    DT.100860380  DT.87006252  DT.91786421  DT.102842173  DT.95378186  DT.85103296  DT.95377954  DT.100742512 
    DT.91786018  DT.100742475  DT.100742468  DT.91786361  DT.100801725  DT.97864862  DT.100742381  DT.100742496 
    DT.100742431  DT.95378228  DT.100837399  DT.100854981  DT.95378263  DT.100742502  DT.95378313  DT.100865110 

    Selected AceView cDNA sequences (see all 2931):

    CR614218 AA729128 T93482 N74153 CN485205 T93505 BM996177 AA355543 
    CR626298 BM842027 BX408621 BE743045 R45263 AI342035 AA679869 T94916 
    AA565023 BM785751 T47353 AA928554 AA866094 AA568575 AI420723 R97542 

    GeneLoc Exon Structure


    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    RPSAP58 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: --
    RPSAP58 Expression
    About this image

    RPSAP58 Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    RPSAP58 Protein Expression

    SOURCE GeneReport for Unigene cluster: Hs.560655
        Custom PCR Arrays for RPSAP58
    Primer
    Products:
    OriGene qSTAR qPCR primer pairs in human, mouse for RPSAP58
    Search Pre-validated RT2 qPCR Primer Assays in human, mouse, rat RPSAP58
    QuantiTect SYBR Green Assays in human, mouse, rat RPSAP58
    QuantiFast Probe-based Assays in human, mouse, rat RPSAP58
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for RPSAP58

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of eukaryotes.

    Orthologs for RPSAP58 gene from Selected species (see all 15)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    chicken
    (Gallus gallus)
    Aves RPSA6
    Gallus gallus ribosomal protein SA (RPSA), mRNA.
    97(a)
    1 → many
    2(44935746-44940493)
    lizard
    (Anolis carolinensis)
    Reptilia --
    --
    Uncharacterized protein
    91(a)
    87(a)
    many ↔ many
    many ↔ many
    GL343224.1(2172674-2182114)
    4(126540318-126541058)
    zebrafish
    (Danio rerio)
    Actinopterygii zgc558312 similar to laminin receptor 1 (67kD, ribosomal protein more 82.58(n)   394027  AY391434.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta sta6
    stubarista
    53(a)
    1 → many
    X(1375830-1377446)
    worm
    (Caenorhabditis elegans)
    Secernentea rps-06
    Protein RPS-0 (rps-0) mRNA, complete cds
    56(a)
    1 → many
    III(4752899-4754083) WBGene00004469
    baker's yeast
    (Saccharomyces cerevisiae)
    Saccharomycetes RPS0B6
    RPS0A6
    Protein component of the small (40S) ribosomal sub...
    Protein component of the small (40S) ribosomal sub...
    56(a)
    55(a)
    many ↔ many
    many ↔ many
    XII(242232-243349) YLR048W
    VII(920575-921788) YGR214W
    soybean
    (Glycine max)
    eudicotyledons Gma.33282 Glycine max ribosome-associated protein p40 mRNA, complete more 72.72(n)    AF020553.1 
    rice
    (Oryza sativa)
    Liliopsida AK104620.12   -- 74.83(n)    AK104620.1 
            Species with no ortholog for RPSAP58

    ENSEMBL Gene Tree for RPSAP58 (if available)
    TreeFam Gene Tree for RPSAP58 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section

    TryGeneCards Plus
    Paralogs for RPSAP58 gene
    RPSA2  
    2 SIMAP similar genes for RPSAP58 using alignment to 2 protein entries:     A6NE09_HUMAN (see all proteins):
    RPSA    LAMR1P15

    RPSAP58 for paralogs           About GeneDecksing


    Selected Pseudogenes.org Pseudogenes for RPSAP58 (see all 22)
    PGOHUM00000247862 PGOHUM00000248259 PGOHUM00000251208 PGOHUM00000237129 PGOHUM00000237164


    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for RPSAP58 (see all 1755)    About this table    
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 19 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs1395191501,2
    --23943816(+) TGTGT-/GTGTGTATATATA
    TATACATATATATAGG
    GTATA
    1 -- us2k10--------
    rs561227151,2
    C--23943819(+) TGTGTA/GTATAT 1 -- us2k10--------
    rs1131131391,2
    C--23943821(+) TGTATA/GTATAT 1 -- us2k10--------
    rs560696201,2
    C--23943830(+) ATATAT/CACATA 1 -- us2k12Minor allele frequency- C:0.00NA 6
    rs1461453921,2
    C--23943844(+) TAGGG-/AA/TA 
            
    TATAT
    1 -- us2k10--------
    rs560878051,2
    C--23943851(+) TATAT-/AT    
       
    /TATG
    GTGTA
    1 -- us2k10--------
    rs713096461,2
    C--23943855(+) ATGTGTA/-TATAT 1 -- us2k11Minor allele frequency- -:0.50NA 2
    rs557620031,2
    C--23943867(+) TATAT-/AT/CACATATATATAGGGT
    ATATATGTGTATATATATATA
    GTTTG
    1 -- us2k11NA 2
    rs621186321,2
    C--23943890(+) TATATG/ATGTGT 1 -- us2k12Minor allele frequency- A:0.25WA NA 4
    rs1435533601,2
    C--23943890(+) ATATA-/TGTGTGT 1 -- us2k10--------

    HapMap Linkage Disequilibrium report for RPSAP58 (23945807 - 24010937 bp)

    Structural Variations
         Database of Genomic Variants (DGV) Selected variations for RPSAP58 (see all 18):    About this table    
    Variant IDTypeSubtypePubMed ID
    esv2718381CNV Deletion23290073
    esv2718386CNV Deletion23290073
    esv2619335CNV Deletion19546169
    esv2718383CNV Deletion23290073
    esv2670676CNV Deletion23128226
    dgv556e201CNV Deletion23290073
    esv2677185CNV Deletion23128226
    esv2268001CNV Deletion18987734
    nsv2448CNV Insertion18451855
    nsv911474CNV Loss21882294

    Site Specific Mutation Identification with PCR Assays
    Search QIAGEN SeqTarget long-range PCR primers for resequencing RPSAP58
    DNA2.0 Custom Variant and Variant Library Synthesis for RPSAP58

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TryGeneCards Plus
      --

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    TryGeneCards Plus

    PubMed articles for RPSAP58 gene integrated from 10 sources:
    (articles sorted by number of sources associating them with RPSAP58)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Comparative analysis of processed ribosomal protein pseudogenes in four mammalian genomes. (PubMed id 19123937)1, 3 Balasubramanian S....Gerstein M. (Genome Biol. 2009)
    2. Systematic and quantitative assessment of the ubiquitin-modified proteome. (PubMed id 21906983)1 Kim W....Gygi S.P. (Mol. Cell 2011)
    3. A germline-specific class of small RNAs binds mammalian Piwi proteins. (PubMed id 16751776)1 Girard A....Carmell M.A. (Nature 2006)
    4. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PubMed id 12477932)1 Strausberg R.L....Marra M.A. (Proc. Natl. Acad. Sci. U.S.A. 2002)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

    TryGeneCards Plus
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section

    TryGeneCards Plus
    Entrez Gene: 388524 HGNC: 36809 AceView: LOC388524 Ensembl:ENSG00000205246 euGenes: HUgn388524
    ECgene: RPSAP58 H-InvDB: RPSAP58

    (According to HUGE)
    About This Section

    TryGeneCards Plus
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section

    TryGeneCards Plus
      --

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section

    TryGeneCards Plus
    Patent Information for RPSAP58 gene:
    Search GeneIP for patents involving RPSAP58

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript, and ESI BIO, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

    TryGeneCards Plus

     
     EMD Millipore genomic analysis products

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for RPSAP58  
     Browse OriGene qPCR primer pairs and template standards   Browse OriGene Protein Over-expression Lysates  
     OriGene Custom Mass Spec   Browse OriGene clones  
     OriGene qSTAR qPCR primer pairs in human, mouse for RPSAP58   Browse OriGene full length recombinant human proteins expressed in human HEK293 cells  
     Browse OriGene ORF clones   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for RPSAP58   OriGene Custom Protein Services for RPSAP58  

     
     
     Block miRNA regulation of human, mouse, rat RPSAP58 using miScript Target Protectors SeqTarget long-range PCR primers for resequencing RPSAP58
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat RPSAP58 Predesigned siRNA for gene silencing in human, mouse, rat RPSAP58
     QuantiFast Probe-based Assays in human, mouse, rat RPSAP58 QuantiTect SYBR Green Assays in human, mouse, rat RPSAP58
     Custom PCR Arrays for RPSAP58 Search Chromatin IP Primers for RPSAP58
     Search Pre-validated RT2 qPCR Primer Assays in human, mouse, rat RPSAP58 Search GeneGlobe Interaction Network for RPSAP58
     Regulatory tfbs in RPSAP58 promoter
     GenScript Custom Purified and Recombinant Proteins Services for RPSAP58 GenScript Custom cDNA clones with any tag delivered in your preferred vector Services for RPSAP58
     GenScript Custom Assay Services for RPSAP58 GenScript Custom overexpressing Cell Line Services for RPSAP58
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Search for Antibodies & Assays

     Search Tocris compounds for RPSAP58
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     RPSAP58 antibodies
     RPSAP58 proteins
     RPSAP58 lysates
     Search for Antibodies for RPSAP58 at Abcam
     See all of Abcam's Antibodies, Kits and Proteins for RPSAP58
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins
     Browse Proteins at Cloud-Clone Corp.
     Browse Antibodies at Cloud-Clone Corp.
     Browse ELISAs at Cloud-Clone Corp.
     Browse CLIAs at Cloud-Clone Corp.



     Browse ESI BIO Cell Lines and PureStem Progenitors for RPSAP58
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for RPSAP58
     SwitchGear 3'UTR luciferase reporter plasmids for RPSAP58
     SwitchGear Promoter luciferase reporter plasmids for RPSAP58
     Search ThermoFisher Antibodies for RPSAP58
     Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat RPSAP58
     inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for RPSAP58
     inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for RPSAP58
     Search LSBio for Antibodies for RPSAP58
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
     Browse compounds at ApexBio
           
    GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014

    View Random Gene

    Category
    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      RPSAP58 gene at Home site.
    Version: 3.12.142 28 July 2014
    hostname: 356980-web2.xennexinc.com index build: 126 solr: 1.4