Home
GeneCards Guide
Suite
- MalaCards
- GeneALaCart
- GeneAnalytics
- GeneLoc
- GenesLikeMe
- VarElect
- PathCards
Terms of Use
- Terms of Use
- 3rd Party Notice
About Us
- GeneCards Team
- Our Publications
- Citing GeneCards
- Licensing Agreement
- Weizmann Institute
- LifeMap Sciences Inc
User Feedback
GeneCards Suite
- Affiliated Databases
  
  Premium Tools
  
  Learn more

Set Analyses:

VarElect

Advanced Search

RPS6KC1 Gene

protein-coding GIFtS: 54
GCID: GC01P213224

Ribosomal Protein S6 Kinase, 52kDa, Polypeptide 1

(Previous names: ribosomal protein S6 kinase, 52kD, polypeptide 1)

Try our

MalaCards

disease database

(According to ¹HGNC, ²Entrez Gene,
³UniProtKB/Swiss-Prot, ⁴UniProtKB/TrEMBL, ⁵OMIM, ⁶GeneLoc, ⁷Ensembl, ⁸DME, ⁹miRBase, ¹⁰fRNAdb, ¹²H-InvDB, ¹³NCBI, ¹⁴NONCODE, and/or ¹⁵RNAdb)
About This Section

Aliases
Ribosomal Protein S6 Kinase, 52kDa, Polypeptide 1¹ ²		Ribosomal Protein S6 Kinase, 52kD, Polypeptide 1¹
Ribosomal S6 Kinase-Like Protein With Two PSK Domains 118 KDa Protein² ³		S6PKh1²
52 KDa Ribosomal Protein S6 Kinase² ³		humS6PKh1²
RPK118² ³		Ribosomal Protein S6 Kinase Delta-1²
S6K-delta-1² ³		EC 2.7.11.1³
SPHK1-Binding Protein² ³

External Ids:	HGNC: 10439¹	Entrez Gene: 26750²	Ensembl: ENSG00000136643⁷	UniProtKB: Q96S38³

Export aliases for RPS6KC1 gene to outside databases

Previous GC identifers: GC01P212070 GC01P209067 GC01P209840 GC01P210281 GC01P209612 GC01P211291 GC01P183899

(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

GeneCards Summary for RPS6KC1 Gene:

RPS6KC1 (ribosomal protein S6 kinase, 52kDa, polypeptide 1) is a protein-coding gene. GO annotations related to this gene include protein serine/threonine kinase activity and phosphatidylinositol binding. An important paralog of this gene is RPS6KL1.

UniProtKB/Swiss-Prot: KS6C1_HUMAN, Q96S38

Function: May be involved in transmitting sphingosine-1 phosphate (SPP)-mediated signaling into the cell

Gene Wiki entry for RPS6KC1 Gene

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

RefSeq DNA sequence at NCBI GenBank:

NC_000001.10 NT_004487.20 NC_018912.2

Regulatory elements:

Regulatory transcription factor binding sites in the RPS6KC1 gene promoter:
MEF-2A Elk-1 NRF-2 MEF-2 Olf-1 LCR-F1 Egr-4 c-Ets-1
Other transcription factors

SwitchGear Promoter luciferase reporter plasmid: RPS6KC1 promoter sequence

Search Chromatin IP Primers for RPS6KC1

Epigenetics:

DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat RPS6KC1

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 1q41 Ensembl cytogenetic band: 1q32.3 HGNC cytogenetic band: 1q41

RPS6KC1 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
RPS6KC1 gene location

GeneLoc information about chromosome 1 GeneLoc Exon Structure

GeneLoc location for GC01P213224: view genomic region (about GC identifiers)

Start:	213,224,588 bp from pter	End:	213,448,116 bp from pter
Size:	223,529 bases	Orientation:	plus strand

(According to ¹UniProtKB, HORDE, ²neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, Cloud-Clone Corp., eBioscience, antibodies-online, and/or GeneTex,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, Cloud-Clone Corp., eBioscience, and/or antibodies-online, Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, Cloud-Clone Corp, antibodies-online, and/or others.)
About This Section

UniProtKB/Swiss-Prot: KS6C1_HUMAN, Q96S38 (See protein sequence)

Recommended Name: Ribosomal protein S6 kinase delta-1

Size: 1066 amino acids; 118682 Da

Subunit: Interacts with SPHK1 and phosphatidylinositol 3-phosphate

Caution: Instead of Lys-820, Arg-820 is found at the binding site

Sequence caution: Sequence=CAB92850.1; Type=Erroneous initiation;

Secondary accessions: B1APS8 B3KVM4 D3DTA4 Q8TDD3 Q9NSF4 Q9UL66

Alternative splicing: 2 isoforms: Q96S38-1 Q96S38-2 (No experimental confirmation available)

Explore the universe of human proteins at neXtProt for RPS6KC1: NX_Q96S38

Explore proteomics data for RPS6KC1 at MOPED

Post-translational modifications:

Modification sites at neXtProt

Modification sites at PhosphoSitePlus

See RPS6KC1 Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

REFSEQ proteins (6 alternative transcripts):

NP_001129610.1 NP_001274147.1 NP_001274148.1 NP_001274149.1 NP_001274150.1 NP_036556.2

ENSEMBL proteins:

ENSP00000355927 ENSP00000355926 ENSP00000442306 ENSP00000439282

RPS6KC1 Human Recombinant Protein Products:

	EMD Millipore Purified and/or Recombinant RPS6KC1 Protein
	Browse R&D Systems for human recombinant proteins
	Browse recombinant and purified proteins available from Enzo Life Sciences
	OriGene Purified Protein for RPS6KC1 OriGene Protein Over-expression Lysate for RPS6KC1 OriGene MassSpec for RPS6KC1 OriGene Custom Protein Services for RPS6KC1
	GenScript Custom Purified and Recombinant Proteins Services for RPS6KC1
	Novus Biologicals RPS6KC1 Protein Novus Biologicals RPS6KC1 Lysate
	Browse Sino Biological Recombinant Proteins Browse Sino Biological Cell Lysates
	Browse ProSpec Recombinant Proteins
	Cloud-Clone Corp. Proteins for RPS6KC1
	Search eBioscience for Proteins for RPS6KC1
	Search GeneTex for Proteins for RPS6KC1
	antibodies-online proteins for RPS6KC1 (2 products)
	antibodies-online peptides for RPS6KC1

RPS6KC1 Antibody Products:

	Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
	Browse R&D Systems for Antibodies
	OriGene Antibodies for RPS6KC1 OriGene Custom Antibody Services for RPS6KC1
	Novus Biologicals RPS6KC1 Antibodies
	Abcam antibodies for RPS6KC1
	Cloud-Clone Corp. Antibodies for RPS6KC1
	Search ThermoFisher Antibodies for RPS6KC1
	antibodies-online antibodies for RPS6KC1 (24 products)

RPS6KC1 Assay Products:

	EMD Millipore Kits and Assays for the Analysis of RPS6KC1
	OriGene Custom Assay Services for RPS6KC1
	Browse R&D Systems for biochemical assays
	GenScript Custom Assay Services for RPS6KC1
	Browse Enzo Life Sciences for kits & assays
	Cloud-Clone Corp. ELISAs for RPS6KC1 Cloud-Clone Corp. CLIAs for RPS6KC1
	Search eBioscience for ELISAs for RPS6KC1
	antibodies-online kits for RPS6KC1 (4 products)

(According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GenesLikeMe)
About This Section

IUPHAR Guide to PHARMACOLOGY protein family classification: ribosomal protein S6 kinase, 52kDa, polypeptide 1

RSKL family

Other AGC kinases

4 InterPro protein domains:

IPR001683 Phox

IPR011009 Kinase-like_dom

IPR000719 Prot_kinase_dom

IPR007330 MIT

Graphical View of Domain Structure for InterPro Entry Q96S38

ProtoNet protein and cluster: Q96S38

1 Blocks protein domain: IPB001683 Phox-like

UniProtKB/Swiss-Prot: KS6C1_HUMAN, Q96S38

Domain: The first protein kinase domain appears to be a pseudokinase domain as it does not contain the classical

characteristics, such as the ATP-binding motif, ATP-binding site and active site

Similarity: Belongs to the protein kinase superfamily. Ser/Thr protein kinase family. S6 kinase subfamily

Similarity: Contains 1 MIT domain

Similarity: Contains 2 protein kinase domains

Similarity: Contains 1 PX (phox homology) domain

Find genes that share domains with RPS6KC1 About GenesLikeMe

(According to ¹UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or ²DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, genOway,
transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, Vector BioLabs and/or Addgene, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Flow cytometry from eBioscience, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene, Sets of similar genes according to GenesLikeMe)
About This Section

Molecular Function:

UniProtKB/Swiss-Prot Summary: KS6C1_HUMAN, Q96S38

Function: May be involved in transmitting sphingosine-1 phosphate (SPP)-mediated signaling into the cell

Catalytic activity: ATP + a protein = ADP + a phosphoprotein

Genatlas biochemistry entry for RPS6KC1:

ribosomal protein S6 kinase,polypeptide 1,expressed highly in testis,skeletal muscle,brain and pancreas,not

involved in vivo in the phosphorylation of RPS6,mediating protein synthesis initiation and elongation induced by

hormones or growth factors,maybe playing an essentilal regulatory role in protein synthesis during cell

proliferation

Enzyme Number (IUBMB): EC 2.7.11.1¹

Gene Ontology (GO): Selected molecular function terms (see all 6): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0004672	protein kinase activity	--	--
GO:0004674	protein serine/threonine kinase activity	IEA	--
GO:0005515	protein binding	IPI	15750338
GO:0005524	ATP binding	IEA	--
GO:0016772	transferase activity, transferring phosphorus-containing groups	--	--

Find genes that share ontologies with RPS6KC1 About GenesLikeMe

Phenotypes:
2 GenomeRNAi human phenotypes for RPS6KC1:

Decreased Wnt reporter activit

Elongated cells

Animal Models:

genOway: Develop your customized and physiologically relevant rodent model for RPS6KC1

miRNA Products:		miRTarBase miRNAs that target RPS6KC1: hsa-mir-26b-5p (MIRT029998)

		Block miRNA regulation of human, mouse, rat RPS6KC1 using miScript Target Protectors
		Selected qRT-PCR Assays for microRNAs that regulate RPS6KC1 (see all 12):
		hsa-miR-623 hsa-miR-22 hsa-miR-181c hsa-miR-181a hsa-miR-181d hsa-miR-3907 hsa-miR-211 hsa-miR-204

		SwitchGear 3'UTR luciferase reporter plasmid: RPS6KC1 3' UTR sequence

Inhib. RNA Products:		OriGene RNAi products in human, mouse, rat for RPS6KC1
		Predesigned siRNA for gene silencing in human, mouse, rat RPS6KC1

Gene Editing
Products:

DNA2.0 Custom Protein Engineering Service for RPS6KC1

Clone Products:		OriGene clones in human, mouse for RPS6KC1 (see all 13) OriGene ORF clones in mouse, rat for RPS6KC1 OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector (see all 2): RPS6KC1 (NM_012424)
		Browse Sino Biological Human cDNA Clones
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for RPS6KC1
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat RPS6KC1
		Addgene plasmids for RPS6KC1

Cell Line Products:		GenScript Custom overexpressing Cell Line Services for RPS6KC1
		Browse ESI BIO Cell Lines and PureStem Progenitors for RPS6KC1

In Situ Assay
Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for RPS6KC1

(According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene, Sets of similar genes according to GenesLikeMe)
About This Section

Subcellular locations from UniProtKB/Swiss-Prot

KS6C1_HUMAN, Q96S38: Cytoplasm. Membrane. Note=Also found in some small dot-like or ring-shaped early endosome

structures

Subcellular locations from COMPARTMENTS:

Compartment	Confidence
endosome	5
cytosol	3
mitochondrion	3
nucleus	2

About this image

Gene Ontology (GO): 5 cellular component terms: About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0005737	cytoplasm	IDA	--
GO:0005769	early endosome	IDA	15750338
GO:0005840	ribosome	--	--
GO:0016020	membrane	IEA	--
GO:0043231	intracellular membrane-bounded organelle	IDA	--

Find genes that share ontologies with RPS6KC1 About GenesLikeMe

(SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GenesLikeMe, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to ¹UniProtKB, ²MINT, ³I2D, and/or ⁴STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene, Sets of similar genes according to GenesLikeMe)
About This Section

SuperPaths for RPS6KC1 About

See pathways by source

Powered
by

SuperPath

Contained pathways About

Nanog in Mammalian ESC Pluripotency

14-3-3 Induced Intracellular Signaling

0.59

CNTF Signaling

FLT3 Signaling

0.50

2 Downloadable PowerPoint Slides of GeneGlobe Pathway Central Maps for RPS6KC1

	FLT3 Signaling
	14-3-3 Induced Intracellular Signaling

Custom Pathway & Disease-focused RT² Profiler PCR Arrays for RPS6KC1
Interactions:

GeneGlobe Interaction Network for RPS6KC1

STRING Interaction Network Preview (showing 5 interactants - click image to see 12)

Selected Interacting proteins for RPS6KC1 (Q96S38^{2, 3} ENSP00000355927⁴) via UniProtKB, MINT, STRING, and/or I2D (see all 17)

Interactant		Interaction Details
GeneCard	External ID(s)	Interaction Details
ENSG00000225987	P40425²^,³, ENSP00000403948⁴	MINT-62747 MINT-62671 MINT-62573 I2D: score=4 STRING: ENSP00000403948
ENSG00000237344	P40425²^,³, ENSP00000397177⁴	MINT-62747 MINT-62671 MINT-62573 I2D: score=4 STRING: ENSP00000397177
PBX2	P40425²^,³, ENSP00000364190⁴	MINT-62747 MINT-62671 MINT-62573 I2D: score=4 STRING: ENSP00000364190
ENSG00000206315	P40425²^,³	MINT-62747 MINT-62671 MINT-62573 I2D: score=4
ENSG00000224952	P40425²^,³	MINT-62747 MINT-62671 MINT-62573 I2D: score=4

About this table

Gene Ontology (GO): 2 biological process terms: About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0006468	protein phosphorylation	--	--
GO:0007165	signal transduction	TAS	10552933

Find genes that share ontologies with RPS6KC1 About GenesLikeMe

(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, Sets of similar genes according to GenesLikeMe)
About This Section

Browse Small Molecules at EMD Millipore

Browse drugs & compounds from Enzo Life Sciences

Browse compounds at ApexBio

Browse Tocris compounds for RPS6KC1 (KS6C1)

(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, and/or Addgene, Primers from OriGene, and/or QIAGEN, Flow cytometry from eBioscience )
About This Section

REFSEQ mRNAs for RPS6KC1 gene (10 alternative transcripts):

NM_001136138.2 NM_001287218.1 NM_001287219.1 NM_001287220.1 NM_001287221.1 NM_012424.4 XM_005273095.1 XM_005273096.1

XM_005273098.2 XM_006711272.1

Unigene Cluster for RPS6KC1:

Ribosomal protein S6 kinase, 52kDa, polypeptide 1

Hs.591416 [show with all ESTs]

Unigene Representative Sequence: NM_012424

7 Ensembl transcripts including schematic representations, and UCSC links where relevant:

ENST00000366960(uc010ptr.2 uc010pts.2 uc010ptt.2 uc010ptu.2 uc010ptv.2)

ENST00000366959(uc001hkd.3) ENST00000490299(uc001hke.3) ENST00000468069

ENST00000491616 ENST00000543470(uc009xdh.2 uc009xdi.1) ENST00000543354

miRNA Products:		Block miRNA regulation of human, mouse, rat RPS6KC1 using miScript Target Protectors
		Selected qRT-PCR Assays for microRNAs that regulate RPS6KC1 (see all 12):
		hsa-miR-623 hsa-miR-22 hsa-miR-181c hsa-miR-181a hsa-miR-181d hsa-miR-3907 hsa-miR-211 hsa-miR-204

		SwitchGear 3'UTR luciferase reporter plasmid: RPS6KC1 3' UTR sequence

Inhib. RNA Products:		OriGene RNAi products in human, mouse, rat for RPS6KC1
		Predesigned siRNA for gene silencing in human, mouse, rat RPS6KC1

Clone Products:		OriGene clones in human, mouse for RPS6KC1 (see all 13) OriGene ORF clones in mouse, rat for RPS6KC1 OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector (see all 2): RPS6KC1 (NM_012424)
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for RPS6KC1
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat RPS6KC1
		Addgene plasmids for RPS6KC1

Primer Products:		OriGene qPCR primer pairs and template standards for RPS6KC1 OriGene qSTAR qPCR primer pairs in human, mouse for RPS6KC1
		Pre-validated RT² qPCR Primer Assay in human, mouse, rat RPS6KC1
		QuantiTect SYBR Green Assays in human, mouse, rat RPS6KC1
		QuantiFast Probe-based Assays in human, mouse, rat RPS6KC1

Additional mRNA sequence:

AB070706.1 AF037447.1 AF477978.1 AK122921.1 AK122989.1 AK130279.1 AK295053.1 AK299298.1

AL356893.1 BC104769.1 BC143449.1 BC143473.1 BC143474.1 BX647303.1 EF491805.1 EF491820.1

9 DOTS entries:

DT.213470 DT.92334640 DT.101971020 DT.101969674 DT.40275803 DT.121362049 DT.75151904 DT.100749650

DT.40266310

Selected AceView cDNA sequences (see all 108):

CB159180 AB070706 BM981369 BU686409 BF439060 AI874333 CA771867 AA670286

AW273740 AA788825 AA774170 BU625559 AI190238 BI915114 BX098178 BM678614

AI740675 BP378802 BX089129 AL356893 BM793456 BM452011 BQ446176 W21053

GeneLoc Exon Structure

4 Alternative Splicing Database (ASD) splice patterns (SP) for RPS6KC1 About this scheme

ExUns:	1	^	2	^	3	^	4	^	5	^	6	^	7	^	8	^	9	^	10	^	11	^	12	^	13a	·	13b	^	14	^	15	^	16	^	17a	·	17b
SP1:					-																		-
SP2:			-		-																		-
SP3:											-												-
SP4:

ECgene alternative splicing isoforms for RPS6KC1

(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GenesLikeMe, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE ¹MOPED, ²PaxDb, and ³MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

RPS6KC1 expression in normal human tissues (normalized intensities)
See probesets specificity/sensitivity at GeneAnnot
About this imageBioGPS <intensity>^2/3
CGAP TAG: GTGAAACATT

About this image

RPS6KC1 expression in embryonic tissues and stem cells About this table

Data from LifeMap, the Embryonic Development and Stem Cells Database


Blood (Hematopoietic System)
Granulocytes Peripheral Blood

RPS6KC1 Protein expression data from MOPED¹, PaxDb² and MaxQB³:

About this image

RPS6KC1 Protein Expression

SOURCE GeneReport for Unigene cluster: Hs.591416

UniProtKB/Swiss-Prot: KS6C1_HUMAN, Q96S38

Tissue specificity: Highly expressed in testis, skeletal muscle, brain, heart, placenta, kidney and liver and

weakly expressed in thymus, small intestine, lung and colon

Custom PCR Arrays for RPS6KC1

Primer Products:		OriGene qPCR primer pairs and template standards for RPS6KC1 OriGene qSTAR qPCR primer pairs in human, mouse for RPS6KC1
		Pre-validated RT² qPCR Primer Assay in human, mouse, rat RPS6KC1
		QuantiTect SYBR Green Assays in human, mouse, rat RPS6KC1
		QuantiFast Probe-based Assays in human, mouse, rat RPS6KC1

In Situ
Assay Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for RPS6KC1

(Orthologs according to ^1,2HomoloGene (²older version, for species not in ¹newer version), ³euGenes, ⁴SGD , ⁵MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or ⁶Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section

This gene was present in the common ancestor of animals.

Orthologs for RPS6KC1 gene from Selected species (see all 16) About this table

Organism	Taxonomic classification	Gene	Description	Human Similarity	Orthology Type	Details
mouse (Mus musculus)	Mammalia	Rps6kc1^{1 , 5}	ribosomal protein S6 kinase polypeptide 1^{1, 5}	79.64(n)¹ 79.1(a)¹		1 (96.20 cM)⁵ 320119¹ NM_178775.4¹ NP_848890.3¹ 190700202⁵
chicken (Gallus gallus)	Aves	RPS6KC1¹	ribosomal protein S6 kinase, 52kDa, polypeptide 1	74.75(n) 71.79(a)		421362 XM_419422.4 XP_419422.3
lizard (Anolis carolinensis)	Reptilia	RPS6KC1⁶	ribosomal protein S6 kinase, 52kDa, polypeptide 1	68(a)	1 ↔ 1	1(238840457-238968557)
African clawed frog (Xenopus laevis)	Amphibia	BJ626358.1²	--	76.8(n)		BJ626358.1
zebrafish (Danio rerio)	Actinopterygii	RPS6KC1⁶	ribosomal protein S6 kinase, 52kDa, polypeptide 1	48(a)	1 ↔ 1	20(3267620-3315107) ENSDARG00000076212
fruit fly (Drosophila melanogaster)	Insecta	CG7156¹	CG7156	44.87(n) 36.14(a)		42187 NM_142440.2 NP_650697.1
worm (Caenorhabditis elegans)	Secernentea	rskd-1⁶	Protein RSKD-1, isoform a	20(a)	1 → many	V(12284058-12288617) WBGene00010096

ENSEMBL Gene Tree for RPS6KC1 (if available)
TreeFam Gene Tree for RPS6KC1 (if available)

(Paralogs according to ¹HomoloGene,
²Ensembl, and ³SIMAP, Pseudogenes according to ⁴Pseudogene.org Build 68,Sets of similar genes according to GenesLikeMe)
About This Section

Paralogs for RPS6KC1 gene

RPS6KL1² SNX15²

4 SIMAP similar genes for RPS6KC1 using alignment to 3 protein entries: KS6C1_HUMAN (see all proteins):

RPS6KA1 RPS6KL1 RPS6KA2 SNX15

Find genes that share paralogs with RPS6KC1 About GenesLikeMe

(SNPs/Variants according to the ¹NCBI SNP Database, ²Ensembl, ³PupaSUITE, ⁴UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
About This Section

SNP ID	Valid	Clinical significance	Chr 1 pos	Sequence	#	AA Chg	Type	More	#	Allele freq	Pop	Total sample	More
Genomic Data					Transcription Related Data				Allele Frequencies
				--	--	--		--	--
VAR_040654⁴		An ovarian mucinous carcinoma sample⁴	--	see VAR_040654	2	G A	mis⁴		0	--	--	--	--
VAR_040657⁴		A breast infiltrating ductal carcinoma sample⁴	--	see VAR_040657	2	E K	mis⁴		0	--	--	--	--
VAR_040652⁴		A lung neuroendocrine carcinoma sample⁴	--	see VAR_040652	2	L I	mis⁴		0	--	--	--	--
VAR_040656⁴		A lung adenocarcinoma sample⁴	--	see VAR_040656	2	C Y	mis⁴		0	--	--	--	--
rs10524884^1,2	C	--	183967596(+)	`tatat-/ATATATATATATATATATATATATATATATATATAT/ATATATATATATATATATATATAT ATATATATATATATAT/ATATATATATATATATATATATATATATATATATATATATATATATGAGAG`	4	--	int¹ cds¹		1		NA	2
rs74140555^1,2	C,F	--	213222635(+)	`AAAAAG/AAGCAA`	2	--	us2k¹		2		WA	120
rs79885731^1,2	C,F	--	213222690(+)	`ATGCTA/GAGAAT`	2	--	us2k¹		1		EA	120
rs146781513^1,2		--	213223128(+)	`CTAGAC/TGGTAC`	2	--	us2k¹		0	--	--	--	--
rs368696388^1,2	C	--	213223153(+)	`TATCT-/CCTTTT`	2	--	us2k¹		0	--	--	--	--
rs11395555^1,2	C,F	--	213223156(+)	`CTACCC/TTTTTT`	2	--	us2k¹ trp³		6		NA WA CSA	11

HapMap Linkage Disequilibrium report for RPS6KC1 (213224588 - 213448116 bp)

Structural Variations
Database of Genomic Variants (DGV) 10 variations for RPS6KC1: About this table

Variant ID	Type	Subtype	PubMed ID
esv2671923	CNV	Deletion	23128226
esv2666633	CNV	Deletion	23128226
esv2675698	CNV	Deletion	23128226
nsv4476	CNV	Insertion	18451855
nsv508693	CNV	Loss	20534489
nsv826598	CNV	Loss	20364138
nsv508692	CNV	Loss	20534489
esv28931	CNV	Loss	19812545
esv1004277	CNV	Gain	20482838
esv275574	CNV	Gain+Loss	21479260

Site Specific Mutation Identification with PCR Assays

SeqTarget long-range PCR primers for resequencing RPS6KC1

DNA2.0 Custom Variant and Variant Library Synthesis for RPS6KC1

(in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB, Sets of similar genes according to GenesLikeMe)
About This Section

(in PubMed. Associations of this gene to articles via ¹Entrez Gene, ²UniProtKB/Swiss-Prot, ³HGNC, ⁴GAD, ⁵PharmGKB, ⁶HMDB, ⁷DrugBank, ⁸UniProtKB/TrEMBL, ⁹ Novoseek, and/or ¹⁰fRNAdb)
About This Section

PubMed articles for RPS6KC1 gene, integrated from 10 sources (see all 21):
(articles sorted by number of sources associating them with RPS6KC1)

Utopia: connect your pdf to the dynamic
world of online information

Cloning, characterization, and chromosome mapping of RPS6KC1, a novel putative member of the ribosome protein S6 kinase family, to chromosome 12q12-q13.1. (PubMed id 10552933)^{1, 2, 3} Zhang H.... Zhao S. (Genomics 1999)
The DNA sequence and biological annotation of human chromosome 1. (PubMed id 16710414)^{1, 2} Gregory S.G.... Bentley D.R. (Nature 2006)
The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)^{1, 2} Gerhard D.S.... Malek J. (Genome Res. 2004)
Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)^{1, 2} Ota T.... Sugano S. (Nat. Genet. 2004)
Identification and characterization of RPK118, a novel sphingosine kinase-1-binding protein. (PubMed id 12077123)^{1, 2} Hayashi S....Nakamura S. (J. Biol. Chem. 2002)
Quantitative analysis of HSP90-client interactions reveals principles of substrate recognition. (PubMed id 22939624)¹ Taipale M....Lindquist S. (Cell 2012)
Toward an understanding of the protein interaction network of the human liver. (PubMed id 21988832)¹ Wang J....Yang X. (Mol. Syst. Biol. 2011)
Systematic and quantitative assessment of the ubiquitin-modified proteome. (PubMed id 21906983)¹ Kim W....Gygi S.P. (Mol. Cell 2011)
System-wide temporal characterization of the proteome and phosphoproteome of human embryonic stem cell differentiation. (PubMed id 21406692)² Rigbolt K.T....Blagoev B. (Sci. Signal. 2011)
Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. (PubMed id 21139048)¹ Danielsen J.M....Nielsen M.L. (amp 2011)

(in PubMed, OMIM, and NCBI Bookshelf)
About This Section

		AND	OR
Aliases
Free Text

Query String		PubMed OMIM NCBI Bookshelf
	(Note: In FireFox, select the above section and copy using Ctrl-C)

(According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
About This Section

Entrez Gene: 26750	HGNC: 10439	AceView: RPS6KC1	Ensembl:ENSG00000136643	euGenes: HUgn26750
ECgene: RPS6KC1	H-InvDB: RPS6KC1

(According to HUGE)
About This Section

(According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
About This Section

Name	Description
PharmGKB entry for RPS6KC1	Pharmacogenomics, SNPs, Pathways

Intellectual Property for RPS6KC1 gene
(Patent information from GeneIP, Licensable technologies from WIS Yeda, Salk, Tufts, IP news from LifeMap Sciences, Inc.)

About This Section

Patent Information for RPS6KC1 gene:
Search GeneIP for patents involving RPS6KC1

GeneCards and IP:
Japan Patent Office Licenses GeneCards European Patent Office Licenses GeneCards Improving the IP Search

(Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, eBioscience, antibodies-online, GeneTex, and/or others, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Addgene, Cell lines from GenScript, and ESI BIO, Flow cytometery from eBioscience, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
Advanced Cell Diagnostics, Animal models from genOway)
About This Section

	EMD Millipore Kits and Assays for the Analysis of RPS6KC1
	Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
	Browse Small Molecules at EMD Millipore
	EMD Millipore Purified and/or Recombinant RPS6KC1 Protein

	EMD Millipore genomic analysis products

	Browse Antibodies		Browse Cell Culture Products
	Browse ELISAs		Browse Flow Cytometry Kits
	Browse Primer Pairs		Browse Enzyme Activity Assays/Reagents
	Browse ELISpot/FluoroSpot Kits/Development Modules		Browse TFB/Immunoprecipitation Assays
	Browse Apoptosis Detection Kits/Reagents		Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents
	Browse DNA Damage/Repair Kits/Reagents		Browse Luminex Assays
	Browse Cell Selection/Detection Kits/Reagents		Browse Secondary Antibodies/Controls/Staining Reagents
	Browse Recombinant/Natural Proteins		Browse Stem Cell Products
	Browse cDNA Clones		Browse Proteome Profiler Antibody Arrays

	OriGene Antibodies for RPS6KC1		OriGene RNAi products in human, mouse, rat for RPS6KC1
	OriGene qPCR primer pairs and template standards for RPS6KC1		OriGene Protein Over-expression Lysate for RPS6KC1
	OriGene MassSpec for RPS6KC1		OriGene clones in human, mouse for RPS6KC1
	OriGene qSTAR qPCR primer pairs in human, mouse for RPS6KC1		OriGene Purified Protein for RPS6KC1
	OriGene ORF clones in mouse, rat for RPS6KC1		OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
	OriGene Custom Antibody Services for RPS6KC1		OriGene Custom Protein Services for RPS6KC1

	Block miRNA regulation of human, mouse, rat RPS6KC1 using miScript Target Protectors		SeqTarget long-range PCR primers for resequencing RPS6KC1
	DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat RPS6KC1		Predesigned siRNA for gene silencing in human, mouse, rat RPS6KC1
	QuantiFast Probe-based Assays in human, mouse, rat RPS6KC1		QuantiTect SYBR Green Assays in human, mouse, rat RPS6KC1
	Custom PCR Arrays for RPS6KC1		Search Chromatin IP Primers for RPS6KC1
	Pre-validated RT² qPCR Primer Assay in human, mouse, rat RPS6KC1		GeneGlobe Interaction Network for RPS6KC1
	Regulatory tfbs in RPS6KC1 promoter

	GenScript Custom Purified and Recombinant Proteins Services for RPS6KC1		GenScript cDNA clones with any tag delivered in your preferred vector for RPS6KC1
	GenScript Custom Assay Services for RPS6KC1		GenScript Custom overexpressing Cell Line Services for RPS6KC1
	CloneReady with Over 120,000 Genes		Gene Synthesis: Any Gene in Any Vector
	Vector-based siRNA and miRNA, Ready for Transfection		Gene Mutant Library, Variants up to 10^11
	Plasmid Preparation		Custom Peptide Services

Search for Antibodies & Assays

Search Tocris compounds for RPS6KC1 (KS6C1)

	Browse Sino Biological Proteins
	Browse Sino Biological Cell Lysates
	Browse Sino Biological cDNA Clones
	4000+ Proteins
	Search Sino Biological for antibodies, proteins & pathways
	Protein Production Services
	Transfection Reagents
	Protein A/G/L resins
	Isotyping reagents

Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

	Novus Tissue Slides
	RPS6KC1 antibodies
	RPS6KC1 proteins
	RPS6KC1 lysates

	Antibodies for RPS6KC1
	See all of Abcam's Antibodies, Kits and Proteins for RPS6KC1
	Custom Antibody / Protein Production Service
	Bulk Purchasing
	Advantages of Rabbit Monoclonal antibodies
	Abcam protocols and scientific support

Browse ProSpec Recombinant Proteins

	Proteins for RPS6KC1
	Antibodies for RPS6KC1
	ELISAs for RPS6KC1
	CLIAs for RPS6KC1

Browse ESI BIO Cell Lines and PureStem Progenitors for RPS6KC1

	Gene Synthesis
	Protein Engineering
	Variant Library Synthesis
	Codon Optimization
	Protein Production and Purification

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for RPS6KC1

	SwitchGear 3'UTR luciferase reporter plasmids for RPS6KC1
	SwitchGear Promoter luciferase reporter plasmids for RPS6KC1

Search ThermoFisher Antibodies for RPS6KC1

Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat RPS6KC1

Browse compounds at ApexBio

Addgene plasmids for RPS6KC1

	Search eBioscience for proteins for RPS6KC1
	Search eBioscience for elisas for RPS6KC1
	eBioscience FlowRNA Probe Sets

genOway: Develop your customized and physiologically relevant rodent model for RPS6KC1

	antibodies-online antibodies for RPS6KC1 (24 products)
	antibodies-online kits for RPS6KC1 (4 products)
	antibodies-online peptides for RPS6KC1
	antibodies-online proteins for RPS6KC1 (2 products)

Search GeneTex for proteins for RPS6KC1

GeneCards Home - Full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014 , 21 Aug 2014 , 8 Sep 2014 , 2 Nov 2014 , 8 Jan 2015 , 3 Feb 2015

View Random Gene

Category			(GIFtS: )
GIFtS Group

The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

The GeneCards Human Gene Database

Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

Hot genes Disease genes RPS6KC1 gene at Home site.

Version: 3.12.348 25 Feb 2015
hostname: 356977-web1.xennexinc.com index build: 128 solr: 1.4

GeneCards Suite

Advanced Search

Export list of displayed genes

RPS6KC1 Gene

Ribosomal Protein S6 Kinase, 52kDa, Polypeptide 1

Aliases
for RPS6KC1 gene

Summaries
for RPS6KC1 gene

Genomic Views
for RPS6KC1 gene

Proteins
for RPS6KC1 gene

RPS6KC1 Human Recombinant Protein Products:

RPS6KC1 Antibody Products:

RPS6KC1 Assay Products:

Domains /
Families
for RPS6KC1 gene

Function
for RPS6KC1 gene

Localization
for RPS6KC1 gene

Pathways & Interactions
for RPS6KC1 gene

Drugs & Compounds
for RPS6KC1 gene

Transcripts
for RPS6KC1 gene

Expression
for RPS6KC1 gene

Orthologs
for RPS6KC1 gene

Paralogs
for RPS6KC1 gene

Genomic Variants
for RPS6KC1 gene

Disorders / Diseases
for RPS6KC1 gene

Publications
for RPS6KC1 gene

External Searches for RPS6KC1 gene

Genome Databases showing RPS6KC1 gene

Other Databases showing RPS6KC1 gene

Specialized Databases showing RPS6KC1 gene

Intellectual Property
for RPS6KC1 gene

Products
for RPS6KC1 gene

View Random Gene

GeneCards Suite

Advanced Search

Export list of displayed genes

RPS6KC1 Gene

Ribosomal Protein S6 Kinase, 52kDa, Polypeptide 1

Aliasesfor RPS6KC1 gene

Summariesfor RPS6KC1 gene

Genomic Viewsfor RPS6KC1 gene

Proteinsfor RPS6KC1 gene

RPS6KC1 Human Recombinant Protein Products:

RPS6KC1 Antibody Products:

RPS6KC1 Assay Products:

Domains /Familiesfor RPS6KC1 gene

Functionfor RPS6KC1 gene

Localizationfor RPS6KC1 gene

Pathways & Interactionsfor RPS6KC1 gene

Drugs & Compoundsfor RPS6KC1 gene

Transcriptsfor RPS6KC1 gene

Expression for RPS6KC1 gene

Orthologsfor RPS6KC1 gene

Paralogsfor RPS6KC1 gene

Genomic Variantsfor RPS6KC1 gene

Disorders / Diseasesfor RPS6KC1 gene

Publicationsfor RPS6KC1 gene

External Searches for RPS6KC1 gene

Genome Databases showing RPS6KC1 gene

Other Databases showing RPS6KC1 gene

Specialized Databases showing RPS6KC1 gene

Intellectual Propertyfor RPS6KC1 gene

Productsfor RPS6KC1 gene

View Random Gene

Aliases
for RPS6KC1 gene

Summaries
for RPS6KC1 gene

Genomic Views
for RPS6KC1 gene

Proteins
for RPS6KC1 gene

Domains /
Families
for RPS6KC1 gene

Function
for RPS6KC1 gene

Localization
for RPS6KC1 gene

Pathways & Interactions
for RPS6KC1 gene

Drugs & Compounds
for RPS6KC1 gene

Transcripts
for RPS6KC1 gene

Expression
for RPS6KC1 gene

Orthologs
for RPS6KC1 gene

Paralogs
for RPS6KC1 gene

Genomic Variants
for RPS6KC1 gene

Disorders / Diseases
for RPS6KC1 gene

Publications
for RPS6KC1 gene

Intellectual Property
for RPS6KC1 gene

Products
for RPS6KC1 gene