Home
GeneCards Guide
Suite
- MalaCards
- GeneALaCart
- GeneDecks
- GeneIP
- GeneLoc
Terms and Conditions
- Terms of Use
- 3rd Party Notice
About Us
- GeneCards Team
- Our Publications
- Citing GeneCards
- Licensing Agreement
- Weizmann Institute
- LifeMap Sciences Inc
User Feedback
Mirror sites

Set Analyses:

Generates a file of GeneCards annotations for your list of genes

Advanced Search

Search By

Section (entire)

for

All GeneCards Within gene subset (to enable gene prioritization):
or upload a file of gene symbols

Category Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21

GIFtS
-

RPS6KC1 Gene

protein-coding GIFtS: 53
GCID: GC01P213224

Ribosomal Protein S6 Kinase, 52kDa, Polypeptide 1

(Previous names: ribosomal protein S6 kinase, 52kD, polypeptide 1)

2 related diseases
at

MalaCards

(According to ¹HGNC, ²Entrez Gene,
³UniProtKB/Swiss-Prot, ⁴UniProtKB/TrEMBL, ⁵OMIM, ⁶GeneLoc, ⁷Ensembl, ⁸DME, ⁹miRBase, ¹⁰fRNAdb, ¹²H-InvDB, ¹³NCBI, ¹⁴NONCODE, and/or ¹⁵RNAdb)
About This Section

Aliases
Ribosomal Protein S6 Kinase, 52kDa, Polypeptide 1¹ ²		SPHK1-Binding Protein² ³
Ribosomal S6 Kinase-Like Protein With Two PSK Domains 118 KDa Protein² ³		Ribosomal Protein S6 Kinase, 52kD, Polypeptide 1¹
52 KDa Ribosomal Protein S6 Kinase² ³		humS6PKh1²
RPK118² ³		Ribosomal Protein S6 Kinase Delta-1²
S6K-delta-1² ³		EC 2.7.11.1³

External Ids:	HGNC: 10439¹	Entrez Gene: 26750²	Ensembl: ENSG00000136643⁷	UniProtKB: Q96S38³

Export aliases for RPS6KC1 gene to outside databases

Previous GC identifers: GC01P212070 GC01P209067 GC01P209840 GC01P210281 GC01P209612 GC01P211291 GC01P183899

(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

GeneCards Summary for RPS6KC1 Gene:

RPS6KC1 (ribosomal protein S6 kinase, 52kDa, polypeptide 1) is a protein-coding gene. Diseases associated with RPS6KC1 include paraplegia, and spasticity, and among its related super-pathways are Nanog in Mammalian ESC Pluripotency and CNTF Signaling. GO annotations related to this gene include protein serine/threonine kinase activity and phosphatidylinositol binding. An important paralog of this gene is RPS6KL1.

UniProtKB/Swiss-Prot: KS6C1_HUMAN, Q96S38

Function: May be involved in transmitting sphingosine-1 phosphate (SPP)-mediated signaling into the cell

Gene Wiki entry for RPS6KC1 Gene

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 73), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section

RefSeq DNA sequence:

NC_000001.10 NT_167186.1 NC_018912.2

Regulatory elements:

SABiosciences Regulatory transcription factor binding sites in the RPS6KC1 gene promoter:
MEF-2A Elk-1 NRF-2 MEF-2 Olf-1 LCR-F1 Egr-4 c-Ets-1
Other transcription factors

SwitchGear Promoter luciferase reporter plasmid: RPS6KC1 promoter sequence

Search SABiosciences Chromatin IP Primers for RPS6KC1

Epigenetics:

QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat RPS6KC1

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 1q41 Ensembl cytogenetic band: 1q32.3 HGNC cytogenetic band: 1q41

RPS6KC1 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
RPS6KC1 gene location

GeneLoc information about chromosome 1 GeneLoc Exon Structure

GeneLoc location for GC01P213224: view genomic region (about GC identifiers)

Start:	213,224,588 bp from pter	End:	213,448,116 bp from pter
Size:	223,529 bases	Orientation:	plus strand

(According to UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE ¹MOPED, ²PaxDb, and ³MAXQB RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Ontologies according to Gene Ontology Consortium 01 Oct 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

UniProtKB/Swiss-Prot: KS6C1_HUMAN, Q96S38 (See protein sequence)

Recommended Name: Ribosomal protein S6 kinase delta-1

Size: 1066 amino acids; 118682 Da

Subunit: Interacts with SPHK1 and phosphatidylinositol 3-phosphate

Subcellular location: Cytoplasm. Membrane. Note=Also found in some small dot-like or ring-shaped early endosome

structures

Caution: Instead of Lys-820, Arg-820 is found at the binding site

Sequence caution: Sequence=CAB92850.1; Type=Erroneous initiation;

Secondary accessions: B1APS8 B3KVM4 D3DTA4 Q8TDD3 Q9NSF4 Q9UL66

Alternative splicing: 2 isoforms: Q96S38-1 Q96S38-2 (No experimental confirmation available)

Explore the universe of human proteins at neXtProt for RPS6KC1: NX_Q96S38

Explore proteomics data for RPS6KC1 at MOPED

Post-translational modifications:

View modification sites using PhosphoSitePlus

View neXtProt modification sites for NX_Q96S38

RPS6KC1 Protein expression data from MOPED¹, PaxDb² and MAXQB³ : About this image

REFSEQ proteins (2 alternative transcripts):

NP_001129610.1 NP_036556.2

ENSEMBL proteins:

ENSP00000355927 ENSP00000355926 ENSP00000442306 ENSP00000439282

Human Recombinant Protein Products for RPS6KC1:

	EMD Millipore Purified and/or Recombinant RPS6KC1 Protein
	Browse R&D Systems for human recombinant proteins
	Browse recombinant and purified proteins available from Enzo Life Sciences
	OriGene Purified Protein for RPS6KC1 OriGene Protein Over-expression Lysate for RPS6KC1 OriGene MassSpec for RPS6KC1 OriGene Custom Protein Services for RPS6KC1
	GenScript Custom Purified and Recombinant Proteins Services for RPS6KC1
	Novus Biologicals RPS6KC1 Protein Novus Biologicals RPS6KC1 Lysate
	Browse Sino Biological Recombinant Proteins Browse Sino Biological Cell Lysates
	Browse ProSpec Recombinant Proteins
	Cloud-Clone Corp. Proteins for RPS6KC1

Gene Ontology (GO): 3 cellular component terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0005769	early endosome	IDA	15750338
GO:0005840	ribosome	--	--
GO:0016020	membrane	IEA	--

RPS6KC1 for ontologies About GeneDecksing

RPS6KC1 Antibody Products:

	Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
	Browse R&D Systems for Antibodies
	Browse OriGene Antibodies OriGene Custom Antibody Services for RPS6KC1
	GenScript Custom Superior Antibodies Services for RPS6KC1
	Novus Biologicals RPS6KC1 Antibodies
	Abcam antibodies for RPS6KC1
	Cloud-Clone Corp. Antibodies for RPS6KC1
	Search ThermoFisher Antibodies for RPS6KC1
	LSBio Antibodies in human, mouse, rat for RPS6KC1

Assay Products for RPS6KC1:

	Browse Kits and Assays available from EMD Millipore
	OriGene Custom Assay Services for RPS6KC1
	Browse R&D Systems for biochemical assays
	GenScript Custom Assay Services for RPS6KC1
	Browse Enzo Life Sciences for kits & assays
	Cloud-Clone Corp. ELISAs for RPS6KC1 Cloud-Clone Corp. CLIAs for RPS6KC1

(According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section

IUPHAR Guide to PHARMACOLOGY protein family classification: ribosomal protein S6 kinase, 52kDa, polypeptide 1

RSKL family

Other AGC kinases

4 InterPro protein domains:

IPR001683 Phox

IPR011009 Kinase-like_dom

IPR000719 Prot_kinase_cat_dom

IPR007330 MIT

Graphical View of Domain Structure for InterPro Entry Q96S38

ProtoNet protein and cluster: Q96S38

1 Blocks protein domain: IPB001683 Phox-like

UniProtKB/Swiss-Prot: KS6C1_HUMAN, Q96S38

Domain: The first protein kinase domain appears to be a pseudokinase domain as it does not contain the classical

characteristics, such as the ATP-binding motif, ATP-binding site and active site

Similarity: Belongs to the protein kinase superfamily. Ser/Thr protein kinase family. S6 kinase subfamily

Similarity: Contains 1 MIT domain

Similarity: Contains 2 protein kinase domains

Similarity: Contains 1 PX (phox homology) domain

RPS6KC1 for domains About GeneDecksing

(According to ¹UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or ²DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, Vector BioLabs, and Sirion Biotech, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene.)
About This Section

Molecular Function:

UniProtKB/Swiss-Prot Summary: KS6C1_HUMAN, Q96S38

Function: May be involved in transmitting sphingosine-1 phosphate (SPP)-mediated signaling into the cell

Catalytic activity: ATP + a protein = ADP + a phosphoprotein

Genatlas biochemistry entry for RPS6KC1:

ribosomal protein S6 kinase,polypeptide 1,expressed highly in testis,skeletal muscle,brain and pancreas,not

involved in vivo in the phosphorylation of RPS6,mediating protein synthesis initiation and elongation induced by

hormones or growth factors,maybe playing an essentilal regulatory role in protein synthesis during cell

proliferation

Enzyme Number (IUBMB): EC 2.7.11.1¹

Gene Ontology (GO): 5/6 molecular function terms (GO ID links to tree view) (see all 6): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0004672	protein kinase activity	--	--
GO:0004674	protein serine/threonine kinase activity	IEA	--
GO:0005515	protein binding	IPI	15750338
GO:0005524	ATP binding	IEA	--
GO:0016772	transferase activity, transferring phosphorus-containing groups	--	--

RPS6KC1 for ontologies About GeneDecksing

Phenotypes:
2 GenomeRNAi human phenotypes for RPS6KC1:

Decreased Wnt reporter activit

Elongated cells

Animal Models:

inGenious Targeting Laboratory - Custom generated mouse model solutions for RPS6KC1

inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for RPS6KC1

genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for RPS6KC1

genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for RPS6KC1

miRNA Products:		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat RPS6KC1
		8/12 QIAGEN miScript miRNA Assays for microRNAs that regulate RPS6KC1 (see all 12):
		hsa-miR-623 hsa-miR-22 hsa-miR-181c hsa-miR-181a hsa-miR-181d hsa-miR-3907 hsa-miR-211 hsa-miR-204

		SwitchGear 3'UTR luciferase reporter plasmid: RPS6KC1 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene RNAi products in human, mouse, rat for RPS6KC1
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat RPS6KC1

Gene Editing Products:			DNA2.0 Custom Protein Engineering Service for RPS6KC1
			Sirion Biotech Customized adenovirus for overexpression of RPS6KC1

Clone Products:		Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
		OriGene clones in human, mouse for RPS6KC1 (see all 13) OriGene ORF clones in mouse, rat for RPS6KC1 OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector (see all 2): RPS6KC1 (NM_012424)
		Browse Sino Biological Human cDNA Clones
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for RPS6KC1
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat RPS6KC1
		Sirion Biotech Customized lentivirus for stable overexpression of RPS6KC1 Customized lentivirus expression plasmids for stable overexpression of RPS6KC1

Cell Line Products:		GenScript Custom overexpressing Cell Line Services for RPS6KC1
		Search LifeMap BioReagents cell lines for RPS6KC1

In Situ Assay
Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for RPS6KC1

(Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to ¹UniProtKB, ²MINT, ³I2D, and/or ⁴STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene).
About This Section

SuperPaths for RPS6KC1 About

See pathways by source

SuperPath

Contained pathways About

Nanog in Mammalian ESC Pluripotency

14-3-3 Induced Intracellular Signaling

0.59

CNTF Signaling

FLT3 Signaling

0.50

2 Downloadable PowerPoint Slides of QIAGEN Pathway Central Maps for RPS6KC1

	FLT3 Signaling
	14-3-3 Induced Intracellular Signaling

Interactions:

SABiosciences Gene Network Central^TM Interacting Genes and Proteins Network for RPS6KC1

STRING Interaction Network Preview (showing 5 interactants - click image to see 11)

5/16 Interacting proteins for RPS6KC1 (Q96S38^{2, 3} ENSP00000355927⁴) via UniProtKB, MINT, STRING, and/or I2D (see all 16)

Interactant		Interaction Details
GeneCard	External ID(s)	Interaction Details
ENSG00000225987	P40425²^,³, ENSP00000403948⁴	MINT-62747 MINT-62671 MINT-62573 I2D: score=4 STRING: ENSP00000403948
ENSG00000237344	P40425²^,³, ENSP00000397177⁴	MINT-62747 MINT-62671 MINT-62573 I2D: score=4 STRING: ENSP00000397177
PBX2	P40425²^,³, ENSP00000364190⁴	MINT-62747 MINT-62671 MINT-62573 I2D: score=4 STRING: ENSP00000364190
ENSG00000206315	P40425²^,³	MINT-62747 MINT-62671 MINT-62573 I2D: score=4
ENSG00000224952	P40425²^,³	MINT-62747 MINT-62671 MINT-62573 I2D: score=4

About this table

Gene Ontology (GO): 3 biological process terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0006468	protein phosphorylation	--	--
GO:0007154	cell communication	--	--
GO:0007165	signal transduction	TAS	10552933

RPS6KC1 for ontologies About GeneDecksing

(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
About This Section

Browse Small Molecules at EMD Millipore

Browse drugs & compounds from Enzo Life Sciences

Browse Tocris compounds for RPS6KC1 (KS6C1)

Search CenterWatch for drugs/clinical trials and news about RPS6KC1 / KS6C1

(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
RNAi Products from EMD Millipore,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Sirion Biotech, Primers from OriGene, SABiosciences, and/or QIAGEN )
About This Section

REFSEQ mRNAs for RPS6KC1 gene (2 alternative transcripts):

NM_001136138.1 NM_012424.3

Unigene Cluster for RPS6KC1:

Ribosomal protein S6 kinase, 52kDa, polypeptide 1

Hs.591416 [show with all ESTs]

Unigene Representative Sequence: NM_012424

7 Ensembl transcripts including schematic representations, and UCSC links where relevant:

ENST00000366960(uc010ptr.2 uc010pts.2 uc010ptt.2 uc010ptu.2 uc010ptv.2)

ENST00000366959(uc001hkd.3) ENST00000490299(uc001hke.3) ENST00000468069

ENST00000491616 ENST00000543470(uc009xdh.2 uc009xdi.1) ENST00000543354

miRNA Products:		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat RPS6KC1
		8/12 QIAGEN miScript miRNA Assays for microRNAs that regulate RPS6KC1 (see all 12):
		hsa-miR-623 hsa-miR-22 hsa-miR-181c hsa-miR-181a hsa-miR-181d hsa-miR-3907 hsa-miR-211 hsa-miR-204

		SwitchGear 3'UTR luciferase reporter plasmid: RPS6KC1 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene RNAi products in human, mouse, rat for RPS6KC1
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat RPS6KC1

Clone Products:		OriGene clones in human, mouse for RPS6KC1 (see all 13) OriGene ORF clones in mouse, rat for RPS6KC1 OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector (see all 2): RPS6KC1 (NM_012424)
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for RPS6KC1
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat RPS6KC1
		Sirion Biotech Customized lentivirus for stable overexpression of RPS6KC1 Customized lentivirus expression plasmids for stable overexpression of RPS6KC1

Primer Products:		OriGene qPCR primer pairs and template standards for RPS6KC1 OriGene qSTAR qPCR primer pairs in human, mouse for RPS6KC1
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat RPS6KC1
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat RPS6KC1
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat RPS6KC1

Additional mRNA sequence:

AB070706.1 AF037447.1 AF477978.1 AK122921.1 AK122989.1 AK130279.1 AK295053.1 AK299298.1

AL356893.1 BC104769.1 BC143449.1 BC143473.1 BC143474.1 BX647303.1 EF491805.1 EF491820.1

9 DOTS entries:

DT.213470 DT.92334640 DT.101971020 DT.101969674 DT.40275803 DT.121362049 DT.75151904 DT.100749650

DT.40266310

24/108 AceView cDNA sequences (see all 108):

AA774170 CA771867 CB529015 AI874333 BQ183843 AA788825 CA773539 AI740675

BM678614 AA670286 CA772736 BF439060 BP378802 AW591866 CA436918 AI190238

BX098178 AI370125 BM793456 BM452011 BQ446176 W21053 AA102718 BI915114

GeneLoc Exon Structure

4 Alternative Splicing Database (ASD) splice patterns (SP) for RPS6KC1 About this scheme

ExUns:	1	^	2	^	3	^	4	^	5	^	6	^	7	^	8	^	9	^	10	^	11	^	12	^	13a	·	13b	^	14	^	15	^	16	^	17a	·	17b
SP1:					-																		-
SP2:			-		-																		-
SP3:											-												-
SP4:

ECgene alternative splicing isoforms for RPS6KC1

(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

RPS6KC1 expression in normal human tissues (normalized intensities) RPS6KC1 embryonic expression: see
See probesets specificity/sensitivity at GeneAnnot
About this imageBioGPS <intensity>^2/3
CGAP TAG: GTGAAACATT

About this image

RPS6KC1 expression in embryonic tissues and stem cells About this table

Data from LifeMap, the Embryonic Development and Stem Cells Database

5/4 selected tissues (see all 4) fully expand


Nose (Sensory Organs) fully expand to see all 2 entries
sensory organ/nose/nasal cavity

Neural Crest (Sensory Organs)
sensory organ/nose/vomeronasal organ

Testis (Reproductive System)
sperm

Blood (Hematopoietic System)
Granulocytes Peripheral Blood

See RPS6KC1 Protein Expression from SPIRE MOPED and PaxDB
Genevestigator expression for RPS6KC1

SOURCE GeneReport for Unigene cluster: Hs.591416

UniProtKB/Swiss-Prot: KS6C1_HUMAN, Q96S38

Tissue specificity: Highly expressed in testis, skeletal muscle, brain, heart, placenta, kidney and liver and

weakly expressed in thymus, small intestine, lung and colon

SABiosciences Custom PCR Arrays for RPS6KC1

Primer Products:		OriGene qPCR primer pairs and template standards for RPS6KC1 OriGene qSTAR qPCR primer pairs in human, mouse for RPS6KC1
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat RPS6KC1
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat RPS6KC1
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat RPS6KC1

In Situ
Assay Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for RPS6KC1

(Orthologs according to ^1,2HomoloGene (²older version, for species not in ¹newer version), ³euGenes, ⁴SGD , ⁵MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or ⁶Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section

This gene was present in the common ancestor of animals.

Orthologs for RPS6KC1 gene from 7/15 species (see all 15) About this table

Organism	Taxonomic classification	Gene	Description	Human Similarity	Orthology Type	Details
mouse (Mus musculus)	Mammalia	Rps6kc1^{1 , 5}	ribosomal protein S6 kinase polypeptide 1^{1, 5}	79.81(n)¹ 79.34(a)¹		1 (96.20 cM)⁵ 320119¹ NM_178775.4¹ NP_848890.3¹ 190700202⁵
chicken (Gallus gallus)	Aves	RPS6KC1¹	ribosomal protein S6 kinase, 52kDa, polypeptide 1	74.94(n) 71.92(a)		421362 XM_419422.3 XP_419422.3
lizard (Anolis carolinensis)	Reptilia	RPS6KC1⁶	Uncharacterized protein	68(a)	1 ↔ 1	1(238840457-238968557)
African clawed frog (Xenopus laevis)	Amphibia	BJ626358.1²	--	76.8(n)		BJ626358.1
zebrafish (Danio rerio)	Actinopterygii	RPS6KC1⁶	ribosomal protein S6 kinase, 52kDa, polypeptide 1	50(a)	1 ↔ 1	20(3267516-3315107)
fruit fly (Drosophila melanogaster)	Insecta	CG7156¹	CG7156	43.2(n) 33.75(a)		42187 NM_142440.2 NP_650697.1
worm (Caenorhabditis elegans)	Secernentea	rskd-1⁶	Protein RSKD-1, isoform a	14(a)	1 → many	V(12284058-12288617)

ENSEMBL Gene Tree for RPS6KC1 (if available)
TreeFam Gene Tree for RPS6KC1 (if available)

(Paralogs according to ¹HomoloGene,
²Ensembl, and ³SIMAP, Pseudogenes according to ⁴Pseudogene.org Build 68)
About This Section

Paralogs for RPS6KC1 gene

RPS6KL1² SNX15²

4 SIMAP similar genes for RPS6KC1 using alignment to 3 protein entries: KS6C1_HUMAN (see all proteins):

RPS6KA1 RPS6KL1 RPS6KA2 SNX15

RPS6KC1 for paralogs About GeneDecksing

(SNPs/Variants according to the ¹NCBI SNP Database, ²Ensembl, ³PupaSUITE, ⁴UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
About This Section

SNP ID	Valid	Clinical significance	Chr 1 pos	Sequence	#	AA Chg	Type	More	#	Allele freq	Pop	Total sample	More
Genomic Data					Transcription Related Data				Allele Frequencies
				--	--	--		--	--
VAR_040654⁴		An ovarian mucinous carcinoma sample⁴	--	see VAR_040654	2	G A	mis⁴		0	--	--	--	--
VAR_040657⁴		A breast infiltrating ductal carcinoma sample⁴	--	see VAR_040657	2	E K	mis⁴		0	--	--	--	--
VAR_040652⁴		A lung neuroendocrine carcinoma sample⁴	--	see VAR_040652	2	L I	mis⁴		0	--	--	--	--
VAR_040656⁴		A lung adenocarcinoma sample⁴	--	see VAR_040656	2	C Y	mis⁴		0	--	--	--	--
rs10524884^1,2	C	--	183967596(+)	`tatat-/ATATATATATATATATATATATATATATATATATAT/ATATATATATATATATATATATAT ATATATATATATATAT/ATATATATATATATATATATATATATATATATATATATATATATATGAGAG`	4	--	int¹ cds¹		1		NA	2
rs74140555^1,2	C,F	--	213222635(+)	`AAAAAG/AAGCAA`	2	--	us2k¹		2		WA	120
rs79885731^1,2	C,F	--	213222690(+)	`ATGCTA/GAGAAT`	2	--	us2k¹		1		EA	120
rs146781513^1,2		--	213223128(+)	`CTAGAC/TGGTAC`	2	--	us2k¹		0	--	--	--	--
rs368696388^1,2	C	--	213223153(+)	`TATCT-/CCTTTT`	2	--	us2k¹		0	--	--	--	--
rs11395555^1,2	C,F	--	213223156(+)	`CTACCC/TTTTTT`	2	--	us2k¹ trp³		6		NA WA CSA	11

HapMap Linkage Disequilibrium report for RPS6KC1 (213224588 - 213448116 bp)

Structural Variations
Database of Genomic Variants (DGV) 10 variations for RPS6KC1: About this table

Variant ID	Type	Subtype	PubMed ID
esv2671923	CNV	Deletion	23128226
esv2666633	CNV	Deletion	23128226
esv2675698	CNV	Deletion	23128226
nsv4476	CNV	Insertion	18451855
nsv508693	CNV	Loss	20534489
nsv826598	CNV	Loss	20364138
nsv508692	CNV	Loss	20534489
esv28931	CNV	Loss	19812545
esv1004277	CNV	Gain	20482838
esv275574	CNV	Gain+Loss	21479260

SABiosciences Cancer Mutation PCR Assays

QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing RPS6KC1

DNA2.0 Custom Variant and Variant Library Synthesis for RPS6KC1

(in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
About This Section

2 diseases for RPS6KC1: About MalaCards

paraplegia spasticity

RPS6KC1 for disorders About GeneDecksing

Export disorders for RPS6KC1 gene to outside databases

(in PubMed. Associations of this gene to articles via ¹Entrez Gene, ²UniProtKB/Swiss-Prot, ³HGNC, ⁴GAD, ⁵PharmGKB, ⁶HMDB, ⁷DrugBank, ⁸UniProtKB/TrEMBL, ⁹ Novoseek, and/or ¹⁰fRNAdb)
About This Section

PubMed articles for RPS6KC1 gene, integrated from 9 sources (see all 21):
(articles sorted by number of sources associating them with RPS6KC1)

Utopia: connect your pdf to the dynamic
world of online information

Cloning, characterization, and chromosome mapping of RPS6KC1, a novel putative member of the ribosome protein S6 kinase family, to chromosome 12q12-q13.1. (PubMed id 10552933)^{1, 2, 3} Zhang H.... Zhao S. (1999)
The DNA sequence and biological annotation of human chromosome 1. (PubMed id 16710414)^{1, 2} Gregory S.G.... Bentley D.R. (2006)
The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)^{1, 2} Gerhard D.S....Malek J. (2004)
Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)^{1, 2} Ota T.... Sugano S. (2004)
Identification and characterization of RPK118, a novel sphingosine kinase-1-binding protein. (PubMed id 12077123)^{1, 2} Hayashi S....Nakamura S. (2002)
Quantitative analysis of HSP90-client interactions rev eals principles of substrate recognition. (PubMed id 22939624)¹ Taipale M....Lindquist S. (2012)
Toward an understanding of the protein interaction net work of the human liver. (PubMed id 21988832)¹ Wang J....Yang X. (2011)
Systematic and quantitative assessment of the ubiquiti n-modified proteome. (PubMed id 21906983)¹ Kim W....Gygi S.P. (2011)
System-wide temporal characterization of the proteome and phosphoproteome of human embryonic stem cell differentiation. (PubMed id 21406692)² Rigbolt K.T....Blagoev B. (2011)
Mass spectrometric analysis of lysine ubiquitylation r eveals promiscuity at site level. (PubMed id 21139048)¹ Danielsen J.M....Nielsen M.L. (2011)

(in PubMed, OMIM, and NCBI Bookshelf)
About This Section

		AND	OR
Aliases
Free Text

Query String		PubMed OMIM NCBI Bookshelf
	(Note: In FireFox, select the above section and copy using Ctrl-C)

(According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
About This Section

Entrez Gene: 26750	HGNC: 10439	AceView: RPS6KC1	Ensembl:ENSG00000136643	euGenes: HUgn26750
ECgene: RPS6KC1	H-InvDB: RPS6KC1

(According to HUGE)
About This Section

(According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
About This Section

Name	Description
PharmGKB entry for RPS6KC1	Pharmacogenomics, SNPs, Pathways

Intellectual Property for RPS6KC1 gene
(Patent information from GeneIP, Licensable technologies from WIS Yeda, Salk, Tufts, IP news from LifeMap Sciences, Inc.)

About This Section

Patent Information for RPS6KC1 gene:
Search GeneIP for patents involving RPS6KC1

GeneCards and IP:
Japan Patent Office Licenses GeneCards European Patent Office Licenses GeneCards Improving the IP Search

(Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Sirion Biotech, Cell lines from GenScript, and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
About This Section

	EMD Millipore Purified and/or Recombinant RPS6KC1 Protein
	Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
	Browse for Gene Knock-down Tools from EMD Millipore
	Browse Kits and Assays available from EMD Millipore
	Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
	Browse Small Molecules at EMD Millipore

	EMD Millipore Custom Antibody & Bulk Services
	EMD Millipore Preclinical / Clinical Development Services
	EMD Millipore Immunoassay Services
	EMD Millipore Target Screening & Profiling Services

	Browse Antibodies		Browse Cell Culture Products
	Browse ELISAs		Browse Flow Cytometry Kits
	Browse Primer Pairs		Browse Kinase Activity Assays/Reagents
	Browse ELISpot Kits/Development Modules		Browse TFB/Immunoprecipitation Assays
	Browse Apoptosis Detection Kits/Reagents		Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents
	Browse DNA Damage/Repair Kits/Reagents		Browse Multiplex/Array Assay Kits/Reagents
	Browse Cell Selection/Detection Kits/Reagents		Browse Secondary Antibodies/Controls/Staining Reagents
	Browse Protease Activity Assays and Reagents		Browse Recombinant/Natural Proteins
	Browse Stem Cell Products		Browse Tocris Biochemicals & Compounds
	Browse cDNA Clones		Browse Proteome Profiler Antibody Arrays

	Browse OriGene Antibodies		OriGene RNAi products in human, mouse, rat for RPS6KC1
	OriGene qPCR primer pairs and template standards for RPS6KC1		OriGene Protein Over-expression Lysate for RPS6KC1
	OriGene MassSpec something-or-other for RPS6KC1		OriGene clones in human, mouse for RPS6KC1
	OriGene qSTAR qPCR primer pairs in human, mouse for RPS6KC1		OriGene Purified Protein for RPS6KC1
	OriGene ORF clones in mouse, rat for RPS6KC1		OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
	OriGene Custom Antibody Services for RPS6KC1		OriGene Custom Protein Services for RPS6KC1

	QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat RPS6KC1
	QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing RPS6KC1
	QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat RPS6KC1
	QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat RPS6KC1
	QIAGEN QuantiFast Probe-based Assays in human, mouse, rat RPS6KC1
	QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat RPS6KC1

	GenScript Custom Purified and Recombinant Proteins Services for RPS6KC1		GenScript cDNA clones with any tag delivered in your preferred vector for RPS6KC1
	GenScript Custom Assay Services for RPS6KC1		GenScript Custom Superior Antibodies Services for RPS6KC1
	GenScript Custom overexpressing Cell Line Services for RPS6KC1		CloneReady with Over 120,000 Genes
	Gene Synthesis: Any Gene in Any Vector		Vector-based siRNA and miRNA, Ready for Transfection
	Gene Mutant Library, Variants up to 10^11		Plasmid Preparation
	Custom Peptide Services

Search for Antibodies & Assays

	Regulatory tfbs in RPS6KC1 promoter
	Search Chromatin IP Primers for RPS6KC1
	RT² qPCR Primer Assay in human, mouse, rat RPS6KC1
	GNC Network for RPS6KC1
	SABiosciences PCR Arrays including human, mouse, rat RPS6KC1

Search Tocris compounds for RPS6KC1 (KS6C1)

	Browse Sino Biological Proteins and Antibodies
	Browse Sino Biological Cell Lysates
	Browse Sino Biological cDNA Clones
	4000+ Proteins
	Search Sino Biological for antibodies, proteins & pathways
	Protein Production Services
	Transfection Reagents
	Protein A/G/L resins
	Isotyping reagents

Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

	Novus Tissue Slides
	RPS6KC1 antibodies
	RPS6KC1 proteins
	RPS6KC1 lysates

	Antibodies for RPS6KC1
	See all of Abcam's Antibodies, Kits and Proteins for RPS6KC1
	Custom Antibody / Protein Production Service
	Bulk Purchasing
	Advantages of Rabbit Monoclonal antibodies
	Abcam protocols and scientific support

Browse ProSpec Recombinant Proteins

	Proteins for RPS6KC1
	Antibodies for RPS6KC1
	ELISAs for RPS6KC1
	CLIAs for RPS6KC1

Search LifeMap BioReagents cell lines for RPS6KC1

	Gene Synthesis
	Protein Engineering
	Variant Library Synthesis
	Codon Optimization
	Protein Production and Purification

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for RPS6KC1

	SwitchGear 3'UTR luciferase reporter plasmids for RPS6KC1
	SwitchGear Promoter luciferase reporter plasmids for RPS6KC1

Search ThermoFisher Antibodies for RPS6KC1

Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat RPS6KC1

	inGenious Targeting Laboratory - Custom generated mouse model solutions for RPS6KC1
	inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for RPS6KC1

Customized:

	lentivirus for stable overexpression of RPS6KC1
	lentivirus expression plasmids for stable overexpression of RPS6KC1
	adenovirus for overexpression of RPS6KC1

LSBio Antibodies in human, mouse, rat for RPS6KC1

Customized transgenic rodents for:

	Humanization
	Biomarker expression
	Off-target effect monitoring
	Translational medicine
	Tissue-specific gene expresssion
	Time-controlled gene expresssion

GeneCards Homepage - Last full update: 23 Oct 2013 - Incrementals: 4 Nov 2013 , 7 Nov 2013 , 23 Jan 2014

View Random Gene

Category			TGFB1 (GIFtS: 73) transforming growth factor, beta 1
GIFtS Group

The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

The GeneCards Human Gene Database

Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

Hot genes Disease genes RPS6KC1 gene at Home site.

hostname: 356980-web2.xennexinc.com index build: 106 solr: 1.4

Advanced Search

Export list of displayed genes

RPS6KC1 Gene

Ribosomal Protein S6 Kinase, 52kDa, Polypeptide 1

Aliases
for RPS6KC1 gene

Summaries
for RPS6KC1 gene

Genomic Views
for RPS6KC1 gene

Proteins
for RPS6KC1 gene

Protein Domains /
Families
for RPS6KC1 gene

Function
for RPS6KC1 gene

Pathways & Interactions
for RPS6KC1 gene

Drugs & Compounds
for RPS6KC1 gene

Transcripts
for RPS6KC1 gene

Expression
for RPS6KC1 gene

Orthologs
for RPS6KC1 gene

Paralogs
for RPS6KC1 gene

Genomic Variants
for RPS6KC1 gene

Disorders / Diseases
for RPS6KC1 gene

Publications
for RPS6KC1 gene

External Searches for RPS6KC1 gene

Genome Databases showing RPS6KC1 gene

Other Databases showing RPS6KC1 gene

Specialized Databases showing RPS6KC1 gene

Intellectual Property
for RPS6KC1 gene

Products
for RPS6KC1 gene

View Random Gene

Advanced Search

Export list of displayed genes

RPS6KC1 Gene

Ribosomal Protein S6 Kinase, 52kDa, Polypeptide 1

Aliasesfor RPS6KC1 gene

Summariesfor RPS6KC1 gene

Genomic Viewsfor RPS6KC1 gene

Proteinsfor RPS6KC1 gene

Protein Domains /Familiesfor RPS6KC1 gene

Functionfor RPS6KC1 gene

Pathways & Interactionsfor RPS6KC1 gene

Drugs & Compoundsfor RPS6KC1 gene

Transcriptsfor RPS6KC1 gene

Expression for RPS6KC1 gene

Orthologsfor RPS6KC1 gene

Paralogsfor RPS6KC1 gene

Genomic Variantsfor RPS6KC1 gene

Disorders / Diseasesfor RPS6KC1 gene

Publicationsfor RPS6KC1 gene

External Searches for RPS6KC1 gene

Genome Databases showing RPS6KC1 gene

Other Databases showing RPS6KC1 gene

Specialized Databases showing RPS6KC1 gene

Intellectual Propertyfor RPS6KC1 gene

Productsfor RPS6KC1 gene

View Random Gene

Aliases
for RPS6KC1 gene

Summaries
for RPS6KC1 gene

Genomic Views
for RPS6KC1 gene

Proteins
for RPS6KC1 gene

Protein Domains /
Families
for RPS6KC1 gene

Function
for RPS6KC1 gene

Pathways & Interactions
for RPS6KC1 gene

Drugs & Compounds
for RPS6KC1 gene

Transcripts
for RPS6KC1 gene

Expression
for RPS6KC1 gene

Orthologs
for RPS6KC1 gene

Paralogs
for RPS6KC1 gene

Genomic Variants
for RPS6KC1 gene

Disorders / Diseases
for RPS6KC1 gene

Publications
for RPS6KC1 gene

Intellectual Property
for RPS6KC1 gene

Products
for RPS6KC1 gene