Free for academic non-profit institutions. Other users need a Commercial license

Aliases for RPS6KA2-AS1 Gene

Subcategory (RNA class) for RPS6KA2-AS1 Gene

non-coding RNA

Quality Score for this RNA gene is


Aliases for RPS6KA2-AS1 Gene

  • RPS6KA2 Antisense RNA 1 2 3 5
  • RPS6KA2 Antisense RNA 1 (Non-Protein Coding) 2

External Ids for RPS6KA2-AS1 Gene

Previous GeneCards Identifiers for RPS6KA2-AS1 Gene

  • GC06P167318

Summaries for RPS6KA2-AS1 Gene

GeneCards Summary for RPS6KA2-AS1 Gene

RPS6KA2-AS1 (RPS6KA2 Antisense RNA 1) is an RNA Gene, and is affiliated with the non-coding RNA class.

No data available for Entrez Gene Summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for RPS6KA2-AS1 Gene

Genomics for RPS6KA2-AS1 Gene

Regulatory Elements for RPS6KA2-AS1 Gene

Enhancers for RPS6KA2-AS1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH06F166872 0.2 ENCODE 12.7 -30.9 -30906 1.0 ELF3 MLX ARID4B DMAP1 RAD21 ZNF48 RARA SLC30A9 THAP11 MIXL1 RPS6KA2 RPS6KA2-AS1 ENSG00000249141 RNASET2 FGFR1OP LOC105378120 GC06P166871 GC06M166883
GH06F166862 0.7 ENCODE 12 -41.0 -40995 0.9 CTCF ZNF146 RAD21 GLIS2 POLR2A PATZ1 ZNF600 ZBTB20 EZH2 MAZ RPS6KA2 RPS6KA2-AS1 FGFR1OP LOC105378120 GPR31 GC06P166871 LOC645468
GH06F166829 1.1 Ensembl ENCODE 11 -73.0 -72982 2.0 DRAP1 THRB RELA CBX5 POLR2A EGR1 GATA2 EED ETV6 CREM ENSG00000249141 RNASET2 RPS6KA2-AS1 RPS6KA2 CCR6 GC06P166871 LOC645468
GH06F166988 1.1 Ensembl ENCODE 10.7 +85.2 85230 0.9 GATA3 MAX PRDM10 RNASET2 ENSG00000249141 RPS6KA2 RPS6KA2-AS1 CCR6 PIR40836
GH06F167150 1.3 FANTOM5 Ensembl ENCODE 10 +248.8 248842 3.4 ELF3 TBP PKNOX1 TBL1XR1 SIN3A RAD21 EGR1 ELK1 CBX5 ETV6 GPR31 RNASET2 CCR6 FGFR1OP LOC105378120 ENSG00000249141 UNC93A RPS6KA2 RPS6KA2-AS1 AFDN
- Elite enhancer/Elite enhancer-gene association Download Table
Download GeneHancer data dump

Enhancers around RPS6KA2-AS1 on UCSC Golden Path with GeneCards custom track

Genomic Location for RPS6KA2-AS1 Gene

166,903,698 bp from pter
166,905,069 bp from pter
1,372 bases
Plus strand

Genomic View for RPS6KA2-AS1 Gene

Genes around RPS6KA2-AS1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
RPS6KA2-AS1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for RPS6KA2-AS1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for RPS6KA2-AS1 Gene

Proteins for RPS6KA2-AS1 Gene

Post-translational modifications for RPS6KA2-AS1 Gene

No Post-translational modifications

No data available for DME Specific Peptides for RPS6KA2-AS1 Gene

Domains & Families for RPS6KA2-AS1 Gene

Gene Families for RPS6KA2-AS1 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with RPS6KA2-AS1: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for RPS6KA2-AS1 Gene

Function for RPS6KA2-AS1 Gene

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for RPS6KA2-AS1 Gene

Localization for RPS6KA2-AS1 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for RPS6KA2-AS1 Gene

Pathways & Interactions for RPS6KA2-AS1 Gene

SuperPathways for RPS6KA2-AS1 Gene

No Data Available

Interacting Proteins for RPS6KA2-AS1 Gene

Gene Ontology (GO) - Biological Process for RPS6KA2-AS1 Gene


No data available for Pathways by source and SIGNOR curated interactions for RPS6KA2-AS1 Gene

Transcripts for RPS6KA2-AS1 Gene

mRNA/cDNA for RPS6KA2-AS1 Gene

(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Alternative Splicing Database (ASD) splice patterns (SP) for RPS6KA2-AS1 Gene

No ASD Table

Relevant External Links for RPS6KA2-AS1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for RPS6KA2-AS1 Gene

mRNA expression in normal human tissues for RPS6KA2-AS1 Gene

mRNA differential expression in normal tissues according to GTEx for RPS6KA2-AS1 Gene

This gene is overexpressed in Testis (x44.6).
genes like me logo Genes that share expression patterns with RPS6KA2-AS1: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners and mRNA Expression by UniProt/SwissProt for RPS6KA2-AS1 Gene

Orthologs for RPS6KA2-AS1 Gene

Evolution for RPS6KA2-AS1 Gene

Gene Tree for RPS6KA2-AS1 (if available)
Gene Tree for RPS6KA2-AS1 (if available)

No data available for Orthologs for RPS6KA2-AS1 Gene

Paralogs for RPS6KA2-AS1 Gene

No data available for Paralogs for RPS6KA2-AS1 Gene

Variants for RPS6KA2-AS1 Gene

Sequence variations from dbSNP and Humsavar for RPS6KA2-AS1 Gene

SNP ID Clin Chr 06 pos Sequence Context AA Info Type
rs111387365 -- 166,904,484(+) GGATT(C/T)CCACT nc-transcript-variant
rs111740444 -- 166,903,768(+) AGGAC(A/G)GTGTG nc-transcript-variant
rs112444503 -- 166,902,347(+) GGGGA(-/GAGAACGCCACGTGAACACATGGG)GAGAA upstream-variant-2KB
rs112938014 -- 166,904,831(+) CATGC(A/G)GCCGC nc-transcript-variant
rs113182042 -- 166,904,196(+) AACCC(A/G)GCTCC intron-variant

Structural Variations from Database of Genomic Variants (DGV) for RPS6KA2-AS1 Gene

Variant ID Type Subtype PubMed ID
dgv11053n54 CNV loss 21841781
nsv605260 CNV gain 21841781
nsv605333 CNV loss 21841781
nsv823929 CNV gain 20364138
nsv949891 CNV deletion 24416366

Relevant External Links for RPS6KA2-AS1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for RPS6KA2-AS1 Gene

Disorders for RPS6KA2-AS1 Gene

Relevant External Links for RPS6KA2-AS1

Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for RPS6KA2-AS1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for RPS6KA2-AS1 Gene

Publications for RPS6KA2-AS1 Gene

  1. In silico prediction and experimental validation of natural antisense transcripts in two cancer-associated regions of human chromosome 6. (PMID: 19287968) Monti L. … Acquati F. (Int. J. Oncol. 2009) 2 3 64

Products for RPS6KA2-AS1 Gene

Sources for RPS6KA2-AS1 Gene

Loading form....