Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

RPN2 Gene

protein-coding   GIFtS: 66
GCID: GC20P035806

Ribophorin II

Alzheimer's & Parkinson's Diseases Congress
  See related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

Aliases
Ribophorin II1 2 3     SWP12
Oligosaccharyltransferase Complex Subunit (Non-Catalytic)1 2     Dolichyl-Diphosphooligosaccharide--Protein Glycosyltransferase Subunit 22
Dolichyl-Diphosphooligosaccharide--Protein Glycosyltransferase 63 KDa
Subunit2 3
     ribophorin-22
RIBIIR2 3     EC 2.4.99.183
RPN-II2 3     Ribophorin-23
RPNII2     EC 2.4.1.1198

External Ids:    HGNC: 103821   Entrez Gene: 61852   Ensembl: ENSG000001187057   OMIM: 1804905   UniProtKB: P048443   

Export aliases for RPN2 gene to outside databases

Previous GC identifers: GC20P035535 GC20P036445 GC20P036492 GC20P035240 GC20P032542


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for RPN2 Gene:
This gene encodes a type I integral membrane protein found only in the rough endoplasmic reticulum. The encoded
protein is part of an N-oligosaccharyl transferase complex that links high mannose oligosaccharides to asparagine
residues found in the Asn-X-Ser/Thr consensus motif of nascent polypeptide chains. This protein is similar in
sequence to the yeast oligosaccharyl transferase subunit SWP1. Alternatively spliced transcript variants encoding
different isoforms have been found for this gene. (provided by RefSeq, Oct 2008)

GeneCards Summary for RPN2 Gene: 
RPN2 (ribophorin II) is a protein-coding gene. Diseases associated with RPN2 include microsporidiosis, and congenital dyserythropoietic anemia, and among its related super-pathways are WNT ligand biogenesis and trafficking and Viral mRNA Translation. GO annotations related to this gene include ribosome binding and dolichyl-diphosphooligosaccharide-protein glycotransferase activity.

UniProtKB/Swiss-Prot: RPN2_HUMAN, P04844
Function: Essential subunit of the N-oligosaccharyl transferase (OST) complex which catalyzes the transfer of a
high mannose oligosaccharide from a lipid-linked oligosaccharide donor to an asparagine residue within an
Asn-X-Ser/Thr consensus motif in nascent polypeptide chains

Gene Wiki entry for RPN2 Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 73), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000020.10  NT_011362.10  NC_018931.2  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the RPN2 gene promoter:
         c-Fos   AP-1   AP-2gamma   E47   CREB   Hand1   AP-2beta   c-Jun   AP-2alpha   AP-2alphaA   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidRPN2 promoter sequence
   Search SABiosciences Chromatin IP Primers for RPN2

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat RPN2


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 20q12-q13.1   Ensembl cytogenetic band:  20q11.23   HGNC cytogenetic band: 20q12-q13.1

RPN2 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
RPN2 gene location

GeneLoc information about chromosome 20         GeneLoc Exon Structure

GeneLoc location for GC20P035806:  view genomic region     (about GC identifiers)

Start:
35,806,813 bp from pter      End:
35,870,026 bp from pter
Size:
63,214 bases      Orientation:
plus strand

(According to UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MAXQB RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Ontologies according to Gene Ontology Consortium 01 Oct 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

UniProtKB/Swiss-Prot: RPN2_HUMAN, P04844 (See protein sequence)
Recommended Name: Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit 2 precursor  
Size: 631 amino acids; 69284 Da
Subunit: Component of the oligosaccharyltransferase (OST) complex. OST seems to exist in different forms which
contain at least RPN1, RPN2, OST48, DAD1, OSTC, KRTCAP2 and either STT3A or STT3B. OST can form stable complexes
with the Sec61 complex or with both the Sec61 and TRAP complexes (By similarity)
Subcellular location: Endoplasmic reticulum membrane; Multi-pass membrane protein (By similarity)
Secondary accessions: Q5JYR6 Q6IBA5 Q96E21 Q9BUQ3 Q9UBE1
Alternative splicing: 2 isoforms:  P04844-1   P04844-2   (No experimental confirmation available)

Explore the universe of human proteins at neXtProt for RPN2: NX_P04844

Explore proteomics data for RPN2 at MOPED 

Post-translational modifications:

  • View modification sites using PhosphoSitePlus
  • View neXtProt modification sites for NX_P04844

  • 4/12 DME Specific Peptides for RPN2 (P04844) (see all 12)
     VKLEHAKS  KQEIQHLFR  LLLAAVSEDS  VTFLAGNRMLAQ 

    RPN2 Protein expression data from MOPED1, PaxDb2 and MAXQB3 :    About this image 

    RPN2 Protein Expression
    REFSEQ proteins (2 alternative transcripts): 
    NP_001129243.1  NP_002942.2  

    ENSEMBL proteins: 
     ENSP00000399137   ENSP00000237530   ENSP00000362724   ENSP00000362735   ENSP00000435563  
     ENSP00000409580   ENSP00000399404  
    Reactome Protein details: P04844
    Human Recombinant Protein Products for RPN2: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein for RPN2
    OriGene Protein Over-expression Lysate for RPN2
    OriGene MassSpec for RPN2 
    OriGene Custom Protein Services for RPN2
    GenScript Custom Purified and Recombinant Proteins Services for RPN2
    Novus Biologicals RPN2 Proteins
    Novus Biologicals RPN2 Lysates
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates 
    ProSpec Recombinant Protein for RPN2
    Cloud-Clone Corp. Proteins for RPN2 

    Gene Ontology (GO): 5/7 cellular component terms (GO ID links to tree view) (see all 7):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000421autophagic vacuole membrane IEA--
    GO:0005634nucleus IDA--
    GO:0005783endoplasmic reticulum IDA--
    GO:0005789endoplasmic reticulum membrane TAS--
    GO:0005791rough endoplasmic reticulum IEA--

    RPN2 for ontologies           About GeneDecksing



    RPN2 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    OriGene Antibodies for RPN2
    OriGene Custom Antibody Services for RPN2
    GenScript Custom Superior Antibodies Services for RPN2
    Novus Biologicals RPN2 Antibodies
    Abcam antibodies for RPN2
    Cloud-Clone Corp. Antibodies for RPN2 
    ThermoFisher Antibodies for RPN2
    LSBio Antibodies in human, mouse, rat for RPN2 

    Assay Products for RPN2: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for RPN2
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for RPN2
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for RPN2 
    Cloud-Clone Corp. CLIAs for RPN2


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section
    1 InterPro protein domain:
     IPR008814 Ribophorin_II

    Graphical View of Domain Structure for InterPro Entry P04844

    ProtoNet protein and cluster: P04844

    UniProtKB/Swiss-Prot: RPN2_HUMAN, P04844
    Similarity: Belongs to the SWP1 family


    RPN2 for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, Vector BioLabs, and Sirion Biotech, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene.)
    About This Section

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: RPN2_HUMAN, P04844
    Function: Essential subunit of the N-oligosaccharyl transferase (OST) complex which catalyzes the transfer of a
    high mannose oligosaccharide from a lipid-linked oligosaccharide donor to an asparagine residue within an
    Asn-X-Ser/Thr consensus motif in nascent polypeptide chains
    Catalytic activity: Dolichyl diphosphooligosaccharide + [protein]-L-asparagine = dolichyl diphosphate + a
    glycoprotein with the oligosaccharide chain attached by N-beta-D-glycosyl linkage to a protein L-asparagine

         Genatlas biochemistry entry for RPN2:
    ribophorin II,69.5kDa,component with RPN1 and DDOST of N-oligosacccharyl transferase

         Enzyme Numbers (IUBMB): EC 2.4.1.1192 EC 2.4.99.181

         Gene Ontology (GO): 2 molecular function terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0004579contributes to dolichyl-diphosphooligosaccharide-protein glycotransferase activity NAS15835887
    GO:0043022ribosome binding IEA--
         
    RPN2 for ontologies           About GeneDecksing


    Phenotypes:
         1 GenomeRNAi human phenotype for RPN2:
     Increased G2M DNA content 

         1 MGI mutant phenotype (inferred from 1 allele(MGI details for Rpn2):
     mortality/aging 

    RPN2 for phenotypes           About GeneDecksing

    Animal Models:
       inGenious Targeting Laboratory - Custom generated mouse model solutions for RPN2 
       inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for RPN2

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for RPN2 
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for RPN2 

    miRNA
    Products:
        
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat RPN2
    5 QIAGEN miScript miRNA Assays for microRNAs that regulate RPN2:
    hsa-miR-513a-5p hsa-miR-27a hsa-miR-27b hsa-miR-1299 hsa-miR-1305
    SwitchGear 3'UTR luciferase reporter plasmidRPN2 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for RPN2
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat RPN2

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for RPN2
    Sirion Biotech Customized adenovirus for overexpression of RPN2

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene clones in human, mouse for RPN2 (see all 14)
    OriGene ORF clones in mouse, rat for RPN2
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): RPN2 (NM_002951)
    Sino Biological Human cDNA Clone for RPN2
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for RPN2
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat RPN2
    Sirion Biotech Customized lentivirus for stable overexpression of RPN2 
                         Customized lentivirus expression plasmids for stable overexpression of RPN2 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for RPN2
    Search LifeMap BioReagents cell lines for RPN2
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for RPN2


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene).
    About This Section

    SuperPaths for RPN2 About   (see all 8)                                                                                              See pathways by source

    SuperPathContained pathways About
    1Asparagine N-linked glycosylation
    Asparagine N-linked glycosylation0.77
    N-Glycan biosynthesis0.52
    WNT ligand biogenesis and trafficking0.77
    Post-translational protein modification0.44
    Signaling by Wnt0.62
    Metabolism of proteins0.35
    2Viral mRNA Translation
    Translation0.78
    SRP-dependent cotranslational protein targeting to membrane0.77
    3CDK-mediated phosphorylation and removal of Cdc6
    Proteasome Degradation0.57
    4Signaling by GPCR
    Signal Transduction0.55
    5Generic Transcription Pathway
    Gene Expression0.47

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways


    1 GeneGo (Thomson Reuters) Pathway for RPN2
        CFTR folding and maturation (norm and CF)

    1 BioSystems Pathway for RPN2
        Proteasome Degradation


    5/9        Reactome Pathways for RPN2 (see all 9)
        Signaling by Wnt
    Translation
    Signal Transduction
    Asparagine N-linked glycosylation
    SRP-dependent cotranslational protein targeting to membrane


    3         Kegg Pathways  (Kegg details for RPN2):
        N-Glycan biosynthesis
    Metabolic pathways
    Protein processing in endoplasmic reticulum

    UniProtKB/Swiss-Prot: RPN2_HUMAN, P04844
    Pathway: Protein modification; protein glycosylation


    RPN2 for pathways           About GeneDecksing

    Interactions:

        SABiosciences Gene Network CentralTM Interacting Genes and Proteins Network for RPN2

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    5/147 Interacting proteins for RPN2 (P048442, 3 ENSP000002375304) via UniProtKB, MINT, STRING, and/or I2D (see all 147)

    InteractantInteraction Details
    GeneCardExternal ID(s)
    RBBP4Q090282, 3, ENSP000003625924MINT-8269098 I2D: score=2 STRING: ENSP00000362592
    FBN3Q75N902, 3MINT-8269076 I2D: score=2 
    NGFRP081382, 3MINT-8269087 I2D: score=2 
    CLN3Q132863, ENSP000003530734I2D: score=3 STRING: ENSP00000353073
    MYCP011063, ENSP000003672074I2D: score=3 STRING: ENSP00000367207
    About this table

    Gene Ontology (GO): 5/10 biological process terms (GO ID links to tree view) (see all 10):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006412translation TAS--
    GO:0006464cellular protein modification process TAS10660554
    GO:0006487protein N-linked glycosylation ----
    GO:0006614SRP-dependent cotranslational protein targeting to membrane TAS--
    GO:0007568aging IEA--

    RPN2 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section
    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for RPN2

    2 HMDB Compounds for RPN2    About this table
    CompoundSynonyms CAS #PubMed Ids
    Dolichyl diphosphateDolichyl diphosphate (see all 2)37247-98-6--
    L-Asparagine(-)-Asparagine (see all 32)70-47-3--

    Search CenterWatch for drugs/clinical trials and news about RPN2

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Sirion Biotech, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for RPN2 gene (2 alternative transcripts): 
    NM_001135771.1  NM_002951.3  

    Unigene Cluster for RPN2:

    Ribophorin II
    Hs.370895  [show with all ESTs]
    Unigene Representative Sequence: NM_002951
    8 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000456102 ENST00000237530(uc010gfw.2 uc021wdb.1 uc002xgq.3 uc002xgp.3)
    ENST00000373622 ENST00000373632 ENST00000462163 ENST00000437329 ENST00000456400
    ENST00000470352

    miRNA
    Products:
         
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat RPN2
    5 QIAGEN miScript miRNA Assays for microRNAs that regulate RPN2:
    hsa-miR-513a-5p hsa-miR-27a hsa-miR-27b hsa-miR-1299 hsa-miR-1305
    SwitchGear 3'UTR luciferase reporter plasmidRPN2 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for RPN2
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat RPN2
    Clone
    Products:
         
    OriGene clones in human, mouse for RPN2 (see all 14)
    OriGene ORF clones in mouse, rat for RPN2
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): RPN2 (NM_002951)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for RPN2
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat RPN2
    Sirion Biotech Customized lentivirus for stable overexpression of RPN2 
                         Customized lentivirus expression plasmids for stable overexpression of RPN2 
    Primer
    Products:
        
    OriGene qPCR primer pairs and template standards for RPN2
    OriGene qSTAR qPCR primer pairs in human, mouse for RPN2
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat RPN2
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat RPN2
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat RPN2

    Additional mRNA sequence: 

    AK096243.1 AK296126.1 AK308683.1 AK315801.1 BC002380.2 BC003560.1 BC013028.2 BC020222.1 
    CR456899.1 Y00282.1 

    24/48 DOTS entries (see all 48):

    DT.40255773  DT.95209031  DT.100882457  DT.100771448  DT.100882482  DT.120815062  DT.100882504  DT.100882501 
    DT.95375184  DT.100031922  DT.100882472  DT.100032268  DT.100656594  DT.120814919  DT.120814949  DT.100000204 
    DT.100882461  DT.100882464  DT.100882492  DT.100882499  DT.100882463  DT.100882477  DT.120814914  DT.87017718 

    24/1087 AceView cDNA sequences (see all 1087):

    BU192449 BG030448 BG676225 BQ687181 BM853806 BU168050 BM851824 AA099418 
    BI224357 CF125603 BQ892956 CR619834 AL514246 BQ685925 CD358303 BQ682155 
    BU859393 BE909280 AW850075 BP352644 BQ689264 AA312746 AI133631 BE795250 

    GeneLoc Exon Structure

    5/12 Alternative Splicing Database (ASD) splice patterns (SP) for RPN2 (see all 12)    About this scheme

    ExUns: 1 ^ 2a · 2b · 2c ^ 3 ^ 4 ^ 5a · 5b ^ 6 ^ 7 ^ 8 ^ 9 ^ 10a · 10b ^ 11a · 11b · 11c ^ 12 ^ 13 ^ 14a · 14b ^ 15 ^ 16a · 16b ^ 17a · 17b ·
    SP1:                                            -     -           -                                               -                             -     -     -   
    SP2:        -     -     -           -     -     -     -           -                                                                                             
    SP3:                                -           -     -           -                                                                                             
    SP4:                                            -                                                                                                               
    SP5:                                      -     -     -           -                                                                                             

    ExUns: 17c ^ 18 ^ 19a · 19b ^ 20 ^ 21
    SP1:                                    
    SP2:                                    
    SP3:                                    
    SP4:                                    
    SP5:                                    


    ECgene alternative splicing isoforms for RPN2

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    RPN2 expression in normal human tissues (normalized intensities)      RPN2 embryonic expression: see
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: TTCCAGACCT
    RPN2 Expression
    About this image


    RPN2 expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database 
     5/41 selected tissues (see all 41) fully expand
     
     Brain (Nervous System)    fully expand to see all 13 entries
             Thalamus
             brain/forebrain/telencephalon   
     
     Testis (Reproductive System)    fully expand to see all 4 entries
             Leydig Cells Testis Interstitium
             seminal vesicle ; glandular cells   
     
     Colon (Gastrointestinal Tract)    fully expand to see all 4 entries
             colon ; endothelial cells   
     
     Epithelium
             esophagus ; squamous epithelial cells   
     
     Uterus (Reproductive System)    fully expand to see all 4 entries
             uterus, post-menopause ; glandular cells   

    See RPN2 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for RPN2

    SOURCE GeneReport for Unigene cluster: Hs.370895

    UniProtKB/Swiss-Prot: RPN2_HUMAN, P04844
    Tissue specificity: Expressed in all tissues tested

        SABiosciences Custom PCR Arrays for RPN2
    Primer
    Products:
    OriGene qPCR primer pairs and template standards for RPN2
    OriGene qSTAR qPCR primer pairs in human, mouse for RPN2
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat RPN2
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat RPN2
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat RPN2
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for RPN2

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of eukaryotes.

    Orthologs for RPN2 gene from 9/18 species (see all 18)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Rpn21 , 5 ribophorin II1, 5 88.38(n)1
    92.39(a)1
      2 (78.20 cM)5
    200141  NM_019642.41  NP_062616.21 
     1572790175 
    chicken
    (Gallus gallus)
    Aves RPN21 ribophorin II 75.83(n)
    78.22(a)
      419177  NM_001006288.1  NP_001006288.1 
    lizard
    (Anolis carolinensis)
    Reptilia RPN26
    ribophorin II
    80(a)
    1 ↔ 1
    GL343291.1(1336709-1377304)
    African clawed frog
    (Xenopus laevis)
    Amphibia MGC537642 similar to ribophorin II 72.68(n)    BC046727.1 
    zebrafish
    (Danio rerio)
    Actinopterygii Dr.42172 Danio rerio mRNA similar to ribophorin II (cDNA clone more 73.32(n)    BC046052.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta CG63701 , 3
    dolichyl-diphospho-oligosaccharide-protein
    more3
    CG63701
    33(a)3
    45.73(n)1
    35.21(a)1
      54E83
    370291  NM_137421.21  NP_611265.11 
    worm
    (Caenorhabditis elegans)
    Secernentea M01A10.33
    ostd-11
    Protein OSTD-11 36(a)3
    46.85(n)1
    36.95(a)1
      I(5549121-5550252)3
    1722081  NM_059223.51  NP_491624.11 
    thale cress
    (Arabidopsis thaliana)
    eudicotyledons HAP61 ribophorin II (RPN2) family protein 39.92(n)
    25.33(a)
      827863  NM_001203856.1  NP_001190785.1 
    rice
    (Oryza sativa)
    Liliopsida Os01g09112001 hypothetical protein 42.25(n)
    27.23(a)
      4324876  NM_001051694.1  NP_001045159.1 


    ENSEMBL Gene Tree for RPN2 (if available)
    TreeFam Gene Tree for RPN2 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
      --

    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/1355 SNPs in RPN2 are shown (see all 1355)    About this table     
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 20 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs114672141,2
    C--35807790(+) CGTGG-/CTTACAGACAGGGCCCCGCGGCCGGCAC
    T
    /CTTATAGACAGGGCCCCGCGGCCGGCACT
    CTTTG
    2 -- int10--------
    rs744179471,2
    C,F--35810114(+) ACTGCG/ACCTGG 2 -- int11Minor allele frequency- A:0.03NA 120
    rs1830706931,2
    --35810158(+) CACCAA/GATATC 2 -- int10--------
    rs1142382851,2
    C,F--35810172(+) ATGACT/CTGCTT 2 -- int11Minor allele frequency- C:0.06WA 118
    rs1478840521,2
    C--35810285(+) TTCCAC/TAGCAC 2 -- int10--------
    rs2017534361,2
    --35810313(+) AATAA-/TGTTGTTA 2 -- cds10--------
    rs755056251,2
    --35810315(+) ATAATG/CTTATT 2 -- int11Minor allele frequency- C:0.50CSA 2
    rs342569841,2
    C--35810316(+) AATGT-/CTT/  
     TCC
    /TTC
    TATTT
    6 -- cds10--------
    rs588393841,2
    C--35810317(+) ATGTTCTT/-ATTTC 2 -- cds11Minor allele frequency- -:0.00NA 2
    rs42397001,2
    C,F,A,H--35810346(+) ctagaA/Ctagaa 2 -- int114Minor allele frequency- C:0.44NS EA NA WA 798

    HapMap Linkage Disequilibrium report for RPN2 (35806813 - 35870026 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 8 variations for RPN2:    About this table     
    Variant IDTypeSubtypePubMed ID
    esv2722385CNV Deletion23290073
    esv2516589CNV Deletion19546169
    esv1174249CNV Deletion17803354
    esv2663037CNV Deletion23128226
    esv4013CNV Deletion18987735
    esv2082246CNV Deletion18987734
    esv8416CNV Loss19470904
    nsv519722CNV Loss19592680


    Human Gene Mutation Database (HGMD): RPN2
    SABiosciences Cancer Mutation PCR Assays
    SeqTarget long-range PCR primers for resequencing RPN2
    DNA2.0 Custom Variant and Variant Library Synthesis for RPN2

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section
    OMIM gene information: 180490    OMIM disorders: --

    13 diseases for RPN2:    About MalaCards
    microsporidiosis    congenital dyserythropoietic anemia    hermansky-pudlak syndrome    insulinoma
    anemia    diabetes mellitus    gastric cancer    alzheimer's disease
    colorectal cancer    hepatocellular carcinoma    prostate cancer    prostatitis
    breast cancer


    RPN2 for disorders           About GeneDecksing


    Congresses - knowledge worth sharing:  
    Alzheimer's & Parkinson's Diseases Congress (ADPD) 18 - 22 March 2015

    1 Novoseek inferred disease relationship for RPN2 gene    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    tumors 0 1 18724378 (1)

    Genetic Association Database (GAD): RPN2
    Human Genome Epidemiology (HuGE) Navigator: RPN2 (4 documents)

    Export disorders for RPN2 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for RPN2 gene, integrated from 9 sources (see all 73):
    (articles sorted by number of sources associating them with RPN2)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PubMed id 20379614)1, 4 Rose J.E....Uhl G.R. (2010)
    2. Hippocampal atrophy as a quantitative trait in a geno me-wide association study identifying novel susceptibility genes for Alzheimer' s disease. (PubMed id 19668339)1, 4 Potkin S.G....Macciardi F. (2009)
    3. Quantitative analysis of global ubiquitination in HeLa cells by mass spectrometry. (PubMed id 18781797)1, 2 Meierhofer D.... Kaiser P. (2008)
    4. Proteomic analysis of mammalian oligosaccharyltransferase reveals multiple subcomplexes that contain Sec61, TRAP, and two potential new subunits. (PubMed id 15835887)1, 2 Shibatani T.... Skach W.R. (2005)
    5. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)1, 2 Ota T.... Sugano S. (2004)
    6. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S....Malek J. (2004)
    7. Oligosaccharyltransferase isoforms that contain different catalytic STT3 subunits have distinct enzymatic properties. (PubMed id 12887896)1, 2 Kelleher D.J.... Gilmore R. (2003)
    8. Exploring proteomes and analyzing protein processing by mass spectrometric identification of sorted N-terminal peptides. (PubMed id 12665801)1, 2 Gevaert K.... Vandekerckhove J. (2003)
    9. The DNA sequence and comparative analysis of human chromosome 20. (PubMed id 11780052)1, 2 Deloukas P....Rogers J. (2001)
    10. Human ribophorins I and II: the primary structure and membrane topology of two highly conserved rough endoplasmic reticulum-specific glycoproteins. (PubMed id 3034581)1, 2 Crimaudo C.... Meyer D.I. (1987)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Disorders
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 6185 HGNC: 10382 AceView: RPN2 Ensembl:ENSG00000118705 euGenes: HUgn6185
    ECgene: RPN2 Kegg: 6185 H-InvDB: RPN2

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for RPN2 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for RPN2 gene:
    Search GeneIP for patents involving RPN2

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Sirion Biotech, Cell lines from GenScript, and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Protease Activity Assays and Reagents   Browse Recombinant/Natural Proteins  
     Browse Stem Cell Products   Browse Tocris Biochemicals & Compounds  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     OriGene Antibodies for RPN2   OriGene RNAi products in human, mouse, rat for RPN2  
     OriGene qPCR primer pairs and template standards for RPN2   OriGene Protein Over-expression Lysate for RPN2  
     OriGene MassSpec something-or-other for RPN2   OriGene clones in human, mouse for RPN2  
     OriGene qSTAR qPCR primer pairs in human, mouse for RPN2   OriGene Purified Protein for RPN2  
     OriGene ORF clones in mouse, rat for RPN2   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for RPN2   OriGene Custom Protein Services for RPN2  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat RPN2
     QIAGEN SeqTarget long-range PCR primers for resequencing RPN2
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat RPN2
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat RPN2
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat RPN2
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat RPN2
     GenScript Custom Purified and Recombinant Proteins Services for RPN2 GenScript cDNA clones with any tag delivered in your preferred vector for RPN2
     GenScript Custom Assay Services for RPN2 GenScript Custom Superior Antibodies Services for RPN2
     GenScript Custom overexpressing Cell Line Services for RPN2 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in RPN2 promoter
     Search Chromatin IP Primers for RPN2
     RT2 qPCR Primer Assay in human, mouse, rat RPN2
     GNC Network for RPN2
     SABiosciences Custom PCR Arrays for RPN2
     Search Tocris compounds for RPN2
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological Cell Lysates
     cDNA Clones for RPN2
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     RPN2 antibodies
     RPN2 proteins
     RPN2 lysates
     Antibodies for RPN2
     See all of Abcam's Antibodies, Kits and Proteins for RPN2
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Recombinant Protein for RPN2




     Proteins for RPN2
     Antibodies for RPN2
     ELISAs for RPN2
     CLIAs for RPN2
     Search LifeMap BioReagents cell lines for RPN2
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for RPN2
     SwitchGear 3'UTR luciferase reporter plasmids for RPN2
     SwitchGear Promoter luciferase reporter plasmids for RPN2
     ThermoFisher Antibodies for RPN2
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat RPN2
     inGenious Targeting Laboratory - Custom generated mouse model solutions for RPN2
     inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for RPN2
    Customized:
     lentivirus for stable overexpression of RPN2
     lentivirus expression plasmids for stable overexpression of RPN2
     adenovirus for overexpression of RPN2
     LSBio Antibodies in human, mouse, rat for RPN2
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
           
    GeneCards Homepage - Last full update: 23 Oct 2013 - Incrementals: 4 Nov 2013 , 7 Nov 2013 , 23 Jan 2014

    View Random Gene

    Category
    (GIFtS: 73)
    transforming growth factor, beta 1
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      RPN2 gene at Home site.
    hostname: 356980-web2.xennexinc.com index build: 106 solr: 1.4