Free for academic non-profit institutions. Other users need a Commercial license

Aliases for RNU7-1 Gene

Subcategory (RNA class) for RNU7-1 Gene

snRNA

Quality Score for this RNA gene is

3

Aliases for RNU7-1 Gene

  • RNA, U7 Small Nuclear 1 2 3 5
  • RNA, Small Nuclear U7.1 2 3
  • RNA, Small Nuclear U7 2 3
  • RNA, U7 Small Nuclear 2
  • U7.1 3
  • RNU7 3

External Ids for RNU7-1 Gene

ORGUL Members for RNU7-1 Gene

Previous HGNC Symbols for RNU7-1 Gene

  • RNU7

Previous GeneCards Identifiers for RNU7-1 Gene

  • GC12P007054
  • GC12P007056
  • GC12P007058
  • GC12P007060
  • GC12P007063
  • GC12P007098
  • GC12P007104
  • GC12P007147
  • GC12P007041
  • GC12P007181
  • GC12P007228
  • GC12P007281
  • GC12P007327
  • GC12P007376
  • GC12P007422

Summaries for RNU7-1 Gene

GeneCards Summary for RNU7-1 Gene

RNU7-1 (RNA, U7 Small Nuclear 1) is an RNA Gene, and is affiliated with the snRNA class.

Additional gene information for RNU7-1 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for RNU7-1 Gene

Genomics for RNU7-1 Gene

GeneHancer (GH) Regulatory Elements for RNU7-1 Gene

Promoters and enhancers for RNU7-1 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH12I006880 Enhancer 0.7 ENCODE 11.1 -62.9 -62944 1.6 DRAP1 SAP130 ARID4B MAX CEBPG DMAP1 ZSCAN9 TEAD3 POLR2A FOSL2 SPSB2 CDCA3 USP5 GNB3 ATN1 C12orf57 RNU7-1 P3H3 GPR162 CD4
GH12I006885 Enhancer 0.4 ENCODE 11.4 -57.0 -56965 2.6 IKZF1 CEBPA SIN3A SPSB2 ENO2 ATN1 USP5 CDCA3 RNU7-1 C12orf57 EMG1 PHB2 SCARNA12
GH12I006940 Promoter/Enhancer 2.7 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 0.4 +9.8 9842 25.9 CLOCK MLX ZFP64 FEZF1 DMAP1 IRF4 YY1 SLC30A9 ZNF213 E2F8 PTPN6 C12orf57 ZNF384 ENSG00000219410 CHD4 ENSG00000247853 SPSB2 SCARNA12 ENSG00000256967 NCAPD2
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around RNU7-1 on UCSC Golden Path with GeneCards custom track

Genomic Locations for RNU7-1 Gene

Genomic Locations for RNU7-1 Gene
chr12:6,943,816-6,943,878
(GRCh38/hg38)
Size:
63 bases
Orientation:
Plus strand
chr12:7,052,979-7,053,041
(GRCh37/hg19)

Genomic View for RNU7-1 Gene

Genes around RNU7-1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
RNU7-1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for RNU7-1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for RNU7-1 Gene

Proteins for RNU7-1 Gene

Post-translational modifications for RNU7-1 Gene

No Post-translational modifications

No data available for DME Specific Peptides for RNU7-1 Gene

Domains & Families for RNU7-1 Gene

Gene Families for RNU7-1 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with RNU7-1: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for RNU7-1 Gene

Function for RNU7-1 Gene

Phenotypes From GWAS Catalog for RNU7-1 Gene

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for RNU7-1 Gene

Localization for RNU7-1 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for RNU7-1 Gene

Pathways & Interactions for RNU7-1 Gene

SuperPathways for RNU7-1 Gene

No Data Available

Interacting Proteins for RNU7-1 Gene

Gene Ontology (GO) - Biological Process for RNU7-1 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for RNU7-1 Gene

Drugs & Compounds for RNU7-1 Gene

No Compound Related Data Available

Transcripts for RNU7-1 Gene

mRNA/cDNA for RNU7-1 Gene

(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Alternative Splicing Database (ASD) splice patterns (SP) for RNU7-1 Gene

No ASD Table

Relevant External Links for RNU7-1 Gene

GeneLoc Exon Structure for
RNU7-1
ECgene alternative splicing isoforms for
RNU7-1

Expression for RNU7-1 Gene

No Expression Related Data Available

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for RNU7-1 Gene

Orthologs for RNU7-1 Gene

This gene was present in the common ancestor of chordates.

Orthologs for RNU7-1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia U7 34
  • 94 (a)
OneToOne
cow
(Bos Taurus)
Mammalia U7 34
  • 92 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia U7 34
  • 87 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Rnu7 34
  • 85 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia U7 34
  • 71 (a)
ManyToMany
chicken
(Gallus gallus)
Aves U7 34
  • 69 (a)
OneToMany
lizard
(Anolis carolinensis)
Reptilia U7 34
  • 80 (a)
ManyToMany
zebrafish
(Danio rerio)
Actinopterygii U7 34
  • 77 (a)
OneToMany
Species where no ortholog for RNU7-1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • dog (Canis familiaris)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for RNU7-1 Gene

ENSEMBL:
Gene Tree for RNU7-1 (if available)
TreeFam:
Gene Tree for RNU7-1 (if available)

Paralogs for RNU7-1 Gene

No data available for Paralogs for RNU7-1 Gene

Variants for RNU7-1 Gene

Sequence variations from dbSNP and Humsavar for RNU7-1 Gene

SNP ID Clin Chr 12 pos Variation AA Info Type
rs587776954 pathogenic, likely-pathogenic, Temtamy syndrome, Colobomatous microphthalmia, Corpus callosum abnormalities, Global developmental delay, Seizures, not provided 6,944,122(+) A/G downstream_transcript_variant
rs199643110 likely-benign, not specified 6,944,151(+) C/T downstream_transcript_variant
rs781901992 likely-benign, not specified 6,944,187(+) TAGTCAAGGCATAGGCTGCTGGCCTGGGGTAGTCAAGGCAT/TAGTCAAGGCAT downstream_transcript_variant
rs373573883 uncertain-significance, not specified 6,944,117(+) G/A/C/T downstream_transcript_variant
rs782600196 uncertain-significance, not specified 6,944,141(+) A/C/G downstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for RNU7-1 Gene

Variant ID Type Subtype PubMed ID
nsv1035811 CNV gain 25217958
nsv1047373 CNV gain 25217958
nsv509453 CNV insertion 20534489

Additional Variant Information for RNU7-1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
RNU7-1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for RNU7-1 Gene

Disorders for RNU7-1 Gene

Additional Disease Information for RNU7-1

No disorders were found for RNU7-1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for RNU7-1 Gene

Publications for RNU7-1 Gene

  1. U7 snRNAs: a computational survey. (PMID: 18267300) Marz M … Stadler PF (Genomics, proteomics & bioinformatics 2007) 2 3 58
  2. Large-scale sequencing in human chromosome 12p13: experimental and computational gene structure determination. (PMID: 9074930) Ansari-Lari MA … Gibbs RA (Genome research 1997) 3 58
  3. A gene-rich cluster between the CD4 and triosephosphate isomerase genes at human chromosome 12p13. (PMID: 8723724) Ansari-Lari MA … Gibbs RA (Genome research 1996) 3 58
  4. RNA-binding activity of TRIM25 is mediated by its PRY/SPRY domain and is required for ubiquitination. (PMID: 29117863) Choudhury NR … Michlewski G (BMC biology 2017) 3

Products for RNU7-1 Gene

Sources for RNU7-1 Gene

Content
Loading form....