Free for academic non-profit institutions. Other users need a Commercial license

Aliases for RNU7-1 Gene

Subcategory (RNA class) for RNU7-1 Gene


Quality Score for this RNA gene is


Aliases for RNU7-1 Gene

  • RNA, U7 Small Nuclear 1 2 3 5
  • RNA, Small Nuclear U7.1 2 3
  • RNA, Small Nuclear U7 2 3
  • RNA, U7 Small Nuclear 2
  • U7.1 3
  • RNU7 3

External Ids for RNU7-1 Gene

ORGUL Members for RNU7-1 Gene

Previous HGNC Symbols for RNU7-1 Gene

  • RNU7

Previous GeneCards Identifiers for RNU7-1 Gene

  • GC12P007054
  • GC12P007056
  • GC12P007058
  • GC12P007060
  • GC12P007063
  • GC12P007098
  • GC12P007104
  • GC12P007147
  • GC12P007041
  • GC12P007181
  • GC12P007228
  • GC12P007281
  • GC12P007327

Summaries for RNU7-1 Gene

GeneCards Summary for RNU7-1 Gene

RNU7-1 (RNA, U7 Small Nuclear 1) is an RNA Gene, and is affiliated with the snRNA class.

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for RNU7-1 Gene

Genomics for RNU7-1 Gene

Regulatory Elements for RNU7-1 Gene

Enhancers for RNU7-1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH12G006880 0.9 ENCODE 11.1 -62.9 -62945 1.6 ZFP64 ARID4B DMAP1 ZNF202 REST ZNF623 ZNF518A ZNF292 MIER3 ZBTB21 SPSB2 ENSG00000219410 C12orf57 GNB3 PHB2 ENSG00000247853 ENO2 CDCA3 USP5 ATN1
GH12G006885 0.8 ENCODE 11.4 -57.0 -56966 2.6 HDAC1 LEF1 SAP130 ZSCAN4 SIN3A TEAD3 FOSL1 ZNF121 FOS SMARCE1 SPSB2 ENO2 ATN1 CDCA3 USP5 C12orf57 RNU7-1 PHB2 SCARNA12 EMG1
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around RNU7-1 on UCSC Golden Path with GeneCards custom track

Promoters for RNU7-1 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000266980 484 1401 MLX CREB3L1 AGO1 ZFP64 DMAP1 YY1 ZNF143 ZNF548 ZNF263 SP3

Genomic Location for RNU7-1 Gene

6,943,816 bp from pter
6,943,878 bp from pter
63 bases
Plus strand

Genomic View for RNU7-1 Gene

Genes around RNU7-1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
RNU7-1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for RNU7-1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for RNU7-1 Gene

Proteins for RNU7-1 Gene

Post-translational modifications for RNU7-1 Gene

No Post-translational modifications

No data available for DME Specific Peptides for RNU7-1 Gene

Domains & Families for RNU7-1 Gene

Gene Families for RNU7-1 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with RNU7-1: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for RNU7-1 Gene

Function for RNU7-1 Gene

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for RNU7-1 Gene

Localization for RNU7-1 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for RNU7-1 Gene

Pathways & Interactions for RNU7-1 Gene

SuperPathways for RNU7-1 Gene

No Data Available

Interacting Proteins for RNU7-1 Gene

Gene Ontology (GO) - Biological Process for RNU7-1 Gene


No data available for Pathways by source and SIGNOR curated interactions for RNU7-1 Gene

Drugs & Compounds for RNU7-1 Gene

No Compound Related Data Available

Transcripts for RNU7-1 Gene

mRNA/cDNA for RNU7-1 Gene

(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Alternative Splicing Database (ASD) splice patterns (SP) for RNU7-1 Gene

No ASD Table

Relevant External Links for RNU7-1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for RNU7-1 Gene

No Expression Related Data Available

No data available for mRNA expression in normal human tissues , mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for RNU7-1 Gene

Orthologs for RNU7-1 Gene

This gene was present in the common ancestor of chordates.

Orthologs for RNU7-1 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia U7 35
  • 94 (a)
(Bos Taurus)
Mammalia U7 35
  • 92 (a)
(Monodelphis domestica)
Mammalia U7 35
  • 87 (a)
(Mus musculus)
Mammalia Rnu7 35
  • 85 (a)
(Ornithorhynchus anatinus)
Mammalia U7 35
  • 71 (a)
(Gallus gallus)
Aves U7 35
  • 69 (a)
(Anolis carolinensis)
Reptilia U7 35
  • 80 (a)
(Danio rerio)
Actinopterygii U7 35
  • 77 (a)
Species where no ortholog for RNU7-1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • dog (Canis familiaris)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for RNU7-1 Gene

Gene Tree for RNU7-1 (if available)
Gene Tree for RNU7-1 (if available)

Paralogs for RNU7-1 Gene

No data available for Paralogs for RNU7-1 Gene

Variants for RNU7-1 Gene

Sequence variations from dbSNP and Humsavar for RNU7-1 Gene

SNP ID Clin Chr 12 pos Sequence Context AA Info Type
rs587776954 Pathogenic 6,944,122(+) GCCCT(A/G)TGGCG intron-variant, nc-transcript-variant, downstream-variant-500B, reference, missense, utr-variant-5-prime
rs797045421 Likely benign 6,944,199(+) GGCAT(-/AGGCTGCTGGCCTGGGGTAGTCAAGGCAT)GGGCT intron-variant, downstream-variant-500B
rs1000062722 -- 6,942,517(+) GGAGG(C/T)GGTAC downstream-variant-500B, upstream-variant-2KB
rs1001643880 -- 6,943,087(+) GATCA(C/T)GAGGT upstream-variant-2KB
rs1001989739 -- 6,942,775(+) GGCTA(C/T)AGTGA downstream-variant-500B, upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for RNU7-1 Gene

Variant ID Type Subtype PubMed ID
nsv1035811 CNV gain 25217958
nsv1047373 CNV gain 25217958
nsv509453 CNV insertion 20534489

Relevant External Links for RNU7-1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for RNU7-1 Gene

Disorders for RNU7-1 Gene

No disorders were found for RNU7-1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot , Genatlas and External Links for RNU7-1 Gene

Publications for RNU7-1 Gene

  1. U7 snRNAs: a computational survey. (PMID: 18267300) Marz M. … Stadler P.F. (Genomics Proteomics Bioinformatics 2007) 2 3 64
  2. Large-scale sequencing in human chromosome 12p13: experimental and computational gene structure determination. (PMID: 9074930) Ansari-Lari M.A. … Gibbs R.A. (Genome Res. 1997) 3 64
  3. A gene-rich cluster between the CD4 and triosephosphate isomerase genes at human chromosome 12p13. (PMID: 8723724) Ansari-Lari M.A. … Gibbs R.A. (Genome Res. 1996) 3 64

Products for RNU7-1 Gene

Sources for RNU7-1 Gene

Loading form....