Free for academic non-profit institutions. Other users need a Commercial license

Aliases for RNU4-2 Gene

Subcategory (RNA class) for RNU4-2 Gene


Quality Score for this RNA gene is


Aliases for RNU4-2 Gene

  • RNA, U4 Small Nuclear 2 2 3 5
  • RNA, U4 Small Nuclear 1B 2 3
  • RNA, U4B1 Small Nuclear 2 3
  • RNA, U4C Small Nuclear 2 3
  • RNU4-1B 3
  • RNU4B1 3
  • RNU4C 3
  • U4A 3
  • U4b 3
  • U4c 3

External Ids for RNU4-2 Gene

ORGUL Members for RNU4-2 Gene

Previous HGNC Symbols for RNU4-2 Gene

  • RNU4C
  • RNU4-1B
  • RNU4B1

Previous GeneCards Identifiers for RNU4-2 Gene

  • GC12U900989
  • GC12M119219
  • GC12M120729
  • GC12M117737

Summaries for RNU4-2 Gene

GeneCards Summary for RNU4-2 Gene

RNU4-2 (RNA, U4 Small Nuclear 2) is an RNA Gene, and is affiliated with the snRNA class.

Additional gene information for RNU4-2 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for RNU4-2 Gene

Genomics for RNU4-2 Gene

Regulatory Elements for RNU4-2 Gene

Enhancers for RNU4-2 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH12H120239 2 FANTOM5 Ensembl ENCODE dbSUPER 11.8 +42.4 42373 19.3 PKNOX1 ARNT ZNF2 ZNF766 FOS REST ZNF592 MEF2D SMARCA4 GLIS1 SIRT4 RNU4-1 RNU4-2 RNU6-1088P PLA2G1B P2RX4 PXN BICDL1 RNF10 RAB35
GH12H120220 0.8 ENCODE dbSUPER 11.8 +71.1 71121 1.2 GLIS1 ARID4B KDM1A ZIC2 PXN GCN1 RNU4-1 RNU4-2 ENSG00000275936 GC12M120218
GH12H120222 0.7 ENCODE dbSUPER 11.8 +69.7 69691 0.2 BCOR ZMYM3 KDM1A PXN RNU4-2 RNU4-1 GCN1 ENSG00000275936 GC12M120218
GH12H120214 0.5 dbSUPER 10.9 +76.1 76084 1.8 GLIS2 POLR2A GLIS1 ZSCAN4 PXN RNU4-1 RNU4-2 SIRT4 ENSG00000111780 RPL31P52 TRIAP1 COQ5 GC12M120218 GC12P120211
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around RNU4-2 on UCSC Golden Path with GeneCards custom track

Promoters for RNU4-2 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000058293 -497 2401 MLX ZFP64 DMAP1 YY1 SLC30A9 ZNF143 SP3 NFYC ZC3H11A PPARGC1A

Genomic Locations for RNU4-2 Gene

Genomic Locations for RNU4-2 Gene
141 bases
Minus strand

Genomic View for RNU4-2 Gene

Genes around RNU4-2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
RNU4-2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for RNU4-2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for RNU4-2 Gene

Proteins for RNU4-2 Gene

Post-translational modifications for RNU4-2 Gene

No Post-translational modifications

No data available for DME Specific Peptides for RNU4-2 Gene

Domains & Families for RNU4-2 Gene

Gene Families for RNU4-2 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with RNU4-2: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for RNU4-2 Gene

Function for RNU4-2 Gene

Animal Model Products

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for RNU4-2 Gene

Localization for RNU4-2 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for RNU4-2 Gene

Pathways & Interactions for RNU4-2 Gene

SuperPathways for RNU4-2 Gene

No Data Available

Interacting Proteins for RNU4-2 Gene

Gene Ontology (GO) - Biological Process for RNU4-2 Gene


No data available for Pathways by source and SIGNOR curated interactions for RNU4-2 Gene

Drugs & Compounds for RNU4-2 Gene

No Compound Related Data Available

Transcripts for RNU4-2 Gene

mRNA/cDNA for RNU4-2 Gene

(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for RNU4-2 Gene

No ASD Table

Relevant External Links for RNU4-2 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for RNU4-2 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for RNU4-2 Gene

mRNA differential expression in normal tissues according to GTEx for RNU4-2 Gene

This gene is overexpressed in Whole Blood (x4.4).
genes like me logo Genes that share expression patterns with RNU4-2: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for RNU4-2 Gene

Orthologs for RNU4-2 Gene

This gene was present in the common ancestor of chordates.

Orthologs for RNU4-2 Gene

Organism Taxonomy Gene Similarity Type Details
(Canis familiaris)
Mammalia U4 34
  • 100 (a)
(Monodelphis domestica)
Mammalia U4 34
  • 100 (a)
(Mus musculus)
Mammalia Gm24407 34
  • 100 (a)
(Bos Taurus)
Mammalia U4 34
  • 99 (a)
(Ornithorhynchus anatinus)
Mammalia U4 34
  • 98 (a)
(Pan troglodytes)
Mammalia U4 34
  • 87 (a)
(Gallus gallus)
Aves U4 34
  • 96 (a)
(Anolis carolinensis)
Reptilia U4 34
  • 99 (a)
(Danio rerio)
Actinopterygii U4 34 34 34
  • 94 (a)
Species where no ortholog for RNU4-2 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for RNU4-2 Gene

Gene Tree for RNU4-2 (if available)
Gene Tree for RNU4-2 (if available)

Paralogs for RNU4-2 Gene

No data available for Paralogs for RNU4-2 Gene

Variants for RNU4-2 Gene

Sequence variations from dbSNP and Humsavar for RNU4-2 Gene

SNP ID Clin Chr 12 pos Sequence Context AA Info Type
rs1000114305 -- 120,291,906(+) GCTGG(A/G)AAGGT upstream-variant-2KB
rs1000724669 -- 120,292,398(+) GAGTT(C/T)AAGAC upstream-variant-2KB, utr-variant-5-prime
rs1000829757 -- 120,293,080(+) GTTCA(-/ACTGCAAGAAAATTCAGTCTCCGTAGAG)ACTGT intron-variant, upstream-variant-2KB, utr-variant-5-prime
rs1000842294 -- 120,291,681(+) CTCAT(A/G)ACTTA downstream-variant-500B, upstream-variant-2KB
rs1001338487 -- 120,291,655(+) CAACC(A/C/G)AAAAA downstream-variant-500B, upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for RNU4-2 Gene

Variant ID Type Subtype PubMed ID
nsv832530 CNV loss 17160897
nsv560435 CNV loss 21841781

Relevant External Links for RNU4-2 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for RNU4-2 Gene

Disorders for RNU4-2 Gene

Relevant External Links for RNU4-2

Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for RNU4-2 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for RNU4-2 Gene

Publications for RNU4-2 Gene

  1. Genes for human U4 small nuclear RNA. (PMID: 3582982) Bark C … Pettersson U (Gene 1986) 2 3 60
  2. Toward a complete human genome sequence. (PMID: 9847074) Sanger Center … Genome Sequencing Center (Genome research 1998) 3 60
  3. Primary and secondary structures of chicken, rat and man nuclear U4 RNAs. Homologies with U1 and U5 RNAs. (PMID: 6169000) Krol A … Jacob M (Nucleic acids research 1981) 3 60

Products for RNU4-2 Gene

Sources for RNU4-2 Gene

Loading form....