Free for academic non-profit institutions. Other users need a Commercial license

Aliases for RNF214 Gene

Aliases for RNF214 Gene

  • Ring Finger Protein 214 2 3 5

External Ids for RNF214 Gene

Previous GeneCards Identifiers for RNF214 Gene

  • GC11P116609
  • GC11P117104
  • GC11P113036

Summaries for RNF214 Gene

GeneCards Summary for RNF214 Gene

RNF214 (Ring Finger Protein 214) is a Protein Coding gene. An important paralog of this gene is DZIP3.

Additional gene information for RNF214 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for RNF214 Gene

Genomics for RNF214 Gene

Regulatory Elements for RNF214 Gene

Enhancers for RNF214 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH11H117327 1.1 ENCODE 34.6 +95.6 95593 2 HDGF PKNOX1 ARNT ARID4B SIN3A ZBTB7B YY1 ZNF766 ZNF207 ZNF143 RNF214 BUD13 ZPR1 PCSK7 ENSG00000252992 RPS27P19 BACE1 ENSG00000250699 GC11M117336
GH11H117036 1.3 Ensembl ENCODE dbSUPER 22.4 -195.0 -194973 1 ZNF146 INSM2 ZNF140 FEZF1 HIC1 ZNF121 ZNF366 SCRT2 ZNF600 TCF7L2 RNF214 APOA1 CEP164 LOC653303 BUD13 ENSG00000224077 SIK3 TAGLN APOA1-AS APOC3
GH11H117997 2 FANTOM5 Ensembl ENCODE dbSUPER 13 +773.4 773441 17 HDGF PKNOX1 ARNT YBX1 ZNF766 ZNF143 ZNF207 FOS MCM5 JUNB IL10RA ENSG00000254528 ARCN1 RNF214 KMT2A ENSG00000254909 UBE4A RPL5P30 FXYD2 TMPRSS13
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around RNF214 on UCSC Golden Path with GeneCards custom track

Promoters for RNF214 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000045493 -225 2401 ATF1 FOXA2 ARNT ZFP64 ARID4B SIN3A YY1 GLIS2 ELK1 ZNF207

Transcription factor binding sites by QIAGEN in the RNF214 gene promoter:

Genomic Location for RNF214 Gene

117,232,625 bp from pter
117,286,445 bp from pter
53,821 bases
Plus strand

Genomic View for RNF214 Gene

Genes around RNF214 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
RNF214 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for RNF214 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for RNF214 Gene

Proteins for RNF214 Gene

  • Protein details for RNF214 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    RING finger protein 214
    Protein Accession:
    Secondary Accessions:
    • B2RUW0
    • B4DTD1

    Protein attributes for RNF214 Gene

    703 amino acids
    Molecular mass:
    77667 Da
    Quaternary structure:
    No Data Available

    Alternative splice isoforms for RNF214 Gene


neXtProt entry for RNF214 Gene

Post-translational modifications for RNF214 Gene

  • Ubiquitination at isoforms=2259
  • Modification sites at PhosphoSitePlus

Other Protein References for RNF214 Gene

No data available for DME Specific Peptides for RNF214 Gene

Domains & Families for RNF214 Gene

Gene Families for RNF214 Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for RNF214 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with RNF214: view

No data available for UniProtKB/Swiss-Prot for RNF214 Gene

Function for RNF214 Gene

Phenotypes From GWAS Catalog for RNF214 Gene

Gene Ontology (GO) - Molecular Function for RNF214 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0046872 metal ion binding IEA --
genes like me logo Genes that share ontologies with RNF214: view
genes like me logo Genes that share phenotypes with RNF214: view

Animal Model Products

CRISPR Products

miRNA for RNF214 Gene

miRTarBase miRNAs that target RNF214

Inhibitory RNA Products

Clone Products

  • Applied Biological Materials Clones for RNF214
  • Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more

No data available for Molecular function , Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for RNF214 Gene

Localization for RNF214 Gene

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for RNF214 gene
Compartment Confidence
cytosol 3
nucleus 2
golgi apparatus 2

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (2)
  • Golgi apparatus (2)
See all subcellular structures

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for RNF214 Gene

Pathways & Interactions for RNF214 Gene

SuperPathways for RNF214 Gene

No Data Available

Gene Ontology (GO) - Biological Process for RNF214 Gene


No data available for Pathways by source and SIGNOR curated interactions for RNF214 Gene

Drugs & Compounds for RNF214 Gene

No Compound Related Data Available

Transcripts for RNF214 Gene

Unigene Clusters for RNF214 Gene

Ring finger protein 214:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

  • Applied Biological Materials Clones for RNF214
  • Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more

Alternative Splicing Database (ASD) splice patterns (SP) for RNF214 Gene

ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5a · 5b · 5c ^ 6 ^ 7 ^ 8 ^ 9 ^ 10 ^ 11a · 11b ^ 12 ^ 13a · 13b · 13c · 13d ^ 14 ^ 15 ^ 16 ^ 17a · 17b
SP1: -
SP5: -

Relevant External Links for RNF214 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for RNF214 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for RNF214 Gene

Protein differential expression in normal tissues from HIPED for RNF214 Gene

This gene is overexpressed in Adrenal (29.8) and Fetal Brain (9.1).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for RNF214 Gene

Protein tissue co-expression partners for RNF214 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of RNF214 Gene:


SOURCE GeneReport for Unigene cluster for RNF214 Gene:


Evidence on tissue expression from TISSUES for RNF214 Gene

  • Nervous system(4.3)
genes like me logo Genes that share expression patterns with RNF214: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for RNF214 Gene

Orthologs for RNF214 Gene

This gene was present in the common ancestor of chordates.

Orthologs for RNF214 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia RNF214 33 34
  • 99.76 (n)
(Bos Taurus)
Mammalia RNF214 33 34
  • 92.98 (n)
(Canis familiaris)
Mammalia RNF214 33 34
  • 92.92 (n)
(Rattus norvegicus)
Mammalia RGD1307500 33
  • 89.87 (n)
(Mus musculus)
Mammalia Rnf214 33 16 34
  • 89.82 (n)
(Monodelphis domestica)
Mammalia RNF214 34
  • 72 (a)
(Ornithorhynchus anatinus)
Mammalia RNF214 34
  • 67 (a)
(Gallus gallus)
Aves RNF214 33 34
  • 76.2 (n)
tropical clawed frog
(Silurana tropicalis)
Amphibia rnf214 33
  • 56.19 (n)
(Danio rerio)
Actinopterygii si:dkey-111e8.1 33
  • 46.78 (n)
RNF214 (1 of 2) 34
  • 31 (a)
RNF214 (2 of 2) 34
  • 17 (a)
Species where no ortholog for RNF214 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for RNF214 Gene

Gene Tree for RNF214 (if available)
Gene Tree for RNF214 (if available)

Paralogs for RNF214 Gene

Paralogs for RNF214 Gene

genes like me logo Genes that share paralogs with RNF214: view

Variants for RNF214 Gene

Sequence variations from dbSNP and Humsavar for RNF214 Gene

SNP ID Clin Chr 11 pos Sequence Context AA Info Type
rs1000008887 -- 117,266,023(+) TCCAT(A/G)AGGTG intron-variant
rs1000014913 -- 117,257,816(+) GAACC(A/G)AGTCT intron-variant
rs1000065414 -- 117,259,191(+) ACCTC(-/AAGTGAGCTGCCTGCCTCGGCCTCCCA)AAGTG intron-variant
rs1000083717 -- 117,266,386(+) ACAGG(G/T)TCTCA intron-variant
rs1000192582 -- 117,275,635(+) AAAAC(A/C/T)TAGAT intron-variant

Structural Variations from Database of Genomic Variants (DGV) for RNF214 Gene

Variant ID Type Subtype PubMed ID
dgv2186n54 CNV loss 21841781
nsv509443 CNV insertion 20534489
nsv513334 CNV insertion 21212237
nsv516483 CNV gain 19592680

Variation tolerance for RNF214 Gene

Residual Variation Intolerance Score: 8.7% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.78; 33.60% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for RNF214 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for RNF214 Gene

Disorders for RNF214 Gene

Relevant External Links for RNF214

Genetic Association Database (GAD)
Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for RNF214 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for RNF214 Gene

Publications for RNF214 Gene

  1. Genetic determinants of cardiovascular events among women with migraine: a genome-wide association study. (PMID: 21779381) Schürks M … Kurth T (PloS one 2011) 3 45 60
  2. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 60
  3. Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 60
  4. An organelle-specific protein landscape identifies novel diseases and molecular mechanisms. (PMID: 27173435) Boldt K … UK10K Rare Diseases Group (Nature communications 2016) 3 60
  5. A human interactome in three quantitative dimensions organized by stoichiometries and abundances. (PMID: 26496610) Hein MY … Mann M (Cell 2015) 3 60

Products for RNF214 Gene

Sources for RNF214 Gene

Loading form....