Free for academic non-profit institutions. Other users need a Commercial license

Aliases for RNF187 Gene

Aliases for RNF187 Gene

  • Ring Finger Protein 187 2 3
  • RING-Type E3 Ubiquitin Transferase RNF187 3 4
  • Ring Domain AP-1 Co-Activator 1 2 3
  • RING Domain AP1 Coactivator 1 3 4
  • RING Finger Protein 187 4 5
  • RACO-1 3 4
  • E3 Ubiquitin-Protein Ligase RNF187 3
  • Protein RNF187 3
  • EC 4
  • RACO1 3

External Ids for RNF187 Gene

Previous GeneCards Identifiers for RNF187 Gene

  • GC01P224982
  • GC01P226740
  • GC01P228675
  • GC01P199189

Summaries for RNF187 Gene

GeneCards Summary for RNF187 Gene

RNF187 (Ring Finger Protein 187) is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include ligase activity and ubiquitin-protein transferase activity.

UniProtKB/Swiss-Prot for RNF187 Gene

  • E3 ubiquitin-protein ligase that acts as a coactivator of JUN-mediated gene activation in response to growth factor signaling via the MAP3K1 pathway, independently from MAPK8.

Additional gene information for RNF187 Gene

No data available for Entrez Gene Summary , CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for RNF187 Gene

Genomics for RNF187 Gene

GeneHancer (GH) Regulatory Elements for RNF187 Gene

Promoters and enhancers for RNF187 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH01I228485 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 556.9 +0.5 486 3.3 CLOCK FEZF1 DMAP1 IRF4 YY1 SLC30A9 ZNF213 E2F8 ZNF143 SP3 RNF187 ENSG00000279306 CICP26 ZNF678 C1orf35 ENSG00000269890 MRPL55 GJC2 LOC105373124
GH01I228484 Enhancer 1.3 Ensembl ENCODE dbSUPER 550.8 -1.7 -1726 1 HDGF FOXA2 ARNT KLF17 ZNF2 RARA TCF12 ZNF121 EGR1 FOS RNF187 ENSG00000279306 CICP26 ZNF678 ENSG00000269890 OBSCN HIST3H2BA
GH01I228500 Enhancer 1.5 FANTOM5 Ensembl ENCODE dbSUPER 9.3 +13.8 13840 1.8 PKNOX1 ARID4B SIN3A DMAP1 ZNF48 ZNF766 ELK1 ZNF143 ATF7 RUNX3 HIST3H3 ZNF678 HIST3H2A HIST3H2BB RPL23AP15 CICP26 OBSCN-AS1 OBSCN C1orf35 RNF187
GH01I228489 Enhancer 1.2 ENCODE dbSUPER 9.7 +3.4 3389 1.6 ATF1 PKNOX1 SMAD1 ARNT TCF12 ZNF121 ZNF766 ATF7 SP3 CAVIN1 ENSG00000226920 RNF187 OBSCN ENSG00000279306 LOC105373124
GH01I228646 Promoter/Enhancer 2.1 FANTOM5 Ensembl ENCODE 4.4 +160.7 160660 3.4 HDGF ARID4B SIN3A YBX1 FEZF1 DMAP1 ZNF2 ZNF213 ZNF302 DEK GC01M228712 LOC105373132 RNA5S17 RNA5SP18 CICP26 HMGN2P19 C1orf35 LOC105373159 ENSG00000269890 NUP133
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around RNF187 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the RNF187 gene promoter:

Genomic Locations for RNF187 Gene

Genomic Locations for RNF187 Gene
9,128 bases
Plus strand

Genomic View for RNF187 Gene

Genes around RNF187 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
RNF187 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for RNF187 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for RNF187 Gene

Proteins for RNF187 Gene

  • Protein details for RNF187 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    E3 ubiquitin-protein ligase RNF187
    Protein Accession:
    Secondary Accessions:
    • A6NL57
    • Q6P2J7
    • Q6PJR0

    Protein attributes for RNF187 Gene

    235 amino acids
    Molecular mass:
    26190 Da
    Quaternary structure:
    • Homodimer (PubMed:23624934). Interacts with JUN, independently of JUN phosphorylation (PubMed:20852630). Interacts (via C-terminus) with TRIM7 (PubMed:25851810).
    • Sequence=AAH12758.1; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305}; Sequence=AAH12758.1; Type=Miscellaneous discrepancy; Note=Unusual initiator. The initiator methionine is coded by a non-canonical CTG leucine codon.; Evidence={ECO:0000305}; Sequence=CAI23328.1; Type=Erroneous gene model prediction; Evidence={ECO:0000305};

neXtProt entry for RNF187 Gene

Post-translational modifications for RNF187 Gene

  • Arginine methylation by PRMT1 stabilizes RNF187 by facilitating K63-linked ubiquitin chain formation, and enables dimerization, c-Jun interaction and subsequent AP1 target gene expression.
  • Ubiquitinated; undergoes Lys-48-linked autoubiquitination in the absence of growth factors and MAP3K1-induced Lys-63-linked polyubiquitination (PubMed:20852630). Lys-48-autoubiquitination leads to degradation by the proteasome, while MAP3K1-induced Lys-63-linked polyubiquitination results in the stabilization of the protein (PubMed:20852630). Lys-48- and Lys-63-linked polyubiquitinations occur most probably on the same 3 C-terminal lysine residues (Lys-195, Lys-223 and Lys-224) and are thus mutually exclusive (PubMed:20852630). Other sites of ubiquitination are not excluded (PubMed:20852630). Lys-63-linked polyubiquitination by TRIM7 in response to growth factor signaling via the MEK/ERK pathway enhances protein stability (PubMed:25851810).
  • Ubiquitination at Lys161, isoforms=195, Lys223, and Lys224

Other Protein References for RNF187 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for RNF187 Gene

Domains & Families for RNF187 Gene

Gene Families for RNF187 Gene

Human Protein Atlas (HPA):
  • Enzymes
  • Predicted intracellular proteins

Protein Domains for RNF187 Gene

Suggested Antigen Peptide Sequences for RNF187 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • The RING-type zinc finger domain is required for E3 ligase activity.
  • The RING-type zinc finger domain is required for E3 ligase activity.
genes like me logo Genes that share domains with RNF187: view

Function for RNF187 Gene

Molecular function for RNF187 Gene

UniProtKB/Swiss-Prot CatalyticActivity:
S-ubiquitinyl-[E2 ubiquitin-conjugating enzyme]-L-cysteine + [acceptor protein]-L-lysine = [E2 ubiquitin-conjugating enzyme]-L-cysteine + N(6)-ubiquitinyl-[acceptor protein]-L-lysine.
UniProtKB/Swiss-Prot Function:
E3 ubiquitin-protein ligase that acts as a coactivator of JUN-mediated gene activation in response to growth factor signaling via the MAP3K1 pathway, independently from MAPK8.

Enzyme Numbers (IUBMB) for RNF187 Gene

Phenotypes From GWAS Catalog for RNF187 Gene

Gene Ontology (GO) - Molecular Function for RNF187 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004842 ubiquitin-protein transferase activity IDA 20852630
GO:0005515 protein binding IPI 20852630
GO:0016740 transferase activity IEA --
GO:0046872 metal ion binding IEA --
genes like me logo Genes that share ontologies with RNF187: view

Phenotypes for RNF187 Gene

genes like me logo Genes that share phenotypes with RNF187: view

Animal Model Products

CRISPR Products

miRNA for RNF187 Gene

miRTarBase miRNAs that target RNF187

Inhibitory RNA Products

No data available for Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for RNF187 Gene

Localization for RNF187 Gene

Subcellular locations from UniProtKB/Swiss-Prot for RNF187 Gene

Cytoplasm. Nucleus. Note=Predominantly located in the cytoplasm. Shuttles between the cytoplasm and the nucleus.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for RNF187 gene
Compartment Confidence
nucleus 5
cytosol 5
extracellular 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (3)
  • Nucleoplasm (3)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for RNF187 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IEA,IDA 20852630
GO:0005654 nucleoplasm IDA --
GO:0005737 cytoplasm IEA,IDA 20852630
GO:0005829 cytosol IDA --
genes like me logo Genes that share ontologies with RNF187: view

Pathways & Interactions for RNF187 Gene

SuperPathways for RNF187 Gene

No Data Available

UniProtKB/Swiss-Prot Q5TA31-RN187_HUMAN

  • Pathway: Protein modification; protein ubiquitination.

Gene Ontology (GO) - Biological Process for RNF187 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0008284 positive regulation of cell proliferation ISS --
GO:0016567 protein ubiquitination IEA --
GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process IMP 20852630
GO:0045893 positive regulation of transcription, DNA-templated IMP 20852630
GO:0051865 protein autoubiquitination IDA 20852630
genes like me logo Genes that share ontologies with RNF187: view

No data available for Pathways by source and SIGNOR curated interactions for RNF187 Gene

Drugs & Compounds for RNF187 Gene

No Compound Related Data Available

Transcripts for RNF187 Gene

mRNA/cDNA for RNF187 Gene

Unigene Clusters for RNF187 Gene

Ring finger protein 187:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Alternative Splicing Database (ASD) splice patterns (SP) for RNF187 Gene

No ASD Table

Relevant External Links for RNF187 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for RNF187 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for RNF187 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for RNF187 Gene

This gene is overexpressed in Adrenal (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for RNF187 Gene

Protein tissue co-expression partners for RNF187 Gene

NURSA nuclear receptor signaling pathways regulating expression of RNF187 Gene:


SOURCE GeneReport for Unigene cluster for RNF187 Gene:


Evidence on tissue expression from TISSUES for RNF187 Gene

  • Nervous system(4.1)
  • Kidney(2.7)
  • Lung(2.5)
  • Thyroid gland(2.2)
  • Adrenal gland(2.1)
  • Liver(2)
genes like me logo Genes that share expression patterns with RNF187: view

Primer Products

No data available for mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for RNF187 Gene

Orthologs for RNF187 Gene

This gene was present in the common ancestor of mammals.

Orthologs for RNF187 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia RNF187 33 34
  • 92.34 (n)
(Mus musculus)
Mammalia Rnf187 33 16 34
  • 88.79 (n)
(Bos Taurus)
Mammalia RNF187 33 34
  • 87.09 (n)
(Rattus norvegicus)
Mammalia Rnf187 33
  • 87.09 (n)
Species where no ortholog for RNF187 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • dog (Canis familiaris)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for RNF187 Gene

Gene Tree for RNF187 (if available)
Gene Tree for RNF187 (if available)

Paralogs for RNF187 Gene

(2) SIMAP similar genes for RNF187 Gene using alignment to 2 proteins:

genes like me logo Genes that share paralogs with RNF187: view

No data available for Paralogs for RNF187 Gene

Variants for RNF187 Gene

Sequence variations from dbSNP and Humsavar for RNF187 Gene

SNP ID Clin Chr 01 pos Variation AA Info Type
rs1000165786 -- 228,488,163(+) C/G intron_variant
rs1000370748 -- 228,493,544(+) G/T intron_variant
rs1000741963 -- 228,493,785(+) C/T intron_variant
rs1000973426 -- 228,490,890(+) GTGTGTGT/GTGTGT intron_variant
rs1001536566 -- 228,495,565(+) CCCTGCCCCTGCCC/CCCTGCCCCTGCCCCTGCCC 3_prime_UTR_variant

Structural Variations from Database of Genomic Variants (DGV) for RNF187 Gene

Variant ID Type Subtype PubMed ID
dgv841n54 CNV gain 21841781
esv32853 CNV gain 17666407
nsv1013500 CNV gain 25217958
nsv1130986 CNV deletion 24896259
nsv468305 CNV gain 19166990
nsv517545 CNV loss 19592680
nsv523935 CNV loss 19592680
nsv549296 CNV gain 21841781
nsv826908 CNV gain 20364138

Variation tolerance for RNF187 Gene

Gene Damage Index Score: 0.22; 4.98% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for RNF187 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for RNF187 Gene

Disorders for RNF187 Gene

Additional Disease Information for RNF187

No disorders were found for RNF187 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for RNF187 Gene

Publications for RNF187 Gene

  1. RNF187 is Downregulated Following NF-κB Inhibition in Late Erythroblasts. (PMID: 27259582) Forster L … Ghassemifar R (Biochemical genetics 2016) 2 3 58
  2. Arginine methylation of the c-Jun coactivator RACO-1 is required for c-Jun/AP-1 activation. (PMID: 23624934) Davies CC … Behrens A (The EMBO journal 2013) 3 4 58
  3. Identification of a co-activator that links growth factor signalling to c-Jun/AP-1 activation. (PMID: 20852630) Davies CC … Behrens A (Nature cell biology 2010) 3 4 58
  4. The DNA sequence and biological annotation of human chromosome 1. (PMID: 16710414) Gregory SG … Prigmore E (Nature 2006) 3 4 58
  5. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58

Products for RNF187 Gene

Sources for RNF187 Gene

Loading form....