Set Analyses:
Advanced Search

Advanced Search

Search By
Section (entire)



protein-coding   GIFtS: 65
GCID: GC04P057774

RE1-Silencing Transcription Factor

  Try our

disease database 

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

RE1-Silencing Transcription Factor1 2     RE1-Silencing Transcription Factor Variant E1a/E2k/E2i/E3/E4j2
NRSF2 3 5     RE1-Silencing Transcription Factor Variant E1b/E2/E3/E52
Neural-Restrictive Silencer Factor2 3     RE1-Silencing Transcription Factor Variant E1b/E2/E3/N3b/E4i2
XBR2 3     RE1-Silencing Transcription Factor Variant E1b/E2/E3/N3c/E42
Neuron Restrictive Silencer Factor2     RE1-Silencing Transcription Factor Variant E1b/E2c/E2j/E3/E42
RE1-Silencing Transcription Factor Variant E1a/E2/E3/E4c2     RE1-Silencing Transcription Factor Variant E1c/E2/E3/E52
RE1-Silencing Transcription Factor Variant E1a/E2/E3/E52     RE1-Silencing Transcription Factor Variant E1c/E2g/E3/E42
RE1-Silencing Transcription Factor Variant E1a/E2/E3/N3a/E4i2     Repressor Binding To The X2 Box2
RE1-Silencing Transcription Factor Variant E1a/E2/E3/N3c/E42     X2 Box Repressor3
RE1-Silencing Transcription Factor Variant E1a/E2/E42     

External Ids:    HGNC: 99661   Entrez Gene: 59782   Ensembl: ENSG000000840937   OMIM: 6005715   UniProtKB: Q131273   

Export aliases for REST gene to outside databases

Previous GC identifers: GC04P057577 GC04P057730 GC04P057689 GC04P057614 GC04P057468 GC04P053727

(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for REST Gene:
This gene encodes a transcriptional repressor that represses neuronal genes in non-neuronal tissues. It is a
member of the Kruppel-type zinc finger transcription factor family. It represses transcription by binding a DNA
sequence element called the neuron-restrictive silencer element. The protein is also found in undifferentiated
neuronal progenitor cells and it is thought that this repressor may act as a master negative regular of
neurogenesis. Alternatively spliced transcript variants have been described (provided by RefSeq, Jul 2010)

GeneCards Summary for REST Gene:
REST (RE1-silencing transcription factor) is a protein-coding gene. GO annotations related to this gene include transcription factor binding and sequence-specific DNA binding transcription factor activity. An important paralog of this gene is ZNF407.

UniProtKB/Swiss-Prot: REST_HUMAN, Q13127
Function: Transcriptional repressor which binds neuron-restrictive silencer element (NRSE) and represses neuronal
gene transcription in non-neuronal cells. Restricts the expression of neuronal genes by associating with two
distinct corepressors, mSin3 and CoREST, which in turn recruit histone deacetylase to the promoters of
REST-regulated genes. Mediates repression by recruiting the BHC complex at RE1/NRSE sites which acts by
deacetylating and demethylating specific sites on histones, thereby acting as a chromatin modifier.
Transcriptional repression by REST-CDYL via the recruitment of histone methyltransferase EHMT2 may be important
in transformation suppression

Gene Wiki entry for REST (RE1-silencing transcription factor) Gene

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

RefSeq DNA sequence at NCBI GenBank:
NC_000004.11  NT_022853.16  NC_018915.2  
Regulatory elements:
   Regulatory transcription factor binding sites in the REST gene promoter:
         CREB   POU2F1   POU2F1a   NRSF form 1   deltaCREB   Lmo2   NRSF form 2   C/EBPalpha   YY1   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidREST promoter sequence
   Search Chromatin IP Primers for REST

DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat REST

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 4q12   Ensembl cytogenetic band:  4q12   HGNC cytogenetic band: 4q12

REST Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
REST gene location

GeneLoc information about chromosome 4         GeneLoc Exon Structure

GeneLoc location for GC04P057774:  view genomic region     (about GC identifiers)

57,774,042 bp from pter      End:
57,802,010 bp from pter
27,969 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, Cloud-Clone Corp., eBioscience, antibodies-online, and/or GeneTex,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, Cloud-Clone Corp., eBioscience, and/or antibodies-online, Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, Cloud-Clone Corp, antibodies-online, and/or others.)
About This Section

UniProtKB/Swiss-Prot: REST_HUMAN, Q13127 (See protein sequence)
Recommended Name: RE1-silencing transcription factor  
Size: 1097 amino acids; 121872 Da
Subunit: Interacts with SIN3A, SIN3B and RCOR1. Interacts with CDYL. Interacts with EHMT1 and EHMT2 only in the
presence of CDYL. Part of a complex containing at least CDYL, REST, WIZ, SETB1, EHMT1 and EHMT2
Sequence caution: Sequence=AAA98503.1; Type=Frameshift; Positions=188, 198, 202, 212, 1087; Sequence=AAC50114.1;
Type=Erroneous initiation; Note=Translation N-terminally shortened; Sequence=AAC50115.1; Type=Erroneous
initiation; Note=Translation N-terminally shortened; Sequence=AAH38985.1; Type=Miscellaneous discrepancy;
Note=Contaminating sequence. Potential poly-A sequence; Sequence=BAD92987.1; Type=Erroneous initiation;
Note=Translation N-terminally shortened;
1 PDB 3D structure from and Proteopedia for REST:
2CZY (3D)    
Secondary accessions: A2RUE0 B9EGJ0 Q12956 Q12957 Q13134 Q59ER1 Q8IWI3
Alternative splicing: 4 isoforms:  Q13127-1   Q13127-2   Q13127-3   Q13127-4   

Explore the universe of human proteins at neXtProt for REST: NX_Q13127

Explore proteomics data for REST at MOPED

Post-translational modifications: 

  • Modification sites at neXtProt
  • Modification sites at PhosphoSitePlus

  • See REST Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins (2 alternative transcripts): 
    NP_001180437.1  NP_005603.3  

    ENSEMBL proteins: 

    REST Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    OriGene Protein Over-expression Lysate for REST
    OriGene Custom MassSpec
    OriGene Custom Protein Services for REST
    GenScript Custom Purified and Recombinant Proteins Services for REST
    Novus Biologicals REST Lysate
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for REST

    Search eBioscience for Proteins for REST 

    Search GeneTex for Proteins for REST 

    Search antibodies-online for proteins for REST 

    Search antibodies-online for peptides for REST

    REST Antibody Products:

    EMD Millipore Mono- and Polyclonal Antibodies for the study of REST
    Browse R&D Systems for Antibodies
    OriGene Antibodies for REST
    OriGene Custom Antibody Services for REST
    Novus Biologicals REST Antibodies
    Abcam antibodies for REST
    Cloud-Clone Corp. Antibodies for REST
    ThermoFisher Antibodies for REST
    antibodies-online antibodies for REST (28 products) 

    REST Assay Products:

    EMD Millipore Kits and Assays for the Analysis of REST
    OriGene Custom Assay Services for REST
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for REST
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for REST
    Cloud-Clone Corp. CLIAs for REST
    Search eBioscience for ELISAs for REST 
    antibodies-online kits for REST (6 products) 

    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GenesLikeMe)
    About This Section

    5 InterPro protein domains:
     IPR015880 Znf_C2H2-like
     IPR027775 C2H2_Znf_fam
     IPR013087 Znf_C2H2/integrase_DNA-bd
     IPR027757 REST
     IPR007087 Znf_C2H2

    Graphical View of Domain Structure for InterPro Entry Q13127

    ProtoNet protein and cluster: Q13127

    1 Blocks protein domain: IPB007086 C2H2-type zinc finger signature

    UniProtKB/Swiss-Prot: REST_HUMAN, Q13127
    Similarity: Contains 9 C2H2-type zinc fingers

    Find genes that share domains with REST           About GenesLikeMe

    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, Vector BioLabs and/or Addgene, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Flow cytometry from eBioscience, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene, Sets of similar genes according to GenesLikeMe)
    About This Section

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: REST_HUMAN, Q13127
    Function: Transcriptional repressor which binds neuron-restrictive silencer element (NRSE) and represses neuronal
    gene transcription in non-neuronal cells. Restricts the expression of neuronal genes by associating with two
    distinct corepressors, mSin3 and CoREST, which in turn recruit histone deacetylase to the promoters of
    REST-regulated genes. Mediates repression by recruiting the BHC complex at RE1/NRSE sites which acts by
    deacetylating and demethylating specific sites on histones, thereby acting as a chromatin modifier.
    Transcriptional repression by REST-CDYL via the recruitment of histone methyltransferase EHMT2 may be important
    in transformation suppression

         Genatlas biochemistry entry for REST:
    RE1 silencing transcription factor

         Gene Ontology (GO): Selected molecular function terms (see all 11):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0001046core promoter sequence-specific DNA binding IDA8568247
    GO:0001047core promoter binding IDA17984088
    GO:0001078RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription IDA10449787
    GO:0003677DNA binding ----
    GO:0003682chromatin binding ISS--
    Find genes that share ontologies with REST           About GenesLikeMe

         1 GenomeRNAi human phenotype for REST:
     Increased cell transformation 

         7 MGI mutant phenotypes (inferred from 7 alleles(MGI details for Rest):
     cellular  embryogenesis  growth/size/body  mortality/aging  nervous system 
     reproductive system  vision/eye 

    Find genes that share phenotypes with REST           About GenesLikeMe

    Animal Models:
         MGI mouse knock-outs for REST: Resttm1.2Yasu Resttm1And Resttm1Ymat

       genOway: Develop your customized and physiologically relevant rodent model for REST

    Transcription Factor Targeting: 
    Targeting motifs: HOMER Transcription Factor Regulatory Elements motif viewer 
                                          Consensus sequence:  GGAGCTGTCCATGGTGCTGA 

    miRTarBase miRNAs that target REST:
    hsa-mir-9-5p (MIRT000026), hsa-mir-335-5p (MIRT018727), hsa-mir-21-5p (MIRT000177)

    Block miRNA regulation of human, mouse, rat REST using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate REST (see all 80):
    hsa-miR-579 hsa-miR-607 hsa-miR-520e hsa-miR-4272 hsa-miR-106a hsa-miR-219-5p hsa-miR-3142 hsa-miR-4325
    Browse SwitchGear 3'UTR luciferase reporter plasmids
    Inhib. RNA
    OriGene RNAi products in human, mouse, rat for REST
    Predesigned siRNA for gene silencing in human, mouse, rat REST

    Gene Editing
    DNA2.0 Custom Protein Engineering Service for REST

    OriGene clones in human, mouse for REST (see all 7)
    OriGene ORF clones in mouse, rat for REST
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): REST (NM_005612)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for REST
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat REST
    Addgene plasmids for REST 

    Cell Line
    GenScript Custom overexpressing Cell Line Services for REST
    Browse ESI BIO Cell Lines and PureStem Progenitors for REST 
    In Situ Assay

    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for REST

    Flow Cytometry

    eBioscience FlowRNA Probe Sets ( VA1-13072) for REST 

    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene, Sets of similar genes according to GenesLikeMe)
    About This Section

    Subcellular locations from UniProtKB/Swiss-Prot
    REST_HUMAN, Q13127: Nucleus (Probable)
    Subcellular locations from COMPARTMENTS: 


    Gene Ontology (GO): 4 cellular component terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005634nucleus NAS7871435
    GO:0005737cytoplasm ----
    GO:0005829cytosol IEA--
    GO:0017053transcriptional repressor complex IDA10734093

    Find genes that share ontologies with REST           About GenesLikeMe

    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GenesLikeMe, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene, Sets of similar genes according to GenesLikeMe)
    About This Section

    SuperPaths for REST About   (see all 6)  
    See pathways by source

    SuperPathContained pathways About
    1Respiratory electron transport, ATP synthesis by chemiosmotic coupling, and heat production by uncoupling proteins.
    Huntington's disease0.45
    2Development NOTCH1-mediated pathway for NF-KB activity modulation
    Transcription Sin3 and NuRD in transcription regulation0.31
    3WNT Signaling
    WNT Signaling
    4Transcriptional Regulatory Network in Embryonic Stem Cell
    Transcriptional Regulatory Network in Embryonic Stem Cell
    5SIDS Susceptibility Pathways
    SIDS Susceptibility Pathways

    Find genes that share SuperPaths with REST           About GenesLikeMe

    Pathways by source                                   See SuperPaths
    Show all pathways

    2 Downloadable PowerPoint Slides of GeneGlobe Pathway Central Maps for REST
        Transcriptional Regulatory Network in Embryonic Stem Cell
    WNT Signaling

    2 GeneGo (Thomson Reuters) Pathways for REST
        Transcription Sin3 and NuRD in transcription regulation
    Dichloroethylene metabolism

    1 BioSystems Pathway for REST
        SIDS Susceptibility Pathways

    1 Kegg Pathway  (Kegg details for REST):
        Huntington's disease

        Pathway & Disease-focused RT2 Profiler PCR Arrays including REST: 
              Embryonic Stem Cells in human mouse rat
              Huntington's Disease in human mouse rat


        GeneGlobe Interaction Network for REST

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    Selected Interacting proteins for REST (Q131271, 3 ENSP000003118164) via UniProtKB, MINT, STRING, and/or I2D (see all 43)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    SMARCA4P515321, 3, ENSP000003507204EBI-926706,EBI-302489 I2D: score=2 STRING: ENSP00000350720
    EHMT2Q96KQ73I2D: score=1 
    ENSG00000206376Q96KQ73I2D: score=1 
    ENSG00000227333Q96KQ73I2D: score=1 
    ENSG00000232045Q96KQ73I2D: score=1 
    About this table

    Gene Ontology (GO): Selected biological process terms (see all 24):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000122negative regulation of transcription from RNA polymerase II promoter TAS7697725
    GO:0006355regulation of transcription, DNA-templated NAS7871435
    GO:0008285negative regulation of cell proliferation IMP--
    GO:0010629negative regulation of gene expression IMP--
    GO:0032348negative regulation of aldosterone biosynthetic process IMP19342457

    Find genes that share ontologies with REST           About GenesLikeMe

    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, Sets of similar genes according to GenesLikeMe)
    About This Section

    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for REST

    8 Novoseek inferred chemical compound relationships for REST gene    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    zinc 40 13 11741002 (2), 10521596 (1), 12220737 (1), 11703459 (1) (see all 7)
    nmda 6.51 4 15755907 (2), 10640675 (1)
    kainate 6.39 5 16701950 (4)
    sodium 0 1 14561745 (1)
    calcium 0 1 19426709 (1)
    tyrosine 0 2 16764822 (1), 9648849 (1)
    arginine 0 1 12220737 (1)
    glutamate 0 1 16701950 (1)

    Find genes that share compounds with REST           About GenesLikeMe

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, and/or Addgene, Primers from OriGene, and/or QIAGEN, Flow cytometry from eBioscience )
    About This Section

    REFSEQ mRNAs for REST gene (3 alternative transcripts): 
    NM_001193508.1  NM_005612.4  XM_005265760.1  

    Unigene Cluster for REST:

    RE1-silencing transcription factor
    Hs.307836  [show with all ESTs]
    Unigene Representative Sequence: NM_005612
    4 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000309042(uc003hch.3 uc003hci.3 uc010ihf.3) ENST00000511065
    ENST00000503522 ENST00000514063
    Block miRNA regulation of human, mouse, rat REST using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate REST (see all 80):
    hsa-miR-579 hsa-miR-607 hsa-miR-520e hsa-miR-4272 hsa-miR-106a hsa-miR-219-5p hsa-miR-3142 hsa-miR-4325
    Browse SwitchGear 3'UTR luciferase reporter plasmids
    Inhib. RNA
    OriGene RNAi products in human, mouse, rat for REST
    Predesigned siRNA for gene silencing in human, mouse, rat REST
    OriGene clones in human, mouse for REST (see all 7)
    OriGene ORF clones in mouse, rat for REST
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): REST (NM_005612)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for REST
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat REST
    Addgene plasmids for REST 
    OriGene qPCR primer pairs and template standards for REST
    OriGene qSTAR qPCR primer pairs in human, mouse for REST
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat REST
      QuantiTect SYBR Green Assays in human, mouse, rat REST
      QuantiFast Probe-based Assays in human, mouse, rat REST
    Flow Cytometry

    eBioscience FlowRNA Probe Sets ( VA1-13072) for REST 

    Additional mRNA sequence: 

    AB209750.1 AF228045.1 BC017822.1 BC038985.1 BC132859.1 BC136491.1 JX896957.1 JX896958.1 
    JX896959.1 JX896960.1 JX896961.1 JX896962.1 JX896963.1 JX896964.1 JX896965.1 JX896966.1 
    JX896967.1 JX896968.1 JX896969.1 JX896970.1 JX896971.1 JX896972.1 JX896973.1 JX896974.1 
    JX896975.1 JX896976.1 JX896977.1 JX896978.1 JX896979.1 JX896980.1 JX896981.1 JX896982.1 
    JX896983.1 JX896984.1 JX896985.1 JX896986.1 JX896987.1 JX896988.1 JX896989.1 JX896990.1 
    JX896991.1 JX896992.1 JX896993.1 KC117262.1 KC117263.1 KC117264.1 KC117265.1 KC117266.1 
    U13877.1 U13879.1 U22314.1 

    7 DOTS entries:

    DT.97842965  DT.100878061  DT.101977160  DT.40248261  DT.95159023  DT.91776459  DT.91776455 

    Selected AceView cDNA sequences (see all 163):

    BQ045299 AA766208 BM551017 BC017822 CA432947 AW068887 W74281 AA598571 
    AI022988 AW665998 AI740830 BE466700 AI445187 AI124003 AW207586 NM_005612 
    AW468023 AI671959 AI693146 BX283975 AI253794 CB135540 AI122873 AI032985 

    GeneLoc Exon Structure

    3 Alternative Splicing Database (ASD) splice patterns (SP) for REST    About this scheme

    ExUns: 1 ^ 2 ^ 3a · 3b ^ 4 ^ 5 ^ 6a · 6b
    SP1:        -                       -               
    SP2:                                -               

    ECgene alternative splicing isoforms for REST

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GenesLikeMe, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    REST expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    REST Expression
    About this image

    REST expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database
     selected tissues (see all 7) fully expand
     Brain (Nervous System)    fully expand to see all 3 entries
     Ovary (Reproductive System)    fully expand to see all 2 entries
             Ovarian Mesenchymal Stroma Cells Ovary Interstitium
     Trophoblast (Extraembryonic Tissues)
             Trophoblast Cells Trophoblast
     Pancreas (Endocrine System)
             Islets of Langerhans
     Liver (Hepatobiliary System)
             Hepatocytes Liver Lobule
    REST Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    REST Protein Expression

    SOURCE GeneReport for Unigene cluster: Hs.307836

    UniProtKB/Swiss-Prot: REST_HUMAN, Q13127
    Tissue specificity: Ubiquitous. Expressed at higher levels in the tissues of the lymphocytic compartment,
    including spleen, thymus, peripheral blood lymphocytes and ovary

        Pathway & Disease-focused RT2 Profiler PCR Arrays including REST: 
              Embryonic Stem Cells in human mouse rat
              Huntington's Disease in human mouse rat

    OriGene qPCR primer pairs and template standards for REST
    OriGene qSTAR qPCR primer pairs in human, mouse for REST
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat REST
    QuantiTect SYBR Green Assays in human, mouse, rat REST
    QuantiFast Probe-based Assays in human, mouse, rat REST
    In Situ
    Assay Products:

    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for REST

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of animals.

    Orthologs for REST gene from Selected species (see all 14)    About this table
    Organism Taxonomic
    Gene Description Human
    (Mus musculus)
    Mammalia Rest1 , 5 RE1-silencing transcription factor1, 5 73.08(n)1
      5 (41.61 cM)5
    197121  NM_011263.21  NP_035393.21 
    (Gallus gallus)
    Aves REST1 RE1-silencing transcription factor 71.01(n)
      422623  XM_420580.4  XP_420580.4 
    (Anolis carolinensis)
    Reptilia REST6
    RE1-silencing transcription factor
    1 ↔ 1
    African clawed frog
    (Xenopus laevis)
    Amphibia rest-A2 RE1-silencing transcription factor 78.78(n)    AF096301.1 
    (Danio rerio)
    Actinopterygii rest6
    RE1-silencing transcription factor
    1 ↔ 1
    14(53551088-53557593) ENSDARG00000007222
    fruit fly
    (Drosophila melanogaster)
    Insecta CG316126
    1 → many

    ENSEMBL Gene Tree for REST (if available)
    TreeFam Gene Tree for REST (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to Build 68,Sets of similar genes according to GenesLikeMe)
    About This Section

    Paralogs for REST gene
    Selected SIMAP similar genes for REST using alignment to 16 protein entries:     REST_HUMAN (see all proteins) (see all similar genes):
    ZNF148    ZNF79    ZNF500    ZNF768    ZNF420    ZNF112
    ZNF133    kr-znf3    ZNF213    ZNF544    ZNF83    ZNF808
    ATL1    ATL1-delta    HKR1    ZNF263    ZNF418    ZNF426

    Find genes that share paralogs with REST           About GenesLikeMe

    1 Pseudogene for REST

    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    Selected SNPs for REST (see all 741)    About this table                                 

    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    Chr 4 posSequence#AA
    --53755997(+) TTCACA/CCAAGA 2 -- ds50010--------
    C,F--57677018(+) ATTTTC/AAATTG 1 -- us2k11Minor allele frequency- A:0.06WA 118
    H--57677054(+) ACCTGT/GGGCCT 1 -- us2k1 tfbs34Minor allele frequency- G:0.00NS EA 418
    --57677071(+) CATGAC/TAATTT 1 -- us2k10--------
    F--57677148(+) CATTCG/ACCATT 1 -- us2k11Minor allele frequency- A:0.03WA 118
    F--57677175(+) AATATG/ATGGGA 1 -- us2k11Minor allele frequency- A:0.03WA 118
    C,F--57677285(+) TTGGAC/ACTAAA 1 -- us2k11Minor allele frequency- A:0.06WA 118
    C--57677335(+) GTAGAA/GGCCTG 1 -- us2k10--------
    C--57677471(+) TCCCTC/-CCCTC 1 -- us2k11Minor allele frequency- -:0.00CSA 2
    --57677563(+) CCTCAC/TTGAAA 1 -- us2k10--------

    HapMap Linkage Disequilibrium report for REST (57774042 - 57802010 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 3 variations for REST:    About this table    
    Variant IDTypeSubtypePubMed ID
    esv2663344CNV Deletion23128226
    esv22393CNV Loss19812545
    nsv822562CNV Gain20364138

    Human Gene Mutation Database (HGMD): REST
    Site Specific Mutation Identification with PCR Assays
    SeqTarget long-range PCR primers for resequencing REST
    DNA2.0 Custom Variant and Variant Library Synthesis for REST

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB, Sets of similar genes according to GenesLikeMe)
    About This Section

    OMIM gene information: 600571    OMIM disorders: --

    1 inferred disease relationship from the University of Copenhagen DISEASES database for REST:
    Huntington's disease

    Find genes that share disorders with REST           About GenesLikeMe

    7 Novoseek inferred disease relationships for REST gene    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    medulloblastoma 32.3 5 16823502 (2), 19150961 (1)
    small cell lung cancer 28.2 6 10766169 (2), 12220737 (1), 14741407 (1)
    pheochromocytoma 18.4 1 18485095 (1)
    glioma 4.8 5 16823502 (4)
    down syndrome 0 2 11830198 (1), 15068239 (1)
    tumors 0 8 15960972 (2), 16929174 (2), 18818083 (1), 19846118 (1) (see all 6)
    cancer 0 4 15960972 (1), 18354483 (1), 16823502 (1)

    Genetic Association Database (GAD): REST
    Human Genome Epidemiology (HuGE) Navigator: REST (298 documents)

    Export disorders for REST gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for REST gene, integrated from 10 sources (see all 203):
    (articles sorted by number of sources associating them with REST)

    1. The neuron-restrictive silencer factor (NRSF): a coordinate repressor of multiple neuron-specific genes. (PubMed id 7871435)1, 2, 3, 9 Schoenherr C.J. and Anderson D.J. (Science 1995)
    2. REST: a mammalian silencer protein that restricts sodium channel gene expression to neurons. (PubMed id 7697725)1, 2, 3 Chong J.A.... Mandel G. (Cell 1995)
    3. Additive effect of BDNF and REST polymorphisms is associated with improved general cognitive ability. (PubMed id 18518926)1, 4, 9 Miyajima F....Payton A. (Genes Brain Behav. 2008)
    4. Neuron-specific splicing of zinc finger transcription factor REST/NRSF/XBR is frequent in neuroblastomas and conserved in human, mouse and rat. (PubMed id 10521596)1, 2, 9 Palm K.... Timmusk T. (Brain Res. Mol. Brain Res. 1999)
    5. The neural repressor NRSF/REST binds the PAH1 domain of the Sin3 corepressor by using its distinct short hydrophobic helix. (PubMed id 16288918)1, 2, 9 Nomura M.... Nishimura Y. (J. Mol. Biol. 2005)
    6. Genome-wide association study identifies two susceptibility loci for exudative age-related macular degeneration in the Japanese population. (PubMed id 21909106)1, 4 Arakawa S....Kubo M. (Nat. Genet. 2011)
    7. A genetic variant near the PMAIP1/Noxa gene is associated with increased bleomycin sensitivity. (PubMed id 21106707)1, 4 Gu J....Wu X. (Hum. Mol. Genet. 2011)
    8. Variation at the NFATC2 locus increases the risk of thiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipril and rosiglitazone Medication (DREAM) study. (PubMed id 20628086)1, 4 Bailey S.D....Anand S. (Diabetes Care 2010)
    9. CDYL bridges REST and histone methyltransferases for gene repression and suppression of cellular transformation. (PubMed id 19061646)1, 2 Mulligan P....Shi Y. (Mol. Cell 2008)
    10. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S.... Malek J. (Genome Res. 2004)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
    Free Text  

      Query String
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 5978 HGNC: 9966 AceView: REST Ensembl:ENSG00000084093 euGenes: HUgn5978
    ECgene: REST Kegg: 5978 H-InvDB: REST

    (According to HUGE)
    About This Section

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section
    PharmGKB entry for REST Pharmacogenomics, SNPs, Pathways
    ATLAS Chromosomes in Cancer entry for REST Genetics and Cytogenetics in Oncology and Haematology

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for REST gene:
    Search GeneIP for patents involving REST

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search

    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, eBioscience, antibodies-online, GeneTex, and/or others, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Addgene, Cell lines from GenScript, and ESI BIO, Flow cytometery from eBioscience, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from genOway)
    About This Section

     EMD Millipore Mono- and Polyclonal Antibodies for the study of REST
     Browse Purified and Recombinant Proteins at EMD Millipore
     Browse Small Molecules at EMD Millipore
     EMD Millipore Kits and Assays for the Analysis of REST
     EMD Millipore genomic analysis products

     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     OriGene Antibodies for REST   OriGene RNAi products in human, mouse, rat for REST  
     OriGene qPCR primer pairs and template standards for REST   OriGene Protein Over-expression Lysate for REST  
     OriGene Custom Mass Spec   OriGene clones in human, mouse for REST  
     OriGene qSTAR qPCR primer pairs in human, mouse for REST   Browse OriGene full length recombinant human proteins expressed in human HEK293 cells  
     OriGene ORF clones in mouse, rat for REST   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for REST   OriGene Custom Protein Services for REST  

     Block miRNA regulation of human, mouse, rat REST using miScript Target Protectors SeqTarget long-range PCR primers for resequencing REST
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat REST Predesigned siRNA for gene silencing in human, mouse, rat REST
     QuantiFast Probe-based Assays in human, mouse, rat REST QuantiTect SYBR Green Assays in human, mouse, rat REST
     PCR Arrays including human, mouse, rat REST Search Chromatin IP Primers for REST
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat REST  GeneGlobe Interaction Network for REST
     Regulatory tfbs in REST promoter
     GenScript Custom Purified and Recombinant Proteins Services for REST GenScript cDNA clones with any tag delivered in your preferred vector for REST
     GenScript Custom Assay Services for REST GenScript Custom overexpressing Cell Line Services for REST
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Search for Antibodies & Assays

     Search Tocris compounds for REST
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     REST antibodies
     REST lysates
     Antibodies for REST
     See all of Abcam's Antibodies, Kits and Proteins for REST
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins
     Proteins for REST
     Antibodies for REST
     ELISAs for REST
     CLIAs for REST

     Browse ESI BIO Cell Lines and PureStem Progenitors for REST
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for REST
     Browse SwitchGear 3'UTR luciferase reporter plasmids for REST
     SwitchGear Promoter luciferase reporter plasmids for REST
     ThermoFisher Antibodies for REST
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat REST
     Browse compounds at ApexBio
     Addgene plasmids for REST
      Search eBioscience for proteins for REST
      Search eBioscience for elisas for REST
      eBioscience FlowRNA Probe Sets
     genOway: Develop your customized and physiologically relevant rodent model for REST
     antibodies-online antibodies for REST (28 products)
     antibodies-online kits for REST (6 products)
      Search antibodies-online for peptides for REST
      Search antibodies-online for proteins for REST
      Search GeneTex for proteins for REST
    GeneCards Home - Full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014 , 21 Aug 2014 , 8 Sep 2014 , 2 Nov 2014 , 8 Jan 2015 , 3 Feb 2015

    View Random Gene

    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 

    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      REST gene at Home site.
    Version: 3.12.352 5 Mar 2015
    hostname: index build: 128 solr: 1.4