Free for academic non-profit institutions. Other users need a Commercial license

Aliases for REST Gene

Aliases for REST Gene

  • RE1 Silencing Transcription Factor 2 3 5
  • RE1-Silencing Transcription Factor 2 3
  • Neural-Restrictive Silencer Factor 3 4
  • NRSF 3 4
  • XBR 3 4
  • RE1-Silencing Transcription Factor Variant E1a/E2k/E2i/E3/E4j 3
  • RE1-Silencing Transcription Factor Variant E1a/E2/E3/N3a/E4i 3
  • RE1-Silencing Transcription Factor Variant E1b/E2/E3/N3b/E4i 3
  • RE1-Silencing Transcription Factor Variant E1b/E2c/E2j/E3/E4 3
  • RE1-Silencing Transcription Factor Variant E1a/E2/E3/N3c/E4 3
  • RE1-Silencing Transcription Factor Variant E1b/E2/E3/N3c/E4 3
  • RE1-Silencing Transcription Factor Variant E1a/E2/E3/E4c 3
  • RE1-Silencing Transcription Factor Variant E1c/E2g/E3/E4 3
  • RE1-Silencing Transcription Factor Variant E1a/E2/E3/E5 3
  • RE1-Silencing Transcription Factor Variant E1b/E2/E3/E5 3
  • RE1-Silencing Transcription Factor Variant E1c/E2/E3/E5 3
  • RE1-Silencing Transcription Factor Variant E1a/E2a/E2k 3
  • RE1-Silencing Transcription Factor Variant E1a/E2d/E4g 3
  • RE1-Silencing Transcription Factor Variant E1a/E2e/E4h 3
  • RE1-Silencing Transcription Factor Variant E1a/E2f/E4e 3
  • RE1-Silencing Transcription Factor Variant E1b/E2a/E2k 3
  • RE1-Silencing Transcription Factor Variant E1b/E2e/E4h 3
  • RE1-Silencing Transcription Factor Variant E1c/E2a/E2k 3
  • RE1-Silencing Transcription Factor Variant E1a/E2/E4 3
  • RE1-Silencing Transcription Factor Variant E1a/E2/E5 3
  • Neuron-Restrictive Silencer Factor 2
  • Neuron Restrictive Silencer Factor 3
  • Repressor Binding To The X2 Box 3
  • X2 Box Repressor 4
  • GINGF5 3
  • HGF5 3
  • WT6 3

External Ids for REST Gene

Previous GeneCards Identifiers for REST Gene

  • GC04P057577
  • GC04P057730
  • GC04P057689
  • GC04P057614
  • GC04P057468
  • GC04P053727
  • GC04P057774

Summaries for REST Gene

Entrez Gene Summary for REST Gene

  • This gene encodes a transcriptional repressor that represses neuronal genes in non-neuronal tissues. It is a member of the Kruppel-type zinc finger transcription factor family. It represses transcription by binding a DNA sequence element called the neuron-restrictive silencer element. The protein is also found in undifferentiated neuronal progenitor cells and it is thought that this repressor may act as a master negative regular of neurogenesis. Alternatively spliced transcript variants have been described [provided by RefSeq, Jul 2010]

GeneCards Summary for REST Gene

REST (RE1 Silencing Transcription Factor) is a Protein Coding gene. Diseases associated with REST include Wilms Tumor 6 and Fibromatosis, Gingival, 5. Among its related pathways are Development NOTCH1-mediated pathway for NF-KB activity modulation and Activated PKN1 stimulates transcription of AR (androgen receptor) regulated genes KLK2 and KLK3. Gene Ontology (GO) annotations related to this gene include DNA binding transcription factor activity and transcription factor binding. An important paralog of this gene is ZNF407.

UniProtKB/Swiss-Prot for REST Gene

  • Transcriptional repressor which binds neuron-restrictive silencer element (NRSE) and represses neuronal gene transcription in non-neuronal cells. Restricts the expression of neuronal genes by associating with two distinct corepressors, mSin3 and CoREST, which in turn recruit histone deacetylase to the promoters of REST-regulated genes. Mediates repression by recruiting the BHC complex at RE1/NRSE sites which acts by deacetylating and demethylating specific sites on histones, thereby acting as a chromatin modifier. Transcriptional repression by REST-CDYL via the recruitment of histone methyltransferase EHMT2 may be important in transformation suppression.

Gene Wiki entry for REST Gene

Additional gene information for REST Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for REST Gene

Genomics for REST Gene

GeneHancer (GH) Regulatory Elements for REST Gene

Promoters and enhancers for REST Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH04I056906 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 550.8 +1.1 1094 4.6 PKNOX1 ATF1 ZFP64 ARID4B SIN3A DMAP1 YY1 ZNF121 ZNF766 GLIS2 REST NOA1 POLR2B AASDH SRP72 CEP135 ENSG00000269949 SPINK2 ENSG00000251799 RNU6-998P
GH04I056975 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE 10.6 +71.7 71667 7.5 HDGF PKNOX1 SMAD1 ARNT ZFP64 ARID4B SIN3A FEZF1 DMAP1 ZNF2 NOA1 POLR2B ENSG00000269949 RNU6-998P REST AASDH
GH04I056874 Enhancer 0.8 FANTOM5 ENCODE 13.4 -33.4 -33413 0.3 ZNF362 POLR2A POU5F1 PRDM10 ZNF384 REST SPINK2 ENSG00000251799 NOA1 POLR2B HOPX ENSG00000269949 PPAT GC04P056899
GH04I056799 Enhancer 1 Ensembl ENCODE 9.4 -107.7 -107742 1.5 ATF1 SIN3A IRF4 ZNF48 RAD21 YY1 ZNF335 ZNF143 ATF7 BCLAF1 SPINK2 PAICS PPAT POLR2B NOA1 SRP72 REST ENSG00000269949 GC04P056807 LOC105377668
GH04I056836 Enhancer 0.8 Ensembl ENCODE 10.4 -71.1 -71076 0.4 CTCF ZNF654 TRIM22 REST ATF2 RAD21 ZNF143 HMBOX1 SMC3 RUNX3 SRP72 REST HOPX PAICS PPAT AASDH SPINK2 GC04P056899
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around REST on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the REST gene promoter:

Genomic Locations for REST Gene

Genomic Locations for REST Gene
chr4:56,907,876-56,966,678
(GRCh38/hg38)
Size:
58,803 bases
Orientation:
Plus strand
chr4:57,774,042-57,802,010
(GRCh37/hg19)

Genomic View for REST Gene

Genes around REST on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
REST Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for REST Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for REST Gene

Proteins for REST Gene

  • Protein details for REST Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q13127-REST_HUMAN
    Recommended name:
    RE1-silencing transcription factor
    Protein Accession:
    Q13127
    Secondary Accessions:
    • A2RUE0
    • B9EGJ0
    • Q12956
    • Q12957
    • Q13134
    • Q59ER1
    • Q8IWI3

    Protein attributes for REST Gene

    Size:
    1097 amino acids
    Molecular mass:
    121872 Da
    Quaternary structure:
    • Interacts with SIN3A, SIN3B and RCOR1. Interacts with CDYL. Interacts with EHMT1 and EHMT2 only in the presence of CDYL. Part of a complex containing at least CDYL, REST, WIZ, SETB1, EHMT1 and EHMT2. Interacts (via zinc-finger DNA-binding domain) with ZFP90 (via N- and C-termini); the interaction inhibits REST repressor activity (PubMed:21284946).
    SequenceCaution:
    • Sequence=AAA98503.1; Type=Frameshift; Positions=188, 198, 202, 212, 1087; Evidence={ECO:0000305}; Sequence=AAC50114.1; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305}; Sequence=AAC50115.1; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305}; Sequence=AAH38985.1; Type=Miscellaneous discrepancy; Note=Contaminating sequence. Potential poly-A sequence.; Evidence={ECO:0000305}; Sequence=BAD92987.1; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for REST Gene

    Alternative splice isoforms for REST Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for REST Gene

Post-translational modifications for REST Gene

No Post-translational modifications

No data available for DME Specific Peptides for REST Gene

Domains & Families for REST Gene

Gene Families for REST Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Plasma proteins
  • Predicted intracellular proteins
  • Transcription factors

Protein Domains for REST Gene

Suggested Antigen Peptide Sequences for REST Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with REST: view

No data available for UniProtKB/Swiss-Prot for REST Gene

Function for REST Gene

Molecular function for REST Gene

GENATLAS Biochemistry:
RE1 silencing transcription factor
UniProtKB/Swiss-Prot Function:
Transcriptional repressor which binds neuron-restrictive silencer element (NRSE) and represses neuronal gene transcription in non-neuronal cells. Restricts the expression of neuronal genes by associating with two distinct corepressors, mSin3 and CoREST, which in turn recruit histone deacetylase to the promoters of REST-regulated genes. Mediates repression by recruiting the BHC complex at RE1/NRSE sites which acts by deacetylating and demethylating specific sites on histones, thereby acting as a chromatin modifier. Transcriptional repression by REST-CDYL via the recruitment of histone methyltransferase EHMT2 may be important in transformation suppression.

Phenotypes From GWAS Catalog for REST Gene

Gene Ontology (GO) - Molecular Function for REST Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000981 RNA polymerase II transcription factor activity, sequence-specific DNA binding IEA --
GO:0001046 core promoter sequence-specific DNA binding IDA 8568247
GO:0001047 core promoter binding IDA 17984088
GO:0001078 transcriptional repressor activity, RNA polymerase II proximal promoter sequence-specific DNA binding IDA 10449787
GO:0001228 transcriptional activator activity, RNA polymerase II transcription regulatory region sequence-specific DNA binding IEA --
genes like me logo Genes that share ontologies with REST: view
genes like me logo Genes that share phenotypes with REST: view

Human Phenotype Ontology for REST Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for REST Gene

MGI Knock Outs for REST:

Animal Model Products

miRNA for REST Gene

miRTarBase miRNAs that target REST
Targeted motifs for REST Gene
HOMER Transcription Factor Regulatory Elements motif REST
  • Consensus sequence: GGAGCTGTCCATGGTGCTGA Submotif: canonical Cell Type: Jurkat

Clone Products

  • Addgene plasmids for REST

No data available for Enzyme Numbers (IUBMB) and Transcription Factor Targets for REST Gene

Localization for REST Gene

Subcellular locations from UniProtKB/Swiss-Prot for REST Gene

Nucleus. Note=Colocalizes with ZFP90 in the nucleus. {ECO:0000250 UniProtKB:Q8VIG1}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for REST gene
Compartment Confidence
nucleus 5
cytosol 4
cytoskeleton 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (2)
  • Nucleoplasm (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for REST Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus NAS,IEA 7871435
GO:0005654 nucleoplasm TAS --
GO:0005829 cytosol IEA --
GO:0017053 transcriptional repressor complex IDA 10734093
genes like me logo Genes that share ontologies with REST: view

Pathways & Interactions for REST Gene

genes like me logo Genes that share pathways with REST: view

Gene Ontology (GO) - Biological Process for REST Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000122 negative regulation of transcription by RNA polymerase II TAS 7697725
GO:0002244 hematopoietic progenitor cell differentiation IEA --
GO:0006351 transcription, DNA-templated IEA --
GO:0006355 regulation of transcription, DNA-templated NAS 7871435
GO:0006357 regulation of transcription by RNA polymerase II IEA --
genes like me logo Genes that share ontologies with REST: view

No data available for SIGNOR curated interactions for REST Gene

Drugs & Compounds for REST Gene

(6) Drugs for REST Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials

(2) Additional Compounds for REST Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with REST: view

Transcripts for REST Gene

Unigene Clusters for REST Gene

RE1-silencing transcription factor:
Representative Sequences:

Clone Products

  • Addgene plasmids for REST

Alternative Splicing Database (ASD) splice patterns (SP) for REST Gene

ExUns: 1 ^ 2 ^ 3a · 3b ^ 4 ^ 5 ^ 6a · 6b
SP1: - -
SP2: -
SP3:

Relevant External Links for REST Gene

GeneLoc Exon Structure for
REST
ECgene alternative splicing isoforms for
REST

Expression for REST Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for REST Gene

Protein differential expression in normal tissues from HIPED for REST Gene

This gene is overexpressed in Serum (68.6).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for REST Gene



Protein tissue co-expression partners for REST Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of REST Gene:

REST

SOURCE GeneReport for Unigene cluster for REST Gene:

Hs.307836

mRNA Expression by UniProt/SwissProt for REST Gene:

Q13127-REST_HUMAN
Tissue specificity: Ubiquitous. Expressed at higher levels in the tissues of the lymphocytic compartment, including spleen, thymus, peripheral blood lymphocytes and ovary.

Evidence on tissue expression from TISSUES for REST Gene

  • Nervous system(4.6)
genes like me logo Genes that share expression patterns with REST: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues and Phenotype-based relationships between genes and organs from Gene ORGANizer for REST Gene

Orthologs for REST Gene

This gene was present in the common ancestor of animals.

Orthologs for REST Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia REST 33 34
  • 99.21 (n)
dog
(Canis familiaris)
Mammalia REST 33 34
  • 85.9 (n)
cow
(Bos Taurus)
Mammalia REST 33
  • 85.15 (n)
-- 34
  • 75 (a)
OneToMany
MGC157163 34
  • 74 (a)
OneToMany
rat
(Rattus norvegicus)
Mammalia Rest 33
  • 74.22 (n)
mouse
(Mus musculus)
Mammalia Rest 33 16 34
  • 73.08 (n)
oppossum
(Monodelphis domestica)
Mammalia REST 34
  • 70 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia REST 34
  • 48 (a)
OneToOne
chicken
(Gallus gallus)
Aves REST 33 34
  • 71.01 (n)
lizard
(Anolis carolinensis)
Reptilia REST 34
  • 48 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia Str.10667 33
African clawed frog
(Xenopus laevis)
Amphibia rest-A 33
zebrafish
(Danio rerio)
Actinopterygii rest 34
  • 37 (a)
OneToOne
fruit fly
(Drosophila melanogaster)
Insecta CG31612 34
  • 9 (a)
OneToMany
sea squirt
(Ciona savignyi)
Ascidiacea CSA.1932 34
  • 20 (a)
OneToOne
Species where no ortholog for REST was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for REST Gene

ENSEMBL:
Gene Tree for REST (if available)
TreeFam:
Gene Tree for REST (if available)

Paralogs for REST Gene

Paralogs for REST Gene

Pseudogenes.org Pseudogenes for REST Gene

genes like me logo Genes that share paralogs with REST: view

Variants for REST Gene

Sequence variations from dbSNP and Humsavar for REST Gene

SNP ID Clin Chr 04 pos Variation AA Info Type
rs869025310 risk-factor, Wilms tumor 6 56,911,469(+) AT/ coding_sequence_variant, frameshift
rs869025311 risk-factor, Wilms tumor 6 56,911,409(+) AGTGAG/AG coding_sequence_variant, frameshift
rs869025312 risk-factor, Wilms tumor 6, Wilms tumor 6 (WT6) [MIM:616806] 56,919,853(+) A/G coding_sequence_variant, intron_variant, missense_variant
VAR_076333 Wilms tumor 6 (WT6) [MIM:616806] p.Arg160Pro
VAR_076334 Wilms tumor 6 (WT6) [MIM:616806] p.Asn290Tyr

Structural Variations from Database of Genomic Variants (DGV) for REST Gene

Variant ID Type Subtype PubMed ID
dgv5214n100 CNV gain 25217958
esv22393 CNV loss 19812545
esv2663344 CNV deletion 23128226
nsv1074717 CNV deletion 25765185
nsv1114531 CNV deletion 24896259
nsv594205 CNV gain 21841781
nsv594206 CNV loss 21841781
nsv822562 CNV gain 20364138
nsv967748 CNV duplication 23825009

Variation tolerance for REST Gene

Residual Variation Intolerance Score: 72.7% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 5.14; 69.36% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for REST Gene

Human Gene Mutation Database (HGMD)
REST
SNPedia medical, phenotypic, and genealogical associations of SNPs for
REST

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for REST Gene

Disorders for REST Gene

MalaCards: The human disease database

(8) MalaCards diseases for REST Gene - From: HGMD, OMIM, ClinVar, Orphanet, Swiss-Prot, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
wilms tumor 6
  • wt6
fibromatosis, gingival, 5
  • gingf5
gingival fibromatosis
  • hereditary gingival fibromatosis
fibromatosis
wilms tumor 1
  • wt1
- elite association - COSMIC cancer census association via MalaCards
Search REST in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

REST_HUMAN
  • Fibromatosis, gingival, 5 (GINGF5) [MIM:617626]: An autosomal dominant form of hereditary gingival fibromatosis, a rare condition characterized by a slow, progressive overgrowth of the gingiva. The excess gingival tissue can cover part of or the entire crown, and can result in diastemas, teeth displacement, or retention of primary or impacted teeth. {ECO:0000269 PubMed:28686854}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Wilms tumor 6 (WT6) [MIM:616806]: A pediatric malignancy of kidney, and the most common childhood abdominal malignancy. It is caused by the uncontrolled multiplication of renal stem, stromal, and epithelial cells. {ECO:0000269 PubMed:26551668}. Note=Disease susceptibility is associated with variations affecting the gene represented in this entry.

Additional Disease Information for REST

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with REST: view

No data available for Genatlas for REST Gene

Publications for REST Gene

  1. The neuron-restrictive silencer factor (NRSF): a coordinate repressor of multiple neuron-specific genes. (PMID: 7871435) Schoenherr CJ … Anderson DJ (Science (New York, N.Y.) 1995) 2 3 4 22 58
  2. Additive effect of BDNF and REST polymorphisms is associated with improved general cognitive ability. (PMID: 18518926) Miyajima F … Payton A (Genes, brain, and behavior 2008) 3 22 44 58
  3. The neural repressor NRSF/REST binds the PAH1 domain of the Sin3 corepressor by using its distinct short hydrophobic helix. (PMID: 16288918) Nomura M … Nishimura Y (Journal of molecular biology 2005) 3 4 22 58
  4. Neuron-specific splicing of zinc finger transcription factor REST/NRSF/XBR is frequent in neuroblastomas and conserved in human, mouse and rat. (PMID: 10521596) Palm K … Timmusk T (Brain research. Molecular brain research 1999) 3 4 22 58
  5. REST: a mammalian silencer protein that restricts sodium channel gene expression to neurons. (PMID: 7697725) Chong JA … Mandel G (Cell 1995) 2 3 4 58

Products for REST Gene

Sources for REST Gene

Content
Loading form....