Free for academic non-profit institutions. Other users need a Commercial license

Aliases for REST Gene

Aliases for REST Gene

  • RE1-Silencing Transcription Factor 2 3
  • Neural-Restrictive Silencer Factor 3 4
  • NRSF 3 4
  • XBR 3 4
  • RE1-Silencing Transcription Factor Variant E1a/E2k/E2i/E3/E4j 3
  • RE1-Silencing Transcription Factor Variant E1a/E2/E3/N3a/E4i 3
  • RE1-Silencing Transcription Factor Variant E1b/E2/E3/N3b/E4i 3
  • RE1-Silencing Transcription Factor Variant E1b/E2c/E2j/E3/E4 3
  • RE1-Silencing Transcription Factor Variant E1a/E2/E3/N3c/E4 3
  • RE1-Silencing Transcription Factor Variant E1b/E2/E3/N3c/E4 3
  • RE1-Silencing Transcription Factor Variant E1a/E2/E3/E4c 3
  • RE1-Silencing Transcription Factor Variant E1c/E2g/E3/E4 3
  • RE1-Silencing Transcription Factor Variant E1a/E2/E3/E5 3
  • RE1-Silencing Transcription Factor Variant E1b/E2/E3/E5 3
  • RE1-Silencing Transcription Factor Variant E1c/E2/E3/E5 3
  • RE1-Silencing Transcription Factor Variant E1a/E2a/E2k 3
  • RE1-Silencing Transcription Factor Variant E1a/E2d/E4g 3
  • RE1-Silencing Transcription Factor Variant E1a/E2e/E4h 3
  • RE1-Silencing Transcription Factor Variant E1a/E2f/E4e 3
  • RE1-Silencing Transcription Factor Variant E1b/E2a/E2k 3
  • RE1-Silencing Transcription Factor Variant E1b/E2e/E4h 3
  • RE1-Silencing Transcription Factor Variant E1c/E2a/E2k 3
  • RE1-Silencing Transcription Factor Variant E1a/E2/E4 3
  • RE1-Silencing Transcription Factor Variant E1a/E2/E5 3
  • Neuron Restrictive Silencer Factor 3
  • Repressor Binding To The X2 Box 3
  • X2 Box Repressor 4

External Ids for REST Gene

Previous GeneCards Identifiers for REST Gene

  • GC04P057577
  • GC04P057730
  • GC04P057689
  • GC04P057614
  • GC04P057468
  • GC04P053727
  • GC04P057774

Summaries for REST Gene

Entrez Gene Summary for REST Gene

  • This gene encodes a transcriptional repressor that represses neuronal genes in non-neuronal tissues. It is a member of the Kruppel-type zinc finger transcription factor family. It represses transcription by binding a DNA sequence element called the neuron-restrictive silencer element. The protein is also found in undifferentiated neuronal progenitor cells and it is thought that this repressor may act as a master negative regular of neurogenesis. Alternatively spliced transcript variants have been described [provided by RefSeq, Jul 2010]

GeneCards Summary for REST Gene

REST (RE1-Silencing Transcription Factor) is a Protein Coding gene. Diseases associated with REST include medulloblastoma. Among its related pathways are Signaling pathways regulating pluripotency of stem cells and RNA Polymerase I Promoter Opening. GO annotations related to this gene include transcription factor activity, sequence-specific DNA binding and transcription factor binding. An important paralog of this gene is ZNF407.

UniProtKB/Swiss-Prot for REST Gene

  • Transcriptional repressor which binds neuron-restrictive silencer element (NRSE) and represses neuronal gene transcription in non-neuronal cells. Restricts the expression of neuronal genes by associating with two distinct corepressors, mSin3 and CoREST, which in turn recruit histone deacetylase to the promoters of REST-regulated genes. Mediates repression by recruiting the BHC complex at RE1/NRSE sites which acts by deacetylating and demethylating specific sites on histones, thereby acting as a chromatin modifier. Transcriptional repression by REST-CDYL via the recruitment of histone methyltransferase EHMT2 may be important in transformation suppression.

Gene Wiki entry for REST Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for REST Gene

Genomics for REST Gene

Regulatory Elements for REST Gene

Epigenetics Products

  • DNA Methylation CpG Assay Predesigned for Pyrosequencing in human,mouse,rat

Genomic Location for REST Gene

Chromosome:
4
Start:
56,907,876 bp from pter
End:
56,935,845 bp from pter
Size:
27,970 bases
Orientation:
Plus strand

Genomic View for REST Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for REST Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for REST Gene

Proteins for REST Gene

  • Protein details for REST Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q13127-REST_HUMAN
    Recommended name:
    RE1-silencing transcription factor
    Protein Accession:
    Q13127
    Secondary Accessions:
    • A2RUE0
    • B9EGJ0
    • Q12956
    • Q12957
    • Q13134
    • Q59ER1
    • Q8IWI3

    Protein attributes for REST Gene

    Size:
    1097 amino acids
    Molecular mass:
    121872 Da
    Quaternary structure:
    • Interacts with SIN3A, SIN3B and RCOR1. Interacts with CDYL. Interacts with EHMT1 and EHMT2 only in the presence of CDYL. Part of a complex containing at least CDYL, REST, WIZ, SETB1, EHMT1 and EHMT2.
    SequenceCaution:
    • Sequence=AAA98503.1; Type=Frameshift; Positions=188, 198, 202, 212, 1087; Evidence={ECO:0000305}; Sequence=AAC50114.1; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305}; Sequence=AAC50115.1; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305}; Sequence=AAH38985.1; Type=Miscellaneous discrepancy; Note=Contaminating sequence. Potential poly-A sequence.; Evidence={ECO:0000305}; Sequence=BAD92987.1; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for REST Gene

    Alternative splice isoforms for REST Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for REST Gene

Proteomics data for REST Gene at MOPED

Post-translational modifications for REST Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for REST Gene

No data available for DME Specific Peptides for REST Gene

Domains & Families for REST Gene

Protein Domains for REST Gene

Suggested Antigen Peptide Sequences for REST Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q13127

UniProtKB/Swiss-Prot:

REST_HUMAN :
  • Contains 9 C2H2-type zinc fingers.
Similarity:
  • Contains 9 C2H2-type zinc fingers.
genes like me logo Genes that share domains with REST: view

No data available for Gene Families for REST Gene

Function for REST Gene

Molecular function for REST Gene

GENATLAS Biochemistry:
RE1 silencing transcription factor
UniProtKB/Swiss-Prot Function:
Transcriptional repressor which binds neuron-restrictive silencer element (NRSE) and represses neuronal gene transcription in non-neuronal cells. Restricts the expression of neuronal genes by associating with two distinct corepressors, mSin3 and CoREST, which in turn recruit histone deacetylase to the promoters of REST-regulated genes. Mediates repression by recruiting the BHC complex at RE1/NRSE sites which acts by deacetylating and demethylating specific sites on histones, thereby acting as a chromatin modifier. Transcriptional repression by REST-CDYL via the recruitment of histone methyltransferase EHMT2 may be important in transformation suppression.

Gene Ontology (GO) - Molecular Function for REST Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000981 RNA polymerase II transcription factor activity, sequence-specific DNA binding --
GO:0001046 core promoter sequence-specific DNA binding IDA 8568247
GO:0001047 core promoter binding IDA 17984088
GO:0001078 transcriptional repressor activity, RNA polymerase II core promoter proximal region sequence-specific binding IDA 10449787
GO:0001228 transcriptional activator activity, RNA polymerase II transcription regulatory region sequence-specific binding IEA --
genes like me logo Genes that share ontologies with REST: view
genes like me logo Genes that share phenotypes with REST: view

Animal Models for REST Gene

MGI Knock Outs for REST:

Animal Model Products

miRNA for REST Gene

miRTarBase miRNAs that target REST
Targeted motifs for REST Gene
HOMER Transcription Factor Regulatory Elements motif REST
  • Consensus sequence: GGAGCTGTCCATGGTGCTGA Submotif: canonical Cell Type: Jurkat

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for REST

In Situ Assay Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) and Transcription Factor Targets for REST Gene

Localization for REST Gene

Subcellular locations from UniProtKB/Swiss-Prot for REST Gene

Subcellular locations from

COMPARTMENTS
Jensen Localization Image for REST Gene COMPARTMENTS Subcellular localization image for REST gene
Compartment Confidence
nucleus 5
cytosol 2
cytoskeleton 1

Gene Ontology (GO) - Cellular Components for REST Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus NAS 7871435
GO:0005654 nucleoplasm TAS --
GO:0005829 cytosol IEA --
GO:0017053 transcriptional repressor complex IDA 10734093
genes like me logo Genes that share ontologies with REST: view

Pathways & Interactions for REST Gene

genes like me logo Genes that share pathways with REST: view

Pathways by source for REST Gene

PCR Array Products

  • Pathway & Disease-focused RT² Profiler PCR Arrays

Gene Ontology (GO) - Biological Process for REST Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000122 negative regulation of transcription from RNA polymerase II promoter TAS 7697725
GO:0002244 hematopoietic progenitor cell differentiation IEA --
GO:0006325 chromatin organization TAS --
GO:0006351 transcription, DNA-templated --
GO:0006355 regulation of transcription, DNA-templated NAS 7871435
genes like me logo Genes that share ontologies with REST: view

No data available for SIGNOR curated interactions for REST Gene

Drugs & Compounds for REST Gene

(6) Drugs for REST Gene - From: NovoSeek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Zinc Approved Pharma 1404
kainate Pharma Full agonist, Agonist 0
NMDA Pharma Full agonist, Agonist 0
arginine Nutra 346
Calcium Nutra 0

(2) Additional Compounds for REST Gene - From: NovoSeek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
glutamate
sodium
  • Sodium
  • Sodium ion
7440-23-5
genes like me logo Genes that share compounds with REST: view

Transcripts for REST Gene

Unigene Clusters for REST Gene

RE1-silencing transcription factor:
Representative Sequences:

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for REST

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for REST Gene

ExUns: 1 ^ 2 ^ 3a · 3b ^ 4 ^ 5 ^ 6a · 6b
SP1: - -
SP2: -
SP3:

Relevant External Links for REST Gene

GeneLoc Exon Structure for
REST
ECgene alternative splicing isoforms for
REST

Expression for REST Gene

mRNA expression in normal human tissues for REST Gene

Protein differential expression in normal tissues from HIPED for REST Gene

This gene is overexpressed in Serum (68.6).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MOPED, and MaxQB for REST Gene



SOURCE GeneReport for Unigene cluster for REST Gene Hs.307836

mRNA Expression by UniProt/SwissProt for REST Gene

Q13127-REST_HUMAN
Tissue specificity: Ubiquitous. Expressed at higher levels in the tissues of the lymphocytic compartment, including spleen, thymus, peripheral blood lymphocytes and ovary.
genes like me logo Genes that share expression patterns with REST: view

Protein tissue co-expression partners for REST Gene

- Elite partner

Primer Products

In Situ Assay Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery and mRNA differential expression in normal tissues for REST Gene

Orthologs for REST Gene

This gene was present in the common ancestor of animals.

Orthologs for REST Gene

Organism Taxonomy Gene Similarity Type Details
cow
(Bos Taurus)
Mammalia REST 35
  • 85.15 (n)
  • 80.86 (a)
-- 36
  • 75 (a)
OneToMany
MGC157163 36
  • 74 (a)
OneToMany
dog
(Canis familiaris)
Mammalia REST 35
  • 85.9 (n)
  • 83.61 (a)
REST 36
  • 85 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Rest 35
  • 73.08 (n)
  • 67.98 (a)
Rest 16
Rest 36
  • 62 (a)
OneToOne
chimpanzee
(Pan troglodytes)
Mammalia REST 35
  • 99.21 (n)
  • 98.45 (a)
REST 36
  • 98 (a)
OneToOne
rat
(Rattus norvegicus)
Mammalia Rest 35
  • 74.22 (n)
  • 69.67 (a)
oppossum
(Monodelphis domestica)
Mammalia REST 36
  • 70 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia REST 36
  • 48 (a)
OneToOne
chicken
(Gallus gallus)
Aves REST 35
  • 71.01 (n)
  • 71.89 (a)
REST 36
  • 56 (a)
OneToOne
lizard
(Anolis carolinensis)
Reptilia REST 36
  • 48 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia Str.10667 35
African clawed frog
(Xenopus laevis)
Amphibia rest-A 35
zebrafish
(Danio rerio)
Actinopterygii rest 36
  • 37 (a)
OneToOne
fruit fly
(Drosophila melanogaster)
Insecta CG31612 36
  • 9 (a)
OneToMany
sea squirt
(Ciona savignyi)
Ascidiacea CSA.1932 36
  • 20 (a)
OneToOne
Species with no ortholog for REST:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for REST Gene

ENSEMBL:
Gene Tree for REST (if available)
TreeFam:
Gene Tree for REST (if available)

Paralogs for REST Gene

Paralogs for REST Gene

Pseudogenes.org Pseudogenes for REST Gene

genes like me logo Genes that share paralogs with REST: view

Variants for REST Gene

Sequence variations from dbSNP and Humsavar for REST Gene

SNP ID Clin Chr 04 pos Sequence Context AA Info Type MAF
VAR_029795 -
VAR_029796 -
VAR_029797 -
VAR_029798 -

Structural Variations from Database of Genomic Variants (DGV) for REST Gene

Variant ID Type Subtype PubMed ID
nsv822562 CNV Gain 20364138
esv22393 CNV Loss 19812545
esv2663344 CNV Deletion 23128226

Variation tolerance for REST Gene

Residual Variation Intolerance Score: 72.66% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 5.14; 69.36% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for REST Gene

HapMap Linkage Disequilibrium report
REST
Human Gene Mutation Database (HGMD)
REST

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for REST Gene

Disorders for REST Gene

MalaCards: The human disease database

(1) MalaCards diseases for REST Gene - From: DISEASES, NovoSeek, and GeneCards

Disorder Aliases PubMed IDs
medulloblastoma
  • medulloblastoma, desmoplastic
- elite association
Search REST in MalaCards View complete list of genes associated with diseases

Relevant External Links for REST

Genetic Association Database (GAD)
REST
Human Genome Epidemiology (HuGE) Navigator
REST
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
REST
genes like me logo Genes that share disorders with REST: view

No data available for UniProtKB/Swiss-Prot and Genatlas for REST Gene

Publications for REST Gene

  1. The neuron-restrictive silencer factor (NRSF): a coordinate repressor of multiple neuron-specific genes. (PMID: 7871435) Schoenherr C.J. … Anderson D.J. (Science 1995) 2 23 67
  2. Epigenetic gene silencing underlies C-fiber dysfunctions in neuropathic pain. (PMID: 20357131) Uchida H. … Ueda H. (J. Neurosci. 2010) 23 67
  3. Aberrant REST-mediated transcriptional regulation in major depressive disorder. (PMID: 19846118) Otsuki K. … Watanabe Y. (J Psychiatr Res 2010) 23 67
  4. Estrogen coordinates translation and transcription, revealing a role for NRSF in human breast cancer cells. (PMID: 20392875) Bronson M.W. … Brodsky A.S. (Mol. Endocrinol. 2010) 23 67
  5. Neuron-restrictive silencer factor causes epigenetic silencing of Kv4.3 gene after peripheral nerve injury. (PMID: 20006971) Uchida H. … Ueda H. (Neuroscience 2010) 23 67

Products for REST Gene

Sources for REST Gene

Back to Top

Content