Free for academic non-profit institutions. Other users need a Commercial license

Aliases for REST Gene

Aliases for REST Gene

  • RE1-Silencing Transcription Factor 2 3
  • NRSF 3 4 6
  • Neural-Restrictive Silencer Factor 3 4
  • XBR 3 4
  • RE1-Silencing Transcription Factor Variant E1a/E2k/E2i/E3/E4j 3
  • RE1-Silencing Transcription Factor Variant E1a/E2/E3/N3a/E4i 3
  • RE1-Silencing Transcription Factor Variant E1b/E2/E3/N3b/E4i 3
  • RE1-Silencing Transcription Factor Variant E1b/E2c/E2j/E3/E4 3
  • RE1-Silencing Transcription Factor Variant E1a/E2/E3/N3c/E4 3
  • RE1-Silencing Transcription Factor Variant E1b/E2/E3/N3c/E4 3
  • RE1-Silencing Transcription Factor Variant E1a/E2/E3/E4c 3
  • RE1-Silencing Transcription Factor Variant E1c/E2g/E3/E4 3
  • RE1-Silencing Transcription Factor Variant E1a/E2/E3/E5 3
  • RE1-Silencing Transcription Factor Variant E1b/E2/E3/E5 3
  • RE1-Silencing Transcription Factor Variant E1c/E2/E3/E5 3
  • RE1-Silencing Transcription Factor Variant E1a/E2/E4 3
  • Neuron Restrictive Silencer Factor 3
  • Repressor Binding To The X2 Box 3
  • X2 Box Repressor 4

External Ids for REST Gene

Summaries for REST Gene

Entrez Gene Summary for REST Gene

  • This gene encodes a transcriptional repressor that represses neuronal genes in non-neuronal tissues. It is a member of the Kruppel-type zinc finger transcription factor family. It represses transcription by binding a DNA sequence element called the neuron-restrictive silencer element. The protein is also found in undifferentiated neuronal progenitor cells and it is thought that this repressor may act as a master negative regular of neurogenesis. Alternatively spliced transcript variants have been described [provided by RefSeq, Jul 2010]

GeneCards Summary for REST Gene

REST (RE1-Silencing Transcription Factor) is a Protein Coding gene. Among its related pathways are Development NOTCH1-mediated pathway for NF-KB activity modulation and SIDS Susceptibility Pathways. GO annotations related to this gene include sequence-specific DNA binding transcription factor activity and transcription factor binding. An important paralog of this gene is ZNF407.

UniProtKB/Swiss-Prot for REST Gene

  • Transcriptional repressor which binds neuron-restrictive silencer element (NRSE) and represses neuronal gene transcription in non-neuronal cells. Restricts the expression of neuronal genes by associating with two distinct corepressors, mSin3 and CoREST, which in turn recruit histone deacetylase to the promoters of REST-regulated genes. Mediates repression by recruiting the BHC complex at RE1/NRSE sites which acts by deacetylating and demethylating specific sites on histones, thereby acting as a chromatin modifier. Transcriptional repression by REST-CDYL via the recruitment of histone methyltransferase EHMT2 may be important in transformation suppression.

Gene Wiki entry for REST Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for REST Gene

Genomics for REST Gene

Genomic Location for REST Gene

Start:
56,907,876 bp from pter
End:
56,935,844 bp from pter
Size:
27,969 bases
Orientation:
Plus strand

Genomic View for REST Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for REST Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for REST Gene

Regulatory Elements for REST Gene

Proteins for REST Gene

  • Protein details for REST Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q13127-REST_HUMAN
    Recommended name:
    RE1-silencing transcription factor
    Protein Accession:
    Q13127
    Secondary Accessions:
    • A2RUE0
    • B9EGJ0
    • Q12956
    • Q12957
    • Q13134
    • Q59ER1
    • Q8IWI3

    Protein attributes for REST Gene

    Size:
    1097 amino acids
    Molecular mass:
    121872 Da
    Quaternary structure:
    • Interacts with SIN3A, SIN3B and RCOR1. Interacts with CDYL. Interacts with EHMT1 and EHMT2 only in the presence of CDYL. Part of a complex containing at least CDYL, REST, WIZ, SETB1, EHMT1 and EHMT2.
    SequenceCaution:
    • Sequence=AAA98503.1; Type=Frameshift; Positions=188, 198, 202, 212, 1087; Evidence={ECO:0000305}; Sequence=AAC50114.1; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305}; Sequence=AAC50115.1; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305}; Sequence=AAH38985.1; Type=Miscellaneous discrepancy; Note=Contaminating sequence. Potential poly-A sequence.; Evidence={ECO:0000305}; Sequence=BAD92987.1; Type=Erroneous initiation; Note=Translation N-terminally shortened.; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for REST Gene

    Alternative splice isoforms for REST Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for REST Gene

Proteomics data for REST Gene at MOPED

Post-translational modifications for REST Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for REST Gene

No data available for DME Specific Peptides for REST Gene

Domains for REST Gene

Protein Domains for REST Gene

UniProtKB/Swiss-Prot:

REST_HUMAN
Similarity:
  • Contains 9 C2H2-type zinc fingers.:
    • Q13127
genes like me logo Genes that share domains with REST: view

No data available for Gene Families for REST Gene

Function for REST Gene

Molecular function for REST Gene

GENATLAS Biochemistry: RE1 silencing transcription factor
UniProtKB/Swiss-Prot Function: Transcriptional repressor which binds neuron-restrictive silencer element (NRSE) and represses neuronal gene transcription in non-neuronal cells. Restricts the expression of neuronal genes by associating with two distinct corepressors, mSin3 and CoREST, which in turn recruit histone deacetylase to the promoters of REST-regulated genes. Mediates repression by recruiting the BHC complex at RE1/NRSE sites which acts by deacetylating and demethylating specific sites on histones, thereby acting as a chromatin modifier. Transcriptional repression by REST-CDYL via the recruitment of histone methyltransferase EHMT2 may be important in transformation suppression.

Gene Ontology (GO) - Molecular Function for REST Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001046 core promoter sequence-specific DNA binding IDA 8568247
GO:0001047 core promoter binding IDA 17984088
GO:0001078 RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription IDA 10449787
GO:0003677 DNA binding --
GO:0003682 chromatin binding ISS --
genes like me logo Genes that share ontologies with REST: view
genes like me logo Genes that share phenotypes with REST: view

Animal Models for REST Gene

MGI Knock Outs for REST:

miRNA for REST Gene

miRTarBase miRNAs that target REST
Targeting motifs for REST Gene
HOMER Transcription Factor Regulatory Elements motif REST
  • Consensus sequence: GGAGCTGTCCATGGTGCTGA Submotif: canonical Cell Type: Jurkat

No data available for Enzyme Numbers (IUBMB) and Transcription Factor Targeting for REST Gene

Localization for REST Gene

Subcellular locations from UniProtKB/Swiss-Prot for REST Gene

Subcellular locations from

COMPARTMENTS
Jensen Localization Image for REST Gene COMPARTMENTS Subcellular localization image for REST gene
Compartment Confidence
nucleus 5
cytosol 3

Gene Ontology (GO) - Cellular Components for REST Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus NAS 7871435
GO:0005654 nucleoplasm TAS --
GO:0005829 cytosol IEA --
GO:0017053 transcriptional repressor complex IDA 10734093
genes like me logo Genes that share ontologies with REST: view

Pathways for REST Gene

genes like me logo Genes that share pathways with REST: view

Pathways by source for REST Gene

2 GeneGo (Thomson Reuters Life Sciences Research) pathways for REST Gene
1 BioSystems pathway for REST Gene
1 KEGG pathway for REST Gene

Gene Ontology (GO) - Biological Process for REST Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000122 negative regulation of transcription from RNA polymerase II promoter TAS 7697725
GO:0002244 hematopoietic progenitor cell differentiation IEA --
GO:0006325 chromatin organization TAS --
GO:0006355 regulation of transcription, DNA-templated NAS 7871435
GO:0006366 transcription from RNA polymerase II promoter IEA --
genes like me logo Genes that share ontologies with REST: view

Compounds for REST Gene

(8) Novoseek inferred chemical compound relationships for REST Gene

Compound -log(P) Hits PubMed IDs
zinc 40 8
nmda 6.51 3
kainate 6.39 4
sodium 0 1
calcium 0 1
genes like me logo Genes that share compounds with REST: view

Transcripts for REST Gene

Unigene Clusters for REST Gene

RE1-silencing transcription factor:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for REST Gene

ExUns: 1 ^ 2 ^ 3a · 3b ^ 4 ^ 5 ^ 6a · 6b
SP1: - -
SP2: -
SP3:

Relevant External Links for REST Gene

GeneLoc Exon Structure for
REST
ECgene alternative splicing isoforms for
REST

Expression for REST Gene

mRNA expression in normal human tissues for REST Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Integrated Proteomics: protein expression from ProteomicsDB, PaxDb, MOPED, and MaxQB for REST Gene

SOURCE GeneReport for Unigene cluster for REST Gene Hs.307836

mRNA Expression by UniProt/SwissProt for REST Gene

Q13127-REST_HUMAN
Tissue specificity: Ubiquitous. Expressed at higher levels in the tissues of the lymphocytic compartment, including spleen, thymus, peripheral blood lymphocytes and ovary.
genes like me logo Genes that share expressions with REST: view

Orthologs for REST Gene

This gene was present in the common ancestor of animals.

Orthologs for REST Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia REST 36
  • 99.21 (n)
  • 98.45 (a)
REST 37
  • 98 (a)
OneToOne
cow
(Bos Taurus)
Mammalia -- 37
  • 75 (a)
OneToMany
MGC157163 37
  • 74 (a)
OneToMany
REST 36
  • 85.15 (n)
  • 80.86 (a)
dog
(Canis familiaris)
Mammalia REST 36
  • 85.9 (n)
  • 83.61 (a)
REST 37
  • 85 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Rest 36
  • 73.08 (n)
  • 67.98 (a)
Rest 16
Rest 37
  • 62 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia REST 37
  • 70 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia REST 37
  • 48 (a)
OneToOne
rat
(Rattus norvegicus)
Mammalia Rest 36
  • 74.22 (n)
  • 69.67 (a)
chicken
(Gallus gallus)
Aves REST 36
  • 71.01 (n)
  • 71.89 (a)
REST 37
  • 56 (a)
OneToOne
lizard
(Anolis carolinensis)
Reptilia REST 37
  • 48 (a)
OneToOne
African clawed frog
(Xenopus laevis)
Amphibia rest-A 36
tropical clawed frog
(Silurana tropicalis)
Amphibia Str.10667 36
zebrafish
(Danio rerio)
Actinopterygii rest 37
  • 37 (a)
OneToOne
fruit fly
(Drosophila melanogaster)
Insecta CG31612 37
  • 9 (a)
OneToMany
sea squirt
(Ciona savignyi)
Ascidiacea CSA.1932 37
  • 20 (a)
OneToOne
Species with no ortholog for REST:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for REST Gene

ENSEMBL:
Gene Tree for REST (if available)
TreeFam:
Gene Tree for REST (if available)

Paralogs for REST Gene

Paralogs for REST Gene

Pseudogenes.org Pseudogenes for REST Gene

genes like me logo Genes that share paralogs with REST: view

Variants for REST Gene

Sequence variations from dbSNP and Humsavar for REST Gene

SNP ID Clin Chr 04 pos Sequence Context AA Info Type MAF
rs3000 -- 56,911,779(+) GAGAT(C/T)TTACC intron-variant
rs9055 -- 56,935,539(+) CAACA(A/G)TGTTT utr-variant-3-prime
rs781654 -- 56,908,010(+) GCTGC(C/G)GCAGC upstream-variant-2KB, utr-variant-5-prime
rs781655 -- 56,908,285(+) CGGGA(C/G)GGGGA upstream-variant-2KB, intron-variant
rs781656 -- 56,912,479(-) ctact(C/T)gggag intron-variant

Structural Variations from Database of Genomic Variants (DGV) for REST Gene

Variant ID Type Subtype PubMed ID
nsv822562 CNV Gain 20364138
esv22393 CNV Loss 19812545
esv2663344 CNV Deletion 23128226

Relevant External Links for REST Gene

HapMap Linkage Disequilibrium report
REST
Human Gene Mutation Database (HGMD)
REST

Disorders for REST Gene

(1) University of Copenhagen DISEASES for REST Gene

(7) Novoseek inferred disease relationships for REST Gene

Disease -log(P) Hits PubMed IDs
medulloblastoma 32.3 3
small cell lung cancer 28.2 4
pheochromocytoma 18.4 1
glioma 4.8 4
down syndrome 0 2

Relevant External Links for REST

Genetic Association Database (GAD)
REST
Human Genome Epidemiology (HuGE) Navigator
REST
genes like me logo Genes that share disorders with REST: view

No data available for UniProtKB/Swiss-Prot for REST Gene

Publications for REST Gene

  1. The neuron-restrictive silencer factor (NRSF): a coordinate repressor of multiple neuron-specific genes. (PMID: 7871435) Schoenherr C.J. … Anderson D.J. (Science 1995) 2 3 4 23
  2. Neuron-specific splicing of zinc finger transcription factor REST/NRSF/XBR is frequent in neuroblastomas and conserved in human, mouse and rat. (PMID: 10521596) Palm K. … Timmusk T. (Brain Res. Mol. Brain Res. 1999) 3 4 23
  3. The neural repressor NRSF/REST binds the PAH1 domain of the Sin3 corepressor by using its distinct short hydrophobic helix. (PMID: 16288918) Nomura M. … Nishimura Y. (J. Mol. Biol. 2005) 3 4 23
  4. Additive effect of BDNF and REST polymorphisms is associated with improved general cognitive ability. (PMID: 18518926) Miyajima F. … Payton A. (Genes Brain Behav. 2008) 3 23 49
  5. REST: a mammalian silencer protein that restricts sodium channel gene expression to neurons. (PMID: 7697725) Chong J.A. … Mandel G. (Cell 1995) 2 3 4

Products for REST Gene

  • Addgene plasmids for REST

Sources for REST Gene

Back to Top

Content