Free for academic non-profit institutions. Other users need a Commercial license

Aliases for RERE Gene

Aliases for RERE Gene

  • Arginine-Glutamic Acid Dipeptide Repeats 2 3 5
  • Arginine-Glutamic Acid Dipeptide (RE) Repeats 2 3
  • ATN1L 3 4
  • ARG 3 4
  • ARP 3 4
  • Arginine-Glutamic Acid Dipeptide Repeats Protein 3
  • Atrophin-1 Related Protein 3
  • Atrophin-1-Related Protein 4
  • Atrophin-1 Like Protein 3
  • Atrophin-1-Like Protein 4
  • Atrophin 2 3
  • KIAA0458 4
  • NEDBEH 3
  • DNB1 3

External Ids for RERE Gene

Previous HGNC Symbols for RERE Gene

  • ATN1L

Previous GeneCards Identifiers for RERE Gene

  • GC01M007994
  • GC01M008221
  • GC01M008122
  • GC01M008346
  • GC01M007562

Summaries for RERE Gene

Entrez Gene Summary for RERE Gene

  • This gene encodes a member of the atrophin family of arginine-glutamic acid (RE) dipeptide repeat-containing proteins. The encoded protein co-localizes with a transcription factor in the nucleus, and its overexpression triggers apoptosis. A similar protein in mouse associates with histone deacetylase and is thought to function as a transcriptional co-repressor during embryonic development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

GeneCards Summary for RERE Gene

RERE (Arginine-Glutamic Acid Dipeptide Repeats) is a Protein Coding gene. Diseases associated with RERE include Chromosome 1P36 Deletion Syndrome and Aortitis. GO annotations related to this gene include transcription factor activity, sequence-specific DNA binding and chromatin binding. An important paralog of this gene is ATN1.

UniProtKB/Swiss-Prot for RERE Gene

  • Plays a role as a transcriptional repressor during development. May play a role in the control of cell survival. Overexpression of RERE recruits BAX to the nucleus particularly to POD and triggers caspase-3 activation, leading to cell death.

Gene Wiki entry for RERE Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for RERE Gene

Genomics for RERE Gene

Regulatory Elements for RERE Gene

Enhancers for RERE Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH01F008369 1.1 Ensembl ENCODE 31.4 +445.1 445081 6.0 PKNOX1 FEZF1 RAD21 YY1 SCRT2 FOS ETV6 EGR2 ZNF263 REST RERE LOC102724552 SLC45A1 ENSG00000221083 PIR31362
GH01F008377 1 Ensembl ENCODE 30.6 +438.5 438454 3.0 PKNOX1 FEZF1 ZNF2 ZNF121 GLIS2 ZNF302 KLF7 ZNF263 ZNF488 TSHZ1 RERE LOC102724552 RPL7P7 RPL7AP18 LOC102725193 SLC45A1 ENSG00000221083 PARK7 H6PD MIR34A
GH01F008381 1.4 FANTOM5 Ensembl ENCODE 30.6 +434.0 433964 4.7 CTCF PKNOX1 JUN INSM2 ZIC2 RAD21 HIC1 OSR2 ZNF707 ATF3 RERE LOC102724552 ENSG00000221083 SLC45A1 PARK7 PIR31362
GH01F008448 0.9 Ensembl ENCODE 21.5 +368.3 368259 2.3 HDGF PKNOX1 FEZF1 ZIC2 ZNF316 ZNF366 EED MAFK TCF7L2 DPF2 RERE LOC102724552 ENSG00000221083 GC01M008444 PIR35776 GC01M008496
GH01F008710 0.8 Ensembl ENCODE 21.4 +104.8 104799 4.2 PKNOX1 ARID4B FEZF1 ZNF2 YY1 ZNF121 SP5 TSHZ1 PPARG KAT8 RERE ENSG00000221083 LOC102724552 RPL7P11 ENSG00000270282
- Elite enhancer/Elite enhancer-gene association Download Table
Download GeneHancer data dump

Enhancers around RERE on UCSC Golden Path with GeneCards custom track

Promoters for RERE Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000530129 291 3201 CREB3L1 FEZF1 DMAP1 YY1 SLC30A9 ZNF143 ZNF263 SP3 NFYC TBX21

Genomic Location for RERE Gene

Chromosome:
1
Start:
8,352,397 bp from pter
End:
8,817,691 bp from pter
Size:
465,295 bases
Orientation:
Minus strand

Genomic View for RERE Gene

Genes around RERE on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
RERE Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for RERE Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for RERE Gene

Proteins for RERE Gene

  • Protein details for RERE Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q9P2R6-RERE_HUMAN
    Recommended name:
    Arginine-glutamic acid dipeptide repeats protein
    Protein Accession:
    Q9P2R6
    Secondary Accessions:
    • O43393
    • O75046
    • O75359
    • Q5VXL9
    • Q6P6B9
    • Q9Y2W4

    Protein attributes for RERE Gene

    Size:
    1566 amino acids
    Molecular mass:
    172424 Da
    Quaternary structure:
    • Interacts with HDAC1 (By similarity). Interacts with ATN1. Interaction with ATN1 is improved when the poly-Gln region of ATN1 is extended. Interacts with FAT1.
    SequenceCaution:
    • Sequence=AAC31120.1; Type=Frameshift; Positions=588, 596; Evidence={ECO:0000305}; Sequence=AAD27584.1; Type=Erroneous initiation; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for RERE Gene

    Alternative splice isoforms for RERE Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for RERE Gene

Post-translational modifications for RERE Gene

  • Ubiquitination at Lys 378 and Lys 1324
  • Modification sites at PhosphoSitePlus

No data available for DME Specific Peptides for RERE Gene

Domains & Families for RERE Gene

Suggested Antigen Peptide Sequences for RERE Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q9P2R6

UniProtKB/Swiss-Prot:

RERE_HUMAN :
  • The interaction with ATN1 is mediated by the coiled coil domain.
  • Contains 1 GATA-type zinc finger.
Domain:
  • The interaction with ATN1 is mediated by the coiled coil domain.
  • Contains 1 BAH domain.
  • Contains 1 ELM2 domain.
  • Contains 1 SANT domain.
Similarity:
  • Contains 1 GATA-type zinc finger.
genes like me logo Genes that share domains with RERE: view

Function for RERE Gene

Molecular function for RERE Gene

UniProtKB/Swiss-Prot Function:
Plays a role as a transcriptional repressor during development. May play a role in the control of cell survival. Overexpression of RERE recruits BAX to the nucleus particularly to POD and triggers caspase-3 activation, leading to cell death.

Gene Ontology (GO) - Molecular Function for RERE Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001105 RNA polymerase II transcription coactivator activity IEA --
GO:0001106 RNA polymerase II transcription corepressor activity IEA --
GO:0003677 DNA binding IEA --
GO:0003682 chromatin binding IEA --
GO:0003700 transcription factor activity, sequence-specific DNA binding IEA --
genes like me logo Genes that share ontologies with RERE: view
genes like me logo Genes that share phenotypes with RERE: view

Animal Model Products

Inhibitory RNA Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for RERE Gene

Localization for RERE Gene

Subcellular locations from UniProtKB/Swiss-Prot for RERE Gene

Nucleus. Note=Localized in nuclear bodies of variables size. Colocalized with PML and BAX in nuclear PODs.

Subcellular locations from

COMPARTMENTS
Jensen Localization Image for RERE Gene COMPARTMENTS Subcellular localization image for RERE gene
Compartment Confidence
nucleus 5
cytosol 2

Gene Ontology (GO) - Cellular Components for RERE Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000118 histone deacetylase complex IEA --
GO:0005634 nucleus NAS,TAS 10814707
genes like me logo Genes that share ontologies with RERE: view

Pathways & Interactions for RERE Gene

SuperPathways for RERE Gene

No Data Available

Gene Ontology (GO) - Biological Process for RERE Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000122 negative regulation of transcription from RNA polymerase II promoter IEA --
GO:0006338 chromatin remodeling IEA --
GO:0006351 transcription, DNA-templated IEA --
GO:0006355 regulation of transcription, DNA-templated IEA --
GO:0006607 NLS-bearing protein import into nucleus TAS 10814707
genes like me logo Genes that share ontologies with RERE: view

No data available for Pathways by source and SIGNOR curated interactions for RERE Gene

Drugs & Compounds for RERE Gene

(1) Drugs for RERE Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
genes like me logo Genes that share compounds with RERE: view

Transcripts for RERE Gene

Unigene Clusters for RERE Gene

Arginine-glutamic acid dipeptide (RE) repeats:
Representative Sequences:

Inhibitory RNA Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for RERE Gene

No ASD Table

Relevant External Links for RERE Gene

GeneLoc Exon Structure for
RERE
ECgene alternative splicing isoforms for
RERE

Expression for RERE Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and SAGE for RERE Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for RERE Gene

This gene is overexpressed in Urine (42.2), Islet of Langerhans (8.1), and Testis (7.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for RERE Gene



Protein tissue co-expression partners for RERE Gene

NURSA nuclear receptor signaling pathways regulating expression of RERE Gene:

RERE

SOURCE GeneReport for Unigene cluster for RERE Gene:

Hs.463041

mRNA Expression by UniProt/SwissProt for RERE Gene:

Q9P2R6-RERE_HUMAN
Tissue specificity: Widely expressed. Expressed in tumor cell lines.
genes like me logo Genes that share expression patterns with RERE: view

Primer Products

No data available for mRNA differential expression in normal tissues for RERE Gene

Orthologs for RERE Gene

This gene was present in the common ancestor of animals.

Orthologs for RERE Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia RERE 34 35
  • 99.51 (n)
oppossum
(Monodelphis domestica)
Mammalia RERE 35
  • 91 (a)
OneToOne
dog
(Canis familiaris)
Mammalia RERE 34 35
  • 90.64 (n)
cow
(Bos Taurus)
Mammalia RERE 34 35
  • 90.13 (n)
mouse
(Mus musculus)
Mammalia Rere 34 16 35
  • 87.8 (n)
rat
(Rattus norvegicus)
Mammalia Rere 34
  • 86.18 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia RERE 35
  • 77 (a)
OneToOne
chicken
(Gallus gallus)
Aves RERE 34 35
  • 80.02 (n)
lizard
(Anolis carolinensis)
Reptilia RERE 35
  • 70 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia rere 34
  • 73.16 (n)
zebrafish
(Danio rerio)
Actinopterygii rerea 34 35
  • 72.33 (n)
fruit fly
(Drosophila melanogaster)
Insecta Gug 36 35
  • 62 (a)
worm
(Caenorhabditis elegans)
Secernentea egl-27 36 35
  • 32 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 35
  • 50 (a)
OneToMany
Species where no ortholog for RERE was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for RERE Gene

ENSEMBL:
Gene Tree for RERE (if available)
TreeFam:
Gene Tree for RERE (if available)

Paralogs for RERE Gene

Paralogs for RERE Gene

(3) SIMAP similar genes for RERE Gene using alignment to 8 proteins:

Pseudogenes.org Pseudogenes for RERE Gene

genes like me logo Genes that share paralogs with RERE: view

Variants for RERE Gene

Sequence variations from dbSNP and Humsavar for RERE Gene

SNP ID Clin Chr 01 pos Sequence Context AA Info Type
rs766951273 Pathogenic 8,359,916(+) GGACC(C/T)GGCCA intron-variant, reference, missense
rs869312871 Pathogenic 8,358,242(-) TCTCA(A/C)ATTCA downstream-variant-500B, reference, missense
rs878853252 Pathogenic 8,361,236(-) CCAGG(-/CTCCCTCCTCAGCTCCTCCAGG)GACCC reference, frameshift-variant
rs878853270 Pathogenic 8,358,750(-) CCGGC(C/G)CCACG reference, missense, utr-variant-3-prime
rs878853011 Likely pathogenic 8,360,361(-) CACCC(C/T)TCCGA reference, missense

Structural Variations from Database of Genomic Variants (DGV) for RERE Gene

Variant ID Type Subtype PubMed ID
dgv11e212 CNV loss 25503493
esv2384996 CNV deletion 18987734
esv2407042 CNV deletion 18987734
esv25426 CNV loss 19812545
esv25533 CNV loss 19812545
esv26500 CNV gain+loss 19812545
esv2658508 CNV deletion 23128226
esv2674889 CNV deletion 23128226
esv2743497 CNV deletion 23290073
esv2743508 CNV deletion 23290073
esv2743519 CNV deletion 23290073
esv2743530 CNV deletion 23290073
esv2743541 CNV deletion 23290073
esv2743552 CNV deletion 23290073
esv27511 CNV gain 19812545
esv3305985 CNV mobile element insertion 20981092
esv3360802 CNV insertion 20981092
esv3391677 CNV insertion 20981092
esv3404682 CNV insertion 20981092
esv3441259 CNV insertion 20981092
esv3569008 CNV gain 25503493
esv3577717 CNV loss 25503493
esv3577720 CNV loss 25503493
esv3585147 CNV loss 21293372
esv3585149 CNV loss 21293372
esv3585150 CNV loss 21293372
esv990980 CNV insertion 20482838
nsv1006756 CNV gain 25217958
nsv1012632 CNV gain 25217958
nsv1012977 CNV loss 25217958
nsv1113071 CNV deletion 24896259
nsv1113072 CNV deletion 24896259
nsv1122292 CNV deletion 24896259
nsv1126175 CNV deletion 24896259
nsv1129127 CNV insertion 24896259
nsv1140406 CNV tandem duplication 24896259
nsv159615 CNV deletion 16902084
nsv1854 CNV insertion 18451855
nsv479019 CNV novel sequence insertion 20440878
nsv516827 CNV loss 19592680
nsv524946 CNV loss 19592680
nsv545344 CNV loss 21841781
nsv819494 CNV gain 19587683
nsv826919 CNV gain 20364138
nsv827030 CNV loss 20364138
nsv827141 CNV gain 20364138
nsv945758 CNV duplication 23825009
nsv945760 CNV duplication 23825009
nsv945761 CNV duplication 23825009
nsv947412 CNV duplication 23825009
nsv947413 CNV duplication 23825009
nsv953453 CNV duplication 24416366

Variation tolerance for RERE Gene

Residual Variation Intolerance Score: 0.885% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 4.99; 68.27% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for RERE Gene

Human Gene Mutation Database (HGMD)
RERE
SNPedia medical, phenotypic, and genealogical associations of SNPs for
RERE

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for RERE Gene

Disorders for RERE Gene

MalaCards: The human disease database

(5) MalaCards diseases for RERE Gene - From: Orphanet, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
chromosome 1p36 deletion syndrome
  • 1p36 deletion syndrome
aortitis
  • aortitis nos
actinomycosis
  • actinomycetoma
mediastinitis
neuroblastoma
  • neuroblastoma 1
- elite association - COSMIC cancer census association via MalaCards
Search RERE in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

RERE_HUMAN
  • Note=A chromosomal aberration involving RERE is found in the neuroblastoma cell line NGP. Translocation t(1;15)(p36.2;q24).

Relevant External Links for RERE

Genetic Association Database (GAD)
RERE
Human Genome Epidemiology (HuGE) Navigator
RERE
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
RERE
genes like me logo Genes that share disorders with RERE: view

No data available for Genatlas for RERE Gene

Publications for RERE Gene

  1. Protein binding of a DRPLA family through arginine-glutamic acid dipeptide repeats is enhanced by extended polyglutamine. (PMID: 10814707) Yanagisawa H. … Yamada M. (Hum. Mol. Genet. 2000) 2 3 4 22 64
  2. Atrophin proteins interact with the Fat1 cadherin and regulate migration and orientation in vascular smooth muscle cells. (PMID: 19131340) Hou R. … Sibinga N.E. (J. Biol. Chem. 2009) 3 4 22 64
  3. Identification and characterization of novel genes located at the t(1;15)(p36.2;q24) translocation breakpoint in the neuroblastoma cell line NGP. (PMID: 10729226) Amler L.C. … Hampton G.M. (Genomics 2000) 2 3 4 64
  4. Genome-wide association study identifies five new schizophrenia loci. (PMID: 21926974) (Nat. Genet. 2011) 3 46 64
  5. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PMID: 20379614) Rose J.E. … Uhl G.R. (Mol. Med. 2010) 3 46 64

Products for RERE Gene

Sources for RERE Gene

Content
Loading form....