Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

RER1 Gene

protein-coding   GIFtS: 47
GCID: GC01P002313

RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae)

 Explore 1 disease affiliated with
RER1 via our new
 Human Malady Compendium 
Biological research products
for RER1
    

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section

Aliases
RER1 Retention In Endoplasmic Reticulum 1 Homolog (S. Cerevisiae)1 2
Protein RER12

External Ids:    HGNC: 303091   Entrez Gene: 110792   Ensembl: ENSG000001579167   UniProtKB: O152583   

Export aliases for RER1 gene to outside databases

Previous GC identifers: GC01P001878 GC01P002336 GC01P001983 GC01P002192 GC01P002355 GC01P001601


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for RER1:
The protein encoded by this gene is a multi-pass membrane protein that is localized to the golgi apparatus. It is
involved in the retention of endoplasmic reticulum (ER) membrane proteins in the ER and retrieval of ER membrane
proteins from the early Golgi compartment to facilitate gamma-secretase complex assembly. (provided by RefSeq, Oct
2009)

UniProtKB/Swiss-Prot: RER1_HUMAN, O15258
Function: Involved in the retrieval of endoplasmic reticulum membrane proteins from the early Golgi compartment (By
similarity)




(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000001.10  NC_018912.1  NT_004350.19  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the RER1 gene promoter:
         NF-1   ISGF-3   RFX1   p53   Pax-5   AP-4   LUN-1   STAT3   c-Myb   ATF6   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidRER1 promoter sequence
   Search SABiosciences Chromatin IP Primers for RER1

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat RER1


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 1p36   Ensembl cytogenetic band:  1p36.32   HGNC cytogenetic band: 1p36

RER1 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
RER1 gene location

GeneLoc information about chromosome 1         GeneLoc Exon Structure

GeneLoc location for GC01P002313:  view genomic region     (about GC identifiers)

Start:
2,323,214 bp from pter      End:
2,336,883 bp from pter
Size:
13,670 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: RER1_HUMAN, O15258 (See protein sequence)
Recommended Name: Protein RER1  
Size: 196 amino acids; 22958 Da
Subcellular location: Golgi apparatus membrane; Multi-pass membrane protein
Secondary accessions: O95322

Explore the universe of human proteins at neXtProt for RER1: NX_O15258

Post-translational modifications:

  • View modification sites using PhosphoSitePlus2
  • View neXtProt modification sites for NX_O15258

  • RER1 Protein expression data from MOPED and PaxDb:    About this image 
    Estimated protein expression log10 (pmol).

    REFSEQ proteins: NP_008964.3  
    ENSEMBL proteins: 
     ENSP00000367779   ENSP00000302088   ENSP00000367773   ENSP00000417000   ENSP00000464222  
     ENSP00000367774  

    Human Recombinant Protein Products: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein: RER1
    OriGene Protein Over-expression Lysate: RER1
    OriGene Custom Protein Services for RER1 
    GenScript Custom Purified and Recombinant Proteins Services for RER1
    Novus Biologicals RER1 Protein
    Novus Biologicals RER1 Lysate
    Browse Sino Biological Recombinant Proteins
    Browse ProSpec Recombinant Proteins
    Uscn Proteins for RER1

    Gene Ontology (GO): 2 cellular component terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0016021integral to membrane ----
    GO:0030173integral to Golgi membrane IDA9309388


    RER1 for ontologies           About GeneDecksing



    RER1 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for RER1 
    GenScript Custom Superior Antibodies Services for RER1
    Novus Biologicals RER1 Antibody
    Search for Antibodies for RER1 at Abcam  
    Uscn Antibodies for RER1
    Search ThermoFisher Antibodies for RER1

    Assay Products for RER1: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Immunoassay Development
    Browse OriGene Fluorogenic Cell Assay Kits
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for RER1
    Browse Enzo Life Sciences for kits & assays
    Uscn ELISAs and CLIAs for RER1


    (According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    RER1 for domains           About GeneDecksing

    1 InterPro domain/family:
     IPR004932 Rer1

    Graphical View of Domain Structure for InterPro Entry O15258

    ProtoNet protein and cluster: O15258

    1 Blocks protein family: IPB004932 Retrieval of early ER protein Rer1

    UniProtKB/Swiss-Prot: RER1_HUMAN, O15258
    Similarity: Belongs to the RER1 family


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
    About This Section

    Function Summary:

         UniProtKB/Swiss-Prot: RER1_HUMAN, O15258
    Function: Involved in the retrieval of endoplasmic reticulum membrane proteins from the early Golgi compartment (By
    similarity)

    miRNA
    Products:
        
    OriGene 3'-UTR Clone: RER1
    Browse MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat RER1
    8/38 QIAGEN miScript miRNA Assays for microRNAs that regulate RER1 (see all 38):
    hsa-miR-2052 hsa-miR-374a hsa-miR-3653 hsa-miR-371-5p hsa-miR-3658 hsa-miR-3613-3p hsa-miR-374b hsa-miR-627
    SwitchGear 3'UTR luciferase reporter plasmidRER1 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for RER1 (see all 7)
    OriGene shRNA RFP: RER1
    OriGene siRNA: RER1
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat RER1

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for RER1

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for RER1 (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for RER1
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: RER1 (NM_007033)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for RER1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat RER1 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for RER1
    Search LifeMap BioReagents cell lines for RER1

    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for RER1

    Gene Ontology (GO): 1 molecular function term (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0003674molecular_function ND--


    RER1 for ontologies           About GeneDecksing


    1 GenomeRNAi human phenotype for RER1:
     Decreased cell number 

    Animal Models:
         2 MGI mutant phenotypes (inferred from 1 allele(MGI details for Rer1):
     muscle  nervous system 

    RER1 for phenotypes           About GeneDecksing


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
    About This Section



    Interactions:

        Search SABiosciences Gene Network CentralTM Interacting Genes and Proteins Networks for RER1

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    5/76 Interacting proteins for RER1 (O152583 ENSP000003020884) via UniProtKB, MINT, STRING, and/or I2D (see all 76)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    ALG5Q9Y6733, ENSP000002398914I2D: score=1 STRING: ENSP00000239891
    DDOSTP396563, ENSP000003641884I2D: score=1 STRING: ENSP00000364188
    MAN1B1Q9UKM73, ENSP000003606454I2D: score=1 STRING: ENSP00000360645
    RPN1P048433, ENSP000002962554I2D: score=1 STRING: ENSP00000296255
    SEC61A1P616193, ENSP000002432534I2D: score=1 STRING: ENSP00000243253
    About this table

    Gene Ontology (GO): 1 biological process term (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006890retrograde vesicle-mediated transport, Golgi to ER IDA9309388


    RER1 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section
    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for RER1
    Search CenterWatch for drugs/clinical trials and news about RER1 

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for RER1 gene: 
    NM_007033.4  

    Unigene Cluster for RER1:

    RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae)
    Hs.741204  [show with all ESTs]
    Unigene Representative Sequence: NM_007033
    8 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000378518 ENST00000306256(uc001aje.2) ENST00000493207 ENST00000378512(uc001ajf.2)
    ENST00000443438 ENST00000488353 ENST00000462129 ENST00000378513

    miRNA
    Products:
         
    OriGene 3'-UTR Clone: RER1
    Browse OriGene MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat RER1
    8/38 QIAGEN miScript miRNA Assays for microRNAs that regulate RER1 (see all 38):
    hsa-miR-2052 hsa-miR-374a hsa-miR-3653 hsa-miR-371-5p hsa-miR-3658 hsa-miR-3613-3p hsa-miR-374b hsa-miR-627
    SwitchGear 3'UTR luciferase reporter plasmidRER1 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for RER1 (see all 7)
    OriGene shRNA RFP: RER1
    OriGene siRNA: RER1
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat RER1
    Clone
    Products:
         
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for RER1 (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for RER1
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: RER1 (NM_007033)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for RER1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat RER1 
    Primer
    Products:
        
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for RER1
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat RER1
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat RER1
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat RER1

    Additional cDNA sequence: 

    AF091071.1 AF157324.1 AJ001421.1 AK095750.1 AK289658.1 BC004965.1 BC025684.1 BT007224.1 
    CR456806.1 

    24/33 DOTS entries (see all 33):

    DT.92451230  DT.40192381  DT.121455823  DT.121455878  DT.449647  DT.100031041  DT.100829687  DT.100829672 
    DT.100775762  DT.100829676  DT.121455895  DT.100829682  DT.95170667  DT.121455710  DT.121455798  DT.92451237 
    DT.95170675  DT.92451224  DT.121455860  DT.95170672  DT.97799701  DT.121455760  DT.121455886  DT.220001 

    24/564 AceView cDNA sequences (see all 564):

    AW051415 AI419368 BU185288 BU619358 BU849564 AJ001421 BQ183530 AI362297 
    AA931241 AA694219 CA487826 AI337907 AI146605 BC004965 AW406557 BP339056 
    AI306393 AI421221 AA725437 BQ891678 BU160421 AA505139 BP338734 BE792846 

    GeneLoc Exon Structure

    5/10 Alternative Splicing Database (ASD) splice patterns (SP) for RER1 (see all 10)    About this scheme

    ExUns: 1a · 1b · 1c · 1d · 1e ^ 2a · 2b · 2c · 2d ^ 3a · 3b ^ 4a · 4b · 4c ^ 5 ^ 6 ^ 7 ^ 8a · 8b · 8c · 8d ^ 9a · 9b · 9c · 9d
    SP1:                                -     -     -     -     -     -                 -                       -     -                                       
    SP2:                                -     -     -     -     -                       -                       -     -                                       
    SP3:                                -     -     -     -     -     -                 -                       -                                             
    SP4:                                -     -     -     -     -     -                 -           -           -     -                                       
    SP5:                                                  -     -     -                 -                       -     -                                       


    ECgene alternative splicing isoforms for RER1

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    RER1 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS
    CGAP TAG: --

    Microarray
    RNAseq (Illumina Body Map)
    (100×FPKM)½
    SAGE (Serial Analysis of Gene Expression)

    About this image
    See RER1 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for RER1

    SOURCE GeneReport for Unigene cluster: Hs.741204
        SABiosciences Custom PCR Arrays for RER1
    Primer
    Products:
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for RER1
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat RER1
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat RER1
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat RER1
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for RER1

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of eukaryotes.

    Orthologs for RER1 gene from 9/36 species (see all 36)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Rer11 , 5 RER1 retention in endoplasmic reticulum 1 homolog (S. more1, 5 88.27(n)1
    96.43(a)1
      4 (86.17 cM)5
    678301  NM_026395.11  NP_080671.11 
     1550741105 
    chicken
    (Gallus gallus)
    Aves RER11 RER1 retention in endoplasmic reticulum 1 homolog (S. more 81.8(n)
    94.39(a)
      419397  NM_001006300.1  NP_001006300.1 
    African clawed frog
    (Xenopus laevis)
    Amphibia BI446701.12   -- 81.86(n)    BI446701.1 
    zebrafish
    (Danio rerio)
    Actinopterygii AY398406.12   -- 79.61(n)   393648  AY398406.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta CG118571 , 3 vesicle-mediated transport3
    CG118571
    63(a)3
    62.98(n)1
    66.86(a)1
      96C83
    430421  NM_001144638.11  NP_001138110.11 
    worm
    (Caenorhabditis elegans)
    Secernentea F46C5.83
    rer-11
    endoplasmic reticular protein3
    Protein RER-11
    56(a)3
    61.05(n)1
    60.87(a)1
      II(8811292-8812178)3
    1744101  NM_063477.51  NP_495878.11 
    baker's yeast
    (Saccharomyces cerevisiae)
    Saccharomycetes RER11 Rer1p 53.5(n)
    50.96(a)
      850354   NP_009925.1 
    thale cress
    (Arabidopsis thaliana)
    eudicotyledons ATRER1A1 protein RER1A 59.35(n)
    58.54(a)
      830077  NM_120082.3  NP_195633.1 
    rice
    (Oryza sativa)
    Liliopsida CA762697.12   -- 71.57(n)    CA762697.1 


    ENSEMBL Gene Tree for RER1 (if available)
    TreeFam Gene Tree for RER1 (if available) 

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
      --

    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/293 NCBI SNPs in RER1 are shown (see all 293    About this table
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 1 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs347131781,2
    C--1599983(-) GTCTAC/TGTATA 1 -- us2k11Minor allele frequency- T:0.01NA 74
    rs793236011,2
    --1600550(+) CAGGGA/CTCCCT 1 -- us2k10--------
    rs778046001,2
    C,--1601602(+) GGGGGT/CGTGGC 1 -- us2k14Minor allele frequency- C:0.26NA WA 242
    rs175231061,2
    C,H--1601707(+) GCTGTC/TGTCTC 1 -- us2k15Minor allele frequency- T:0.00MN EA NS NA 536
    rs729249311,2
    C,--1602431(+) ACTGAC/TGNNNN 1 -- int10--------
    rs1114515911,2
    --1602458(+) CATCGG/CTTTTG 1 -- int11Minor allele frequency- C:0.50CSA 2
    rs681031431,2
    C,--1602882(+) AAGGAG/TGNNNN 1 -- int14Minor allele frequency- T:0.08NA WA EA 360
    rs556720281,2
    C--1603101(+) CATCCCAGGCTTCAGTGCTCCTGGACG
    CCAGGCAGAGGACTTCATCC
    /-
    TTTCC
    1 -- int11Minor allele frequency- -:0.00NA 2
    rs413156441,2
    --1603329(+) AGCCCC/TGAACC 1 -- int10--------
    rs750690991,2
    F,--1603763(+) GGCTGT/CTGGAG 1 -- int11Minor allele frequency- C:0.11WA 118

    HapMap Linkage Disequilibrium report for RER1 (2323214 - 2336883 bp)
    Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
    Database of Genomic Variants (DGV): 6 variations for RER1
         5 CNVs: 53347 29815 4193 29817 29816
         1 Indel: 97257

    SABiosciences Cancer Mutation PCR Assays
    QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing RER1
    DNA2.0 Custom Variant and Variant Library Synthesis for RER1

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    RER1 for disorders           About GeneDecksing

    1 disease for RER1:    About MalaCards
    malaria


    Export disorders for RER1 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for RER1 gene, integrated from 9 sources (see all 18):
    (articles sorted by number of sources associating them with RER1)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Human Rer1 is localized to the Golgi apparatus and complements the deletion of the homologous Rer1 protein of Saccharomyces cerevisiae. (PubMed id 9309388)1, 2, 3, 9 Fuellekrug J....Schmitt H. (1997)
    2. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S....Malek J. (2004)
    3. Global landscape of HIV-human protein complexes. (PubMed id 22190034)1 Jager S....Krogan N.J. (2012)
    4. Initial characterization of the human central proteome. (PubMed id 21269460)2 Burkard T.R.... Colinge J. (2011)
    5. A proteome-wide, quantitative survey of in vivo ubiqui tylation sites reveals widespread regulatory roles. (PubMed id 21890473)1 Wagner S.A....Choudhary C. (2011)
    6. Systematic and quantitative assessment of the ubiquiti n-modified proteome. (PubMed id 21906983)1 Kim W....Gygi S.P. (2011)
    7. System-wide temporal characterization of the proteome and phosphoproteome of human embryonic stem cell differentiation. (PubMed id 21406692)2 Rigbolt K.T....Blagoev B. (2011)
    8. Mass spectrometric analysis of lysine ubiquitylation r eveals promiscuity at site level. (PubMed id 21139048)1 Danielsen J.M....Nielsen M.L. (2011)
    9. Quantitative phosphoproteomics reveals widespread full phosphorylation site occupancy during mitosis. (PubMed id 20068231)2 Olsen J.V....Mann M. (2010)
    10. Quantitative phosphoproteomic analysis of T cell receptor signaling reveals system-wide modulation of protein-protein interactions. (PubMed id 19690332)2 Mayya V.... Han D.K. (2009)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 11079 HGNC: 30309 AceView: RER1 Ensembl:ENSG00000157916 euGenes: HUgn11079
    ECgene: RER1 H-InvDB: RER1

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for RER1 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for RER1 gene:
    Search GeneIP for patents involving RER1

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences),
    In Situ Hybridization Assays from
    Advanced Cell Diagnostics
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Phosphatase Activity Assays/Reagents   Browse Recombinant/Natural Proteins  
     Browse OriGene Antibodies   OriGene shRNA RFP for RER1  
     OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for RER1   OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for RER1  
     OriGene Protein Over-expression Lysate for RER1   Browse OriGene Fluorogenic Cell Assay Kits  
     OriGene siRNA for RER1   OriGene 3'-UTR Clone for RER1  
     OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for RER1   OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for RER1  
     Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
     Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
     OriGene Purified Protein for RER1   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for RER1   OriGene Custom Protein Services for RER1  
     OriGene Custom Immunoassay Development  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat RER1
     QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing RER1
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat RER1
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat RER1
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat RER1
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat RER1
     GenScript Custom Purified and Recombinant Proteins Services for RER1 GenScript cDNA clones with any tag delivered in your preferred vector for RER1
     GenScript Custom Assay Services for RER1 GenScript Custom Superior Antibodies Services for RER1
     GenScript Custom overexpressing Cell Line Services for RER1 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in RER1 promoter
     Search Chromatin IP Primers for RER1
     RT2 qPCR Primer Assay in human, mouse, rat RER1
     Search GNC Networks for RER1
     SABiosciences Custom PCR Arrays for RER1
     Search Tocris compounds for RER1
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological cDNA Clones
     Antibodies/Proteins Production Services
     Rabbit Monoclonal Antibody Platform
     Bulk Purchasing
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     RER1 antibodies
     RER1 proteins
     RER1 lysates
     Search for Antibodies for RER1 at Abcam
     See all of Abcam's Antibodies, Kits and Proteins for RER1
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     RER1 Proteins, Antibodies, CLIAs, and ELISAs
     Search LifeMap BioReagents cell lines for RER1
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for RER1
     SwitchGear 3'UTR luciferase reporter plasmids for RER1
     SwitchGear Promoter luciferase reporter plasmids for RER1
     Search ThermoFisher Antibodies for RER1
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat RER1
           
    GeneCards Homepage - Last full update: 19 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013

    View Random Gene

    Category
    VWF
    (GIFTS: 73)
    von Willebrand factor
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      RER1 gene at Home site.
    hostname: 356977-web1.xennexinc.com index build: 100 solr: 1.4