Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

REEP3 Gene

protein-coding   GIFtS: 49
GCID: GC10P065281

receptor accessory protein 3

(Previous name: chromosome 10 open reading frame 74 )
(Previous symbol: C10orf74)
 Explore 1 disease affiliated with
REEP3 via our new
 Human Malady Compendium 
Biological research products
for REEP3
    

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section

Aliases
Receptor Accessory Protein 31 2
C10orf741 2 3 5
Chromosome 10 Open Reading Frame 741
Receptor Expression Enhancing Protein 32
Receptor Expression-Enhancing Protein 32

External Ids:    HGNC: 237111   Entrez Gene: 2210352   Ensembl: ENSG000001654767   OMIM: 6093485   UniProtKB: Q6NUK43   

Export aliases for REEP3 gene to outside databases

Previous GC identifers: GC10P064952 GC10P059317


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

UniProtKB/Swiss-Prot: REEP3_HUMAN, Q6NUK4
Function: May enhance the cell surface expression of odorant receptors (By similarity)




(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000010.10  NC_018921.1  NT_030059.13  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the REEP3 gene promoter:
         Max1   ER-alpha   HTF   AP-2gamma   FOXJ2 (long isoform)   Sox9   AP-2beta   AP-2alpha   c-Myc   AP-2alphaA   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidREEP3 promoter sequence
   Search SABiosciences Chromatin IP Primers for REEP3

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat REEP3


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 10q21.3   Ensembl cytogenetic band:  10q21.3   HGNC cytogenetic band: 10q21.3

REEP3 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
REEP3 gene location

GeneLoc information about chromosome 10         GeneLoc Exon Structure

GeneLoc location for GC10P065281:  view genomic region     (about GC identifiers)

Start:
65,281,123 bp from pter      End:
65,384,883 bp from pter
Size:
103,761 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: REEP3_HUMAN, Q6NUK4 (See protein sequence)
Recommended Name: Receptor expression-enhancing protein 3  
Size: 255 amino acids; 29264 Da
Subunit: Interacts with odorant receptor proteins (By similarity)
Subcellular location: Membrane; Multi-pass membrane protein (By similarity)
Sequence caution: Sequence=AAH10040.1; Type=Miscellaneous discrepancy; Note=Contaminating sequence. Potential poly-A
sequence;
Secondary accessions: Q5JQR5 Q5QGT2 Q6PEW8 Q6PJY4
Alternative splicing: 2 isoforms:  Q6NUK4-1   Q6NUK4-2   (No experimental confirmation available)

Explore the universe of human proteins at neXtProt for REEP3: NX_Q6NUK4

Post-translational modifications:

  • View modification sites using PhosphoSitePlus2
  • View neXtProt modification sites for NX_Q6NUK4

  • REEP3 Protein expression data from MOPED and PaxDb:    About this image 
    Estimated protein expression log10 (pmol).

    REFSEQ proteins: NP_001001330.1  
    ENSEMBL proteins: 
     ENSP00000298249   ENSP00000362863  

    Human Recombinant Protein Products: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein: REEP3
    OriGene Protein Over-expression Lysate: REEP3
    OriGene Custom Protein Services for REEP3 
    GenScript Custom Purified and Recombinant Proteins Services for REEP3
    Novus Biologicals REEP3 Protein
    Novus Biologicals REEP3 Lysate
    Browse Sino Biological Recombinant Proteins
    Browse ProSpec Recombinant Proteins
    Uscn Proteins for REEP3

    Gene Ontology (GO): 1 cellular component term (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0016021integral to membrane IEA--


    REEP3 for ontologies           About GeneDecksing



    REEP3 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    OriGene Antibodies: REEP3
    OriGene Custom Antibody Services for REEP3 
    GenScript Custom Superior Antibodies Services for REEP3
    Novus Biologicals REEP3 Antibodies
    Search for Antibodies for REEP3 at Abcam  
    Uscn Antibodies for REEP3
    ThermoFisher Antibodies for REEP3

    Assay Products for REEP3: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Immunoassay Development
    Browse OriGene Fluorogenic Cell Assay Kits
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for REEP3
    Browse Enzo Life Sciences for kits & assays
    Uscn ELISAs and CLIAs for REEP3


    (According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    REEP3 for domains           About GeneDecksing

    1 InterPro domain/family:
     IPR004345 TB2_DP1_HVA22

    Graphical View of Domain Structure for InterPro Entry Q6NUK4

    ProtoNet protein and cluster: Q6NUK4

    1 Blocks protein family: IPB004345 TB2/DP1 and HVA22 related proteins

    UniProtKB/Swiss-Prot: REEP3_HUMAN, Q6NUK4
    Similarity: Belongs to the DP1 family


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
    About This Section

    Function Summary:

         UniProtKB/Swiss-Prot: REEP3_HUMAN, Q6NUK4
    Function: May enhance the cell surface expression of odorant receptors (By similarity)

    miRNA
    Products:
        
    OriGene 3'-UTR Clone: REEP3
    Browse MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat REEP3
    8/95 QIAGEN miScript miRNA Assays for microRNAs that regulate REEP3 (see all 95):
    hsa-miR-520e hsa-miR-607 hsa-miR-106a hsa-miR-200a hsa-miR-30d hsa-miR-30a hsa-miR-149 hsa-miR-93
    SwitchGear 3'UTR luciferase reporter plasmidREEP3 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for REEP3 (see all 7)
    OriGene shRNA RFP: REEP3
    OriGene siRNA: REEP3
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat REEP3

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for REEP3

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for REEP3 (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for REEP3 (see all 2)
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: REEP3 (NM_001001330)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for REEP3
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat REEP3 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for REEP3
    Search LifeMap BioReagents cell lines for REEP3

    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for REEP3


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
    About This Section



    Interactions:

        Search SABiosciences Gene Network CentralTM Interacting Genes and Proteins Networks for REEP3

    STRING Interaction Network Preview (showing 1 interactants - click image to see more details)

    3 Interacting proteins for REEP3 (Q6NUK42, 3 ENSP000003628634) via UniProtKB, MINT, STRING, and/or I2D
    InteractantInteraction Details
    GeneCardExternal ID(s)
    SFNP319472, 3MINT-3976629 I2D: score=1 
    ARL6IP5O759153I2D: score=1 
    UBCENSP000003448184STRING: ENSP00000344818
    About this table

    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section
    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for REEP3
    Search CenterWatch for drugs/clinical trials and news about REEP3 

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for REEP3 gene: 
    NM_001001330.2  

    Unigene Cluster for REEP3:

    Receptor accessory protein 3
    Hs.499833  [show with all ESTs]
    Unigene Representative Sequence: NM_001001330
    2 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000298249 ENST00000373758(uc009xpl.2 uc001jmt.3)

    miRNA
    Products:
         
    OriGene 3'-UTR Clone: REEP3
    Browse OriGene MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat REEP3
    8/95 QIAGEN miScript miRNA Assays for microRNAs that regulate REEP3 (see all 95):
    hsa-miR-520e hsa-miR-607 hsa-miR-106a hsa-miR-200a hsa-miR-30d hsa-miR-30a hsa-miR-149 hsa-miR-93
    SwitchGear 3'UTR luciferase reporter plasmidREEP3 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for REEP3 (see all 7)
    OriGene shRNA RFP: REEP3
    OriGene siRNA: REEP3
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat REEP3
    Clone
    Products:
         
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for REEP3 (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for REEP3 (see all 2)
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: REEP3 (NM_001001330)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for REEP3
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat REEP3 
    Primer
    Products:
        
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for REEP3
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat REEP3
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat REEP3
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat REEP3

    Additional cDNA sequence: 

    AK289976.1 AY562241.1 BC010040.2 BC018658.1 BC038724.1 BC057832.1 BC068557.1 CR936686.1 

    11 DOTS entries:

    DT.415955  DT.80102037  DT.91686888  DT.95164555  DT.95164557  DT.97838862  DT.100021448  DT.95164559 
    DT.121260033  DT.40250675  DT.91765865 

    24/154 AceView cDNA sequences (see all 154):

    AA100609 AA620591 AI192275 BU197986 BM830660 AI079315 BX494303 AI499277 
    W56228 AL118571 CA455063 BI826741 BX280876 BM761268 CA422715 BM841117 
    BC057832 AI922029 AA730643 W31882 BC010040 AA548384 BQ225487 CA489790 

    GeneLoc Exon Structure


    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    REEP3 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS
    CGAP TAG: ACTTAACATT

    Microarray
    RNAseq (Illumina Body Map)
    (100×FPKM)½
    SAGE (Serial Analysis of Gene Expression)

    About this image
    See REEP3 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for REEP3

    SOURCE GeneReport for Unigene cluster: Hs.499833
        SABiosciences Custom PCR Arrays for REEP3
    Primer
    Products:
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for REEP3
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat REEP3
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat REEP3
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat REEP3
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for REEP3

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of eukaryotes.

    Orthologs for REEP3 gene from 8/24 species (see all 24)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    chicken
    (Gallus gallus)
    Aves REEP31 receptor accessory protein 3 79.22(n)
    83.92(a)
      423654  NM_001199532.1  NP_001186461.1 
    lizard
    (Anolis carolinensis)
    Reptilia REEP36
    --
    68(a)
    1 ↔ 1
    GL343204.1(2295507-2333207)
    African clawed frog
    (Xenopus laevis)
    Amphibia MGC687642 hypothetical protein MGC68764 74.05(n)    BC063730.1 
    zebrafish
    (Danio rerio)
    Actinopterygii zgc555292 hypothetical protein MGC55529 75.1(n)   393130  BC045373.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta CG116976
    CG55396
    (see all 3)
    --
    15(a)
    14(a)
    (see all 3)
    possible ortholog
    possible ortholog
    (see all 3)
    X(11466740-11467673)
    2R(19692334-19693411)
    worm
    (Caenorhabditis elegans)
    Secernentea T19C3.46
    Uncharacterized protein T19C3.4
    34(a)
    1 → many
    III(618245-620209)
    thale cress
    (Arabidopsis thaliana)
    eudicotyledons HVA22G6
    ATHVA22E6
    (see all 11)
    HVA22-like protein e
    (see all 11)
    27(a)
    25(a)
    (see all 11)
    possible ortholog
    possible ortholog
    (see all 11)
    1(28423896-28424931)
    5(20633193-20634552)
    rice
    (Oryza sativa)
    Liliopsida --
    --
    (see all 16)
    HVA22, putative, expressed
    (see all 16)
    3(a)
    29(a)
    (see all 16)
    possible ortholog
    possible ortholog
    (see all 16)
    1(30362018-30369168)
    9(16874520-16875342)


    ENSEMBL Gene Tree for REEP3 (if available)
    TreeFam Gene Tree for REEP3 (if available) 

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for REEP3 gene
    REEP12  REEP42  REEP62  REEP52  REEP22  
    3 SIMAP similar genes for REEP3 using alignment to 2 protein entries:     REEP3_HUMAN (see all proteins):
    REEP1    REEP4    REEP2

    REEP3 for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/1467 NCBI SNPs in REEP3 are shown (see all 1467    About this table
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 10 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs562085051,2
    C--59369245(+) TATCA-/GCATGAGCCACCAAAGCCC
    ACCCCAGTTTTATTTTTTATCA
    CATGC
    1 -- int11Minor allele frequency- GCATGAGCCACCAAAGCCCACCCCAGTTTTATTTTTTATCA:0.00NA 2
    rs1834303921,2
    --65279305(+) ATTCAA/GTACAT 1 -- us2k10--------
    rs1882877541,2
    --65279311(+) TACATA/TAGACA 1 -- us2k10--------
    rs1922353371,2
    --65279347(+) AGAAAC/TAGAAA 1 -- us2k10--------
    rs763786001,2
    F,--65279420(+) AGGATG/ATCTTC 1 -- us2k12Minor allele frequency- A:0.02WA NA 238
    rs1829333351,2
    --65279482(+) CAAAGC/TGTTAA 1 -- us2k10--------
    rs1412215761,2
    --65279760(+) ATTCAC/GAGTTA 1 -- us2k10--------
    rs797613981,2
    --65279868(+) TTGTTA/TCTTAA 1 -- us2k10--------
    rs70710911,2
    C,F,--65279908(+) GAGAAC/GTGAAA 1 -- us2k12Minor allele frequency- G:0.11WA NA 238
    rs1876351971,2
    --65280163(+) TATTCA/TTCGCA 1 -- us2k10--------

    HapMap Linkage Disequilibrium report for REEP3 (65281123 - 65384883 bp)
    Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
    Database of Genomic Variants (DGV): 1 variation for REEP3
         1 Indel: 71029

    SABiosciences Cancer Mutation PCR Assays
    QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing REEP3
    DNA2.0 Custom Variant and Variant Library Synthesis for REEP3

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    REEP3 for disorders           About GeneDecksing

    OMIM gene information: 609348    OMIM disorders: --

    1 disease for REEP3:    About MalaCards
    alzheimer's disease

    Human Genome Epidemiology (HuGE) Navigator: REEP3 (3 documents)

    Export disorders for REEP3 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for REEP3 gene, integrated from 9 sources (see all 18):
    (articles sorted by number of sources associating them with REEP3)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. RTP family members induce functional expression of mammalian odorant receptors. (PubMed id 15550249)1, 2, 3 Saito H....Matsunami H. (2004)
    2. Inherited ACTH insensitivity illuminates the mechanisms of ACTH action. (PubMed id 16271481)1, 3 Clark A.J....Huebner A. (2005)
    3. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S....Malek J. (2004)
    4. The DNA sequence and comparative analysis of human chromosome 10. (PubMed id 15164054)1, 2 Deloukas P.... Rogers J. (2004)
    5. Identification and characterization of the TRIP8 and REEP3 genes on chromosome 10q21.3 as novel candidate genes for autism. (PubMed id 17290275)1, 9 Castermans D....Devriendt K. (2007)
    6. Genome-wide association analysis of juvenile idiopathi c arthritis identifies a new susceptibility locus at chromosomal region 3q13. (PubMed id 22354554)1 Thompson S.D....Glass D.N. (2012)
    7. A proteome-wide, quantitative survey of in vivo ubiqui tylation sites reveals widespread regulatory roles. (PubMed id 21890473)1 Wagner S.A....Choudhary C. (2011)
    8. Systematic and quantitative assessment of the ubiquiti n-modified proteome. (PubMed id 21906983)1 Kim W....Gygi S.P. (2011)
    9. System-wide temporal characterization of the proteome and phosphoproteome of human embryonic stem cell differentiation. (PubMed id 21406692)2 Rigbolt K.T....Blagoev B. (2011)
    10. Ubiquitin ligase substrate identification through qua ntitative proteomics at both the protein and peptide levels. (PubMed id 21987572)1 Lee K.A....Doedens J.R. (2011)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 221035 HGNC: 23711 AceView: C10orf74 Ensembl:ENSG00000165476 euGenes: HUgn221035
    ECgene: REEP3 H-InvDB: REEP3

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for REEP3 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for REEP3 gene:
    Search GeneIP for patents involving REEP3

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences),
    In Situ Hybridization Assays from
    Advanced Cell Diagnostics
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Phosphatase Activity Assays/Reagents   Browse Recombinant/Natural Proteins  
     OriGene Antibodies for REEP3   OriGene shRNA RFP for REEP3  
     OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for REEP3   OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for REEP3  
     OriGene Protein Over-expression Lysate for REEP3   Browse OriGene Fluorogenic Cell Assay Kits  
     OriGene siRNA for REEP3   OriGene 3'-UTR Clone for REEP3  
     OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for REEP3   OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for REEP3  
     Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
     Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
     OriGene Purified Protein for REEP3   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for REEP3   OriGene Custom Protein Services for REEP3  
     OriGene Custom Immunoassay Development  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat REEP3
     QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing REEP3
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat REEP3
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat REEP3
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat REEP3
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat REEP3
     GenScript Custom Purified and Recombinant Proteins Services for REEP3 GenScript cDNA clones with any tag delivered in your preferred vector for REEP3
     GenScript Custom Assay Services for REEP3 GenScript Custom Superior Antibodies Services for REEP3
     GenScript Custom overexpressing Cell Line Services for REEP3 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in REEP3 promoter
     Search Chromatin IP Primers for REEP3
     RT2 qPCR Primer Assay in human, mouse, rat REEP3
     Search GNC Networks for REEP3
     SABiosciences Custom PCR Arrays for REEP3
     Search Tocris compounds for REEP3
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological cDNA Clones
     Antibodies/Proteins Production Services
     Rabbit Monoclonal Antibody Platform
     Bulk Purchasing
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     REEP3 antibodies
     REEP3 proteins
     REEP3 lysates
     Search for Antibodies for REEP3 at Abcam
     See all of Abcam's Antibodies, Kits and Proteins for REEP3
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     REEP3 Proteins, Antibodies, CLIAs, and ELISAs
     Search LifeMap BioReagents cell lines for REEP3
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for REEP3
     SwitchGear 3'UTR luciferase reporter plasmids for REEP3
     SwitchGear Promoter luciferase reporter plasmids for REEP3
     ThermoFisher Antibodies for REEP3
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat REEP3
           
    GeneCards Homepage - Last full update: 19 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013

    View Random Gene

    Category
    VWF
    (GIFTS: 73)
    von Willebrand factor
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      REEP3 gene at Home site.
    hostname: 356980-web2.xennexinc.com index build: 100 solr: 1.4