Free for academic non-profit institutions. Other users need a Commercial license

Aliases for RARRES1 Gene

Aliases for RARRES1 Gene

  • Retinoic Acid Receptor Responder 1 2 3 5
  • Retinoic Acid Receptor Responder (Tazarotene Induced) 1 2 3
  • Phorbol Ester-Induced Gene 1 Protein 3 4
  • Tazarotene-Induced Gene 1 Protein 3 4
  • RAR-Responsive Protein TIG1 3 4
  • Latexin-Like 2 3
  • PERG-1 3 4
  • TIG1 3 4
  • Retinoic Acid Receptor Responder Protein 1 3
  • PEIG1 4
  • LXNL 3

External Ids for RARRES1 Gene

Previous GeneCards Identifiers for RARRES1 Gene

  • GC03M155675
  • GC03M159362
  • GC03M159696
  • GC03M159735
  • GC03M159897
  • GC03M158414
  • GC03M155810

Summaries for RARRES1 Gene

Entrez Gene Summary for RARRES1 Gene

  • This gene was identified as a retinoid acid (RA) receptor-responsive gene. It encodes a type 1 membrane protein. The expression of this gene is upregulated by tazarotene as well as by retinoic acid receptors. The expression of this gene is found to be downregulated in prostate cancer, which is caused by the methylation of its promoter and CpG island. Alternatively spliced transcript variant encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]

GeneCards Summary for RARRES1 Gene

RARRES1 (Retinoic Acid Receptor Responder 1) is a Protein Coding gene. An important paralog of this gene is LXN.

UniProtKB/Swiss-Prot for RARRES1 Gene

  • Inhibitor of the cytoplasmic carboxypeptidase AGBL2, may regulate the alpha-tubulin tyrosination cycle.

Gene Wiki entry for RARRES1 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for RARRES1 Gene

Genomics for RARRES1 Gene

Regulatory Elements for RARRES1 Gene

Enhancers for RARRES1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH03G158767 2.3 VISTA FANTOM5 Ensembl ENCODE dbSUPER 12.6 -38.8 -38787 8.2 PKNOX1 FOXA2 ARNT FEZF1 TCF12 GATA2 CBX5 FOS KLF13 ZNF263 ENSG00000240207 ENSG00000271778 RARRES1 MFSD1 MLF1 ENSG00000272247 GFM1 LXN PIR51214 ENSG00000243675
GH03G158709 1.6 FANTOM5 Ensembl ENCODE dbSUPER 12.7 +21.0 20961 5.3 SIN3A GATA2 SCRT2 FOS IKZF2 JUNB ZNF592 CREB3 MAFF ZNF589 ENSG00000240207 GFM1 MLF1 LXN RARRES1 MFSD1 ENSG00000272247 PIR52872 ENSG00000272440
GH03G158791 1.4 Ensembl ENCODE dbSUPER 11.9 -58.7 -58667 0.7 TBP ATF1 CBX3 ARID4B SIN3A BRCA1 DNMT3B RAD21 CHAMP1 RFX5 MFSD1 ENSG00000240207 RARRES1 LXN GFM1 MLF1 LOC100996447 ENSG00000271778 ENSG00000272247
GH03G158800 1.4 ENCODE dbSUPER 11.7 -69.3 -69325 2.4 HDGF PKNOX1 MLX CREB3L1 ARNT AGO1 WRNIP1 ARID4B SIN3A DMAP1 ENSG00000272247 MFSD1 ENSG00000271778 RARRES1 ENSG00000240207 ENSG00000272440 RSRC1 GFM1 PIR50004
GH03G158700 1.1 ENCODE dbSUPER 11.5 +30.3 30311 4.3 TAL1 BACH1 BMI1 ZBTB40 ZNF664 ARID3A CBX5 GATA2 EED ETV6 GFM1 ENSG00000240207 MFSD1 LXN RARRES1 MLF1 ENSG00000272440 PIR52872
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around RARRES1 on UCSC Golden Path with GeneCards custom track

Promoters for RARRES1 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000161036 196 1001 CTCF SUZ12 MAX SIN3A RBBP5 CHAMP1 E2F1 ELK1 POLR2A E2F6

Genomic Location for RARRES1 Gene

158,696,892 bp from pter
158,732,696 bp from pter
35,805 bases
Minus strand

Genomic View for RARRES1 Gene

Genes around RARRES1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
RARRES1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for RARRES1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for RARRES1 Gene

Proteins for RARRES1 Gene

  • Protein details for RARRES1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Retinoic acid receptor responder protein 1
    Protein Accession:
    Secondary Accessions:
    • Q8N1D7

    Protein attributes for RARRES1 Gene

    294 amino acids
    Molecular mass:
    33285 Da
    Quaternary structure:
    No Data Available

    Alternative splice isoforms for RARRES1 Gene


neXtProt entry for RARRES1 Gene

Post-translational modifications for RARRES1 Gene

Other Protein References for RARRES1 Gene

No data available for DME Specific Peptides for RARRES1 Gene

Domains & Families for RARRES1 Gene

Protein Domains for RARRES1 Gene

Suggested Antigen Peptide Sequences for RARRES1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the protease inhibitor I47 (latexin) family.
  • Belongs to the protease inhibitor I47 (latexin) family.
genes like me logo Genes that share domains with RARRES1: view

No data available for Gene Families for RARRES1 Gene

Function for RARRES1 Gene

Molecular function for RARRES1 Gene

UniProtKB/Swiss-Prot Function:
Inhibitor of the cytoplasmic carboxypeptidase AGBL2, may regulate the alpha-tubulin tyrosination cycle.
UniProtKB/Swiss-Prot Induction:
By tazarotene and by all the retinoic acid receptors tested.
genes like me logo Genes that share phenotypes with RARRES1: view

Animal Model Products

CRISPR Products

Inhibitory RNA Products

No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for RARRES1 Gene

Localization for RARRES1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for RARRES1 Gene

Membrane; Single-pass type III membrane protein.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for RARRES1 gene
Compartment Confidence
extracellular 5
plasma membrane 1
nucleus 1
endoplasmic reticulum 1
lysosome 1
golgi apparatus 1

Gene Ontology (GO) - Cellular Components for RARRES1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane TAS,IEA --
GO:0070062 extracellular exosome IDA 19199708
genes like me logo Genes that share ontologies with RARRES1: view

Pathways & Interactions for RARRES1 Gene

SuperPathways for RARRES1 Gene

No Data Available

Interacting Proteins for RARRES1 Gene

Selected Interacting proteins: P49788-TIG1_HUMAN for RARRES1 Gene via IID

Gene Ontology (GO) - Biological Process for RARRES1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0008285 negative regulation of cell proliferation IEA --
genes like me logo Genes that share ontologies with RARRES1: view

No data available for Pathways by source and SIGNOR curated interactions for RARRES1 Gene

Drugs & Compounds for RARRES1 Gene

(2) Drugs for RARRES1 Gene - From: DrugBank, DGIdb, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Tretinoin Approved, Investigational Nutra binder, Target, agonist 228

(3) Additional Compounds for RARRES1 Gene - From: HMDB and Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
all-trans-retinoic acid
  • (all-E)-3,7-Dimethyl-9-(2,6,6-trimethyl-1-cyclohexen-1-yl)-2,4,6,8-nonatetraenoate
  • (all-E)-3,7-Dimethyl-9-(2,6,6-trimethyl-1-cyclohexen-1-yl)-2,4,6,8-nonatetraenoic acid
  • 3,7-Dimethyl-9-(2,6,6-trimethyl-1-cyclohexen-1-yl)-2,4,6,8-nonatetraenoate
  • 3,7-Dimethyl-9-(2,6,6-trimethyl-1-cyclohexen-1-yl)-2,4,6,8-nonatetraenoic acid
  • Acide retinoique (French)
Full agonist, Agonist 302-79-4
genes like me logo Genes that share compounds with RARRES1: view

Transcripts for RARRES1 Gene

Unigene Clusters for RARRES1 Gene

Retinoic acid receptor responder (tazarotene induced) 1:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Alternative Splicing Database (ASD) splice patterns (SP) for RARRES1 Gene

ExUns: 1a · 1b · 1c ^ 2 ^ 3a · 3b · 3c ^ 4a · 4b · 4c ^ 5 ^ 6
SP1: -
SP3: - - -
SP4: -

Relevant External Links for RARRES1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for RARRES1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for RARRES1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for RARRES1 Gene

This gene is overexpressed in Minor Salivary Gland (x5.5), Fallopian Tube (x5.1), Adipose - Visceral (Omentum) (x4.9), and Heart - Atrial Appendage (x4.5).

Protein differential expression in normal tissues from HIPED for RARRES1 Gene

This gene is overexpressed in Amniocyte (64.9).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for RARRES1 Gene

NURSA nuclear receptor signaling pathways regulating expression of RARRES1 Gene:


SOURCE GeneReport for Unigene cluster for RARRES1 Gene:


Evidence on tissue expression from TISSUES for RARRES1 Gene

  • Skin(4.1)
genes like me logo Genes that share expression patterns with RARRES1: view

Primer Products

No data available for Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for RARRES1 Gene

Orthologs for RARRES1 Gene

This gene was present in the common ancestor of chordates.

Orthologs for RARRES1 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia RARRES1 34 35
  • 88.96 (n)
(Rattus norvegicus)
Mammalia Rarres1 34
  • 81.36 (n)
(Mus musculus)
Mammalia Rarres1 34 16 35
  • 79.86 (n)
(Bos Taurus)
Mammalia RARRES1 34 35
  • 79.75 (n)
(Canis familiaris)
Mammalia RARRES1 35
  • 71 (a)
(Ornithorhynchus anatinus)
Mammalia RARRES1 35
  • 46 (a)
(Gallus gallus)
Aves RARRES1 34 35
  • 53.53 (n)
(Anolis carolinensis)
Reptilia RARRES1 35
  • 35 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia rarres1 34
  • 55.16 (n)
(Danio rerio)
Actinopterygii lxn 35
  • 22 (a)
Species where no ortholog for RARRES1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for RARRES1 Gene

Gene Tree for RARRES1 (if available)
Gene Tree for RARRES1 (if available)

Paralogs for RARRES1 Gene

Paralogs for RARRES1 Gene

(1) SIMAP similar genes for RARRES1 Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with RARRES1: view

Variants for RARRES1 Gene

Sequence variations from dbSNP and Humsavar for RARRES1 Gene

SNP ID Clin Chr 03 pos Sequence Context AA Info Type
rs1000002439 -- 158,713,532(+) TTCTC(-/TCCCAGGGGTCCCAAGGAAGAGGGAGG)TGATC intron-variant
rs1000041900 -- 158,719,365(+) CTCCC(A/G)GGTTC intron-variant
rs1000088176 -- 158,697,939(+) CAGTA(G/T)AATCA nc-transcript-variant, reference, missense
rs1000300190 -- 158,701,186(+) TCTCA(A/G)TTCAT intron-variant
rs1000301221 -- 158,729,394(+) ATTTT(A/G)TTTTC intron-variant

Structural Variations from Database of Genomic Variants (DGV) for RARRES1 Gene

Variant ID Type Subtype PubMed ID
esv2763312 CNV gain 21179565
nsv1004124 CNV gain 25217958
nsv1007141 CNV loss 25217958
nsv1014255 CNV gain 25217958

Variation tolerance for RARRES1 Gene

Residual Variation Intolerance Score: 59% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 6.35; 76.85% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for RARRES1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for RARRES1 Gene

Disorders for RARRES1 Gene

Relevant External Links for RARRES1

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for RARRES1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for RARRES1 Gene

Publications for RARRES1 Gene

  1. Tazarotene-induced gene 1 (TIG1), a novel retinoic acid receptor- responsive gene in skin. (PMID: 8601727) Nagpal S. … Chandraratna R.A.S. (J. Invest. Dermatol. 1996) 2 3 4 22 64
  2. Tumor suppressor RARRES1 interacts with cytoplasmic carboxypeptidase AGBL2 to regulate the I+-tubulin tyrosination cycle. (PMID: 21303978) Sahab Z.J. … Byers S.W. (Cancer Res. 2011) 3 4 64
  3. Involvement of tazarotene-induced gene 1 in proliferation and differentiation of human adipose tissue-derived mesenchymal stem cells. (PMID: 19250291) Ohnishi S. … Nagaya N. (Cell Prolif. 2009) 3 22 64
  4. Sequential use of transcriptional profiling, expression quantitative trait mapping, and gene association implicates MMP20 in human kidney aging. (PMID: 19834535) Wheeler H.E. … Kim S.K. (PLoS Genet. 2009) 3 46 64
  5. DNA methylation of genes linked to retinoid signaling in squamous cell carcinoma of the esophagus: DNA methylation of CRBP1 and TIG1 is associated with tumor stage. (PMID: 16128742) Mizuiri H. … Yasui W. (Cancer Sci. 2005) 3 22 64

Products for RARRES1 Gene

Sources for RARRES1 Gene

Loading form....