Set Analyses:
Advanced Search

Advanced Search

Search By
Section (entire)

or upload a file of gene symbols

Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21

RAD54B Gene

protein-coding   GIFtS: 63
GCID: GC08M095384

RAD54 Homolog B (S. Cerevisiae)

Microbiology & Infectious Diseases Congress
  See related diseases

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

RAD54 Homolog B (S. Cerevisiae)1 2
DNA Repair And Recombination Protein RAD54B2
EC 3.6.4.-3
RAD54 Homolog B3
EC 3.6.18

External Ids:    HGNC: 172281   Entrez Gene: 257882   Ensembl: ENSG000001972757   OMIM: 6042895   UniProtKB: Q9Y6203   

Export aliases for RAD54B gene to outside databases

Previous GC identifers: GC08M094130 GC08M095230 GC08M095052 GC08M095340 GC08M095453 GC08M090593

(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for RAD54B Gene:
The protein encoded by this gene belongs to the DEAD-like helicase superfamily. It shares similarity with
Saccharomyces cerevisiae RAD54 and RDH54, both of which are involved in homologous recombination and repair of
DNA. This protein binds to double-stranded DNA, and displays ATPase activity in the presence of DNA. This gene is
highly expressed in testis and spleen, which suggests active roles in meiotic and mitotic recombination.
Homozygous mutations of this gene were observed in primary lymphoma and colon cancer. (provided by RefSeq, Jul

GeneCards Summary for RAD54B Gene: 
RAD54B (RAD54 homolog B (S. cerevisiae)) is a protein-coding gene. Diseases associated with RAD54B include hereditary pancreatitis, and colon cancer, and among its related super-pathways are Homologous recombination. GO annotations related to this gene include DNA helicase activity and DNA translocase activity.

UniProtKB/Swiss-Prot: RA54B_HUMAN, Q9Y620
Function: Involved in DNA repair and mitotic recombination. May play an active role in recombination processes in
concert with other members of the RAD52 epistasis group

Gene Wiki entry for RAD54B Gene

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 73), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000008.10  NC_018919.2  NT_008046.16  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the RAD54B gene promoter:
         Pbx1a   AML1a   MEF-2   Evi-1   GATA-1   MEF-2A   POU2F1a   FOXJ2 (long isoform)   FOXJ2   aMEF-2   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmids (see all 2): RAD54B promoter sequence
   Search SABiosciences Chromatin IP Primers for RAD54B

QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat RAD54B

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 8q22.1   Ensembl cytogenetic band:  8q22.1   HGNC cytogenetic band: 8q22.1

RAD54B Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
RAD54B gene location

GeneLoc information about chromosome 8         GeneLoc Exon Structure

GeneLoc location for GC08M095384:  view genomic region     (about GC identifiers)

95,384,188 bp from pter      End:
95,487,343 bp from pter
103,156 bases      Orientation:
minus strand

(According to UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MAXQB RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Ontologies according to Gene Ontology Consortium 01 Oct 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

UniProtKB/Swiss-Prot: RA54B_HUMAN, Q9Y620 (See protein sequence)
Recommended Name: DNA repair and recombination protein RAD54B  
Size: 910 amino acids; 102967 Da
Subunit: Interacts with RAD51 through the NH2-terminal domain. Immunoprecipitation experiments show that the
interaction is constitutive and not induced by ionizing radiation. The interaction may be indirect
Subcellular location: Nucleus (Probable)
Secondary accessions: F6WBS8
Alternative splicing: 2 isoforms:  Q9Y620-1   Q9Y620-2   (No experimental confirmation available)

Explore the universe of human proteins at neXtProt for RAD54B: NX_Q9Y620

Explore proteomics data for RAD54B at MOPED 

Post-translational modifications:

  • View modification sites using PhosphoSitePlus
  • View neXtProt modification sites for NX_Q9Y620

  • 4/7 DME Specific Peptides for RAD54B (Q9Y620) (see all 7)

    RAD54B Protein expression data from MOPED1, PaxDb2 and MAXQB3 :    About this image 

    RAD54B Protein Expression
    REFSEQ proteins (3 alternative transcripts): 
    NP_001192191.1  NP_001192192.1  NP_036547.1  

    ENSEMBL proteins: 
     ENSP00000336606   ENSP00000430808   ENSP00000430570   ENSP00000428554   ENSP00000430153  

    Human Recombinant Protein Products for RAD54B: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    Browse OriGene Protein Over-expression Lysates
    OriGene Custom MassSpec 
    OriGene Custom Protein Services for RAD54B
    GenScript Custom Purified and Recombinant Proteins Services for RAD54B
    Novus Biologicals RAD54B Proteins
    Novus Biologicals RAD54B Lysates
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates 
    Browse ProSpec Recombinant Proteins
    Browse Proteins at Cloud-Clone Corp. 

    Gene Ontology (GO): 1 cellular component term (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005634nucleus IEA--

    RAD54B for ontologies           About GeneDecksing

    RAD54B Antibody Products: 
    EMD Millipore Mono- and Polyclonal Antibodies for the study of RAD54B
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for RAD54B
    GenScript Custom Superior Antibodies Services for RAD54B
    Novus Biologicals RAD54B Antibodies
    Abcam antibodies for RAD54B
    Browse Antibodies at Cloud-Clone Corp. 
    ThermoFisher Antibodies for RAD54B
    LSBio Antibodies in human, mouse, rat for RAD54B 

    Assay Products for RAD54B: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for RAD54B
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for RAD54B
    Browse Enzo Life Sciences for kits & assays
    Browse ELISAs at Cloud-Clone Corp. 
    Browse CLIAs at Cloud-Clone Corp.

    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section
    4 InterPro protein domains:
     IPR000330 SNF2_N
     IPR027417 P-loop_NTPase
     IPR014001 Helicase_ATP-bd
     IPR001650 Helicase_C

    Graphical View of Domain Structure for InterPro Entry Q9Y620

    ProtoNet protein and cluster: Q9Y620

    1 Blocks protein domain: IPB000330 SNF2 related domain

    UniProtKB/Swiss-Prot: RA54B_HUMAN, Q9Y620
    Similarity: Belongs to the SNF2/RAD54 helicase family
    Similarity: Contains 1 helicase ATP-binding domain
    Similarity: Contains 1 helicase C-terminal domain

    RAD54B for domains           About GeneDecksing

    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, Vector BioLabs, and Sirion Biotech, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene.)
    About This Section

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: RA54B_HUMAN, Q9Y620
    Function: Involved in DNA repair and mitotic recombination. May play an active role in recombination processes in
    concert with other members of the RAD52 epistasis group

         Genatlas biochemistry entry for RAD54B:
    yeast (S cerevisiae) RAD54 homolog,recombination gene,highly expressed in testis and spleen,homozygously mutated
    in primary lymphoma and colon cancer

         Enzyme Numbers (IUBMB): EC 3.6.12 EC 3.6.4.-1

         Gene Ontology (GO): 5/8 molecular function terms (GO ID links to tree view) (see all 8):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0003676nucleic acid binding ----
    GO:0003677DNA binding IEA--
    GO:0003678DNA helicase activity TAS10362364
    GO:0003724RNA helicase activity TAS10362364
    GO:0004386helicase activity ----
    RAD54B for ontologies           About GeneDecksing

         4 MGI mutant phenotypes (inferred from 1 allele(MGI details for Rad54b):
     cellular  hematopoietic system  homeostasis/metabolism  mortality/aging 

    RAD54B for phenotypes           About GeneDecksing

    Animal Models:
         MGI mouse knock-out Rad54btm1Roka for RAD54B

       inGenious Targeting Laboratory - Custom generated mouse model solutions for RAD54B 
       inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for RAD54B

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for RAD54B 
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for RAD54B 

    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat RAD54B
    4 QIAGEN miScript miRNA Assays for microRNAs that regulate RAD54B:
    hsa-miR-942 hsa-miR-129-5p hsa-miR-765 hsa-miR-421
    SwitchGear 3'UTR luciferase reporter plasmidRAD54B 3' UTR sequence
    Inhib. RNA
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for RAD54B
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat RAD54B

    Gene Editing
    DNA2.0 Custom Protein Engineering Service for RAD54B
    Sirion Biotech Customized adenovirus for overexpression of RAD54B

    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene clones in human, mouse for RAD54B (see all 4)
    OriGene ORF clones in mouse, rat for RAD54B
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 3): RAD54B (NM_001205262)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for RAD54B
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat RAD54B
    Sirion Biotech Customized lentivirus for stable overexpression of RAD54B 
                         Customized lentivirus expression plasmids for stable overexpression of RAD54B 

    Cell Line
    GenScript Custom overexpressing Cell Line Services for RAD54B
    Search LifeMap BioReagents cell lines for RAD54B
    In Situ Assay

    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for RAD54B

    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene).
    About This Section

    SuperPaths for RAD54B About                                                                                                See pathways by source

    SuperPathContained pathways About
    1Homologous recombination
    Homologous recombination0.40
    Homologous recombination0.40

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways

    1 EMD Millipore Pathway for RAD54B

    1 BioSystems Pathway for RAD54B
        Homologous recombination

    1         Kegg Pathway  (Kegg details for RAD54B):
        Homologous recombination

    RAD54B for pathways           About GeneDecksing


        SABiosciences Gene Network CentralTM Interacting Genes and Proteins Network for RAD54B

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    5/44 Interacting proteins for RAD54B (Q9Y6202, 3 ENSP000003366064) via UniProtKB, MINT, STRING, and/or I2D (see all 44)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    CSNK1EP496742, 3, ENSP000003529294MINT-67588 I2D: score=5 STRING: ENSP00000352929
    DYRK2Q926302, 3, ENSP000003421054MINT-67527 I2D: score=5 STRING: ENSP00000342105
    LNX1Q8TBB12, 3, ENSP000002639254MINT-68231 I2D: score=5 STRING: ENSP00000263925
    TRAPPC6AO758652, 3, ENSP000000062754MINT-67956 I2D: score=5 STRING: ENSP00000006275
    PSMA1P257862, 3MINT-67096 I2D: score=5 
    About this table

    Gene Ontology (GO): 4 biological process terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000724double-strand break repair via homologous recombination IDA16428451
    GO:0006312mitotic recombination TAS10362364
    GO:0007131reciprocal meiotic recombination TAS10362364
    GO:0032508DNA duplex unwinding TAS10362364

    RAD54B for ontologies           About GeneDecksing

    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section
    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for RAD54B (RA54B)

    Search CenterWatch for drugs/clinical trials and news about RAD54B / RA54B

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Sirion Biotech, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for RAD54B gene (5 alternative transcripts): 
    NM_001205262.2  NM_001205263.1  NM_012415.3  NM_006550.1  NM_134434.1  

    Unigene Cluster for RAD54B:

    RAD54 homolog B (S. cerevisiae)
    Hs.744229  [show with all ESTs]
    Unigene Representative Sequence: NM_001205262
    8 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000336148(uc010may.2 uc003ygk.3 uc003ygl.2) ENST00000519348
    ENST00000518358 ENST00000463267 ENST00000523192 ENST00000518998 ENST00000523839
    Congresses - knowledge worth sharing:  
    European Congress of Clinical Microbiology and Infectious Diseases (ECCMID) 10 - 13 May 2014

    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat RAD54B
    4 QIAGEN miScript miRNA Assays for microRNAs that regulate RAD54B:
    hsa-miR-942 hsa-miR-129-5p hsa-miR-765 hsa-miR-421
    SwitchGear 3'UTR luciferase reporter plasmidRAD54B 3' UTR sequence
    Inhib. RNA
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for RAD54B
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat RAD54B
    OriGene clones in human, mouse for RAD54B (see all 4)
    OriGene ORF clones in mouse, rat for RAD54B
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 3): RAD54B (NM_001205262)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for RAD54B
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat RAD54B
    Sirion Biotech Customized lentivirus for stable overexpression of RAD54B 
                         Customized lentivirus expression plasmids for stable overexpression of RAD54B 
    OriGene qPCR primer pairs and template standards for RAD54B
    OriGene qSTAR qPCR primer pairs in human, mouse for RAD54B
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat RAD54B
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat RAD54B
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat RAD54B

    Additional mRNA sequence: 

    AF086020.1 AF112481.1 AK290437.1 AK307516.1 AL133578.1 BC001965.2 BC020668.1 BC033710.2 

    10 DOTS entries:

    DT.306247  DT.105675  DT.91939615  DT.102836258  DT.121478779  DT.121478780  DT.121478762  DT.121478774 
    DT.92422333  DT.97824274 

    24/70 AceView cDNA sequences (see all 70):

    BC020668 BE888572 AF112481 BC033710 AA973748 BX955743 H88371 AW151987 
    BC001965 AF007866 NM_006550 BM930136 AL523600 NM_012415 BU538087 CR602319 
    H88433 BX955752 NM_134434 AF086020 BU956980 BX283391 CB145803 BF697708 

    GeneLoc Exon Structure

    5/6 Alternative Splicing Database (ASD) splice patterns (SP) for RAD54B (see all 6)    About this scheme

    ExUns: 1a · 1b ^ 2 ^ 3 ^ 4a · 4b ^ 5 ^ 6 ^ 7 ^ 8a · 8b ^ 9a · 9b ^ 10 ^ 11a · 11b ^ 12a · 12b ^ 13a · 13b
    SP1:                                -                                   -                                                   
    SP2:                          -     -                                                                                       
    SP5:                                                                                                  -                     

    ECgene alternative splicing isoforms for RAD54B

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    RAD54B expression in normal human tissues (normalized intensities)      RAD54B embryonic expression: see
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: --
    RAD54B Expression
    About this image

    RAD54B expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database 
     5/16 selected tissues (see all 16) fully expand
     Brain (Nervous System)    fully expand to see all 8 entries
             Adult Endothelial Cells Blood Brain Barrier
     Neural Tube (Nervous System)    fully expand to see all 3 entries
     Eye (Sensory Organs)
     Thymus (Hematopoietic System)
     Gut Tube (Gastrointestinal Tract)

    See RAD54B Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for RAD54B

    SOURCE GeneReport for Unigene cluster: Hs.744229

    UniProtKB/Swiss-Prot: RA54B_HUMAN, Q9Y620
    Tissue specificity: Abundantly expressed in testis and spleen. Relatively low levels observed in thymus, prostate,
    ovary and colon

        SABiosciences Custom PCR Arrays for RAD54B
    OriGene qPCR primer pairs and template standards for RAD54B
    OriGene qSTAR qPCR primer pairs in human, mouse for RAD54B
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat RAD54B
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat RAD54B
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat RAD54B
    In Situ
    Assay Products:

    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for RAD54B

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of animals and fungi.

    Orthologs for RAD54B gene from 7/18 species (see all 18)    About this table
    Organism Taxonomic
    Gene Description Human
    (Mus musculus)
    Mammalia Rad54b1 , 5 RAD54 homolog B (S. cerevisiae)1, 5 83.03(n)1
      4 (5.11 cM)5
    6234741  NM_001039556.31  NP_001034645.11 
    (Gallus gallus)
    Aves RAD54B1 RAD54 homolog B (S. cerevisiae) 72.12(n)
      395449  NM_204710.1  NP_990041.1 
    (Anolis carolinensis)
    Reptilia RAD54B6
    Uncharacterized protein
    1 ↔ 1
    African clawed frog
    (Xenopus laevis)
    Amphibia Xl.320662 Xenopus laevis transcribed sequence with weak similarity more 75.95(n)    BJ627295.1 
    (Danio rerio)
    Actinopterygii rad54b1 RAD54 homolog B (S. cerevisiae) 58.42(n)
      560482  XM_683887.5  XP_688979.3 
    (Anopheles gambiae)
    Insecta AgaP_AGAP0069451 AGAP006945-PA 48.55(n)
      1270139  XM_308811.4  XP_308811.4 
    baker's yeast
    (Saccharomyces cerevisiae)
    Saccharomycetes RDH54(YBR073W)4
    DNA-dependent ATPase, stimulates strand exchange by more4
    8523651, 4  NP_009629.61  NP_009629.24 

    ENSEMBL Gene Tree for RAD54B (if available)
    TreeFam Gene Tree for RAD54B (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to Build 68)
    About This Section
    Paralogs for RAD54B gene
    2 SIMAP similar genes for RAD54B using alignment to 4 protein entries:     RA54B_HUMAN (see all proteins):
    DKFZp434J1672    RAD54L

    RAD54B for paralogs           About GeneDecksing

    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/2001 SNPs in RAD54B are shown (see all 2001)    About this table     
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    Chr 8 posSequence#AA
    A colon cancer sample4--see VAR_0195632 D Y mis40--------
    C,FA non-Hodgkin lymphoma sample4 pathogenic195560378(+) GGTGAT/CTGCAC 4 /N /S mis13Minor allele frequency- C:0.02EA NA 640
    C--90625080(+) GCAGT-/ATGTTTG 2 -- int10--------
    A--90643779(+) aaaaaA/Tatata 2 -- int1 trp30--------
    C--90670210(+) GCATG-/CA    
    2 -- int10--------
    C--95385638(+) TGGCC-/TTATGG 2 -- int12Minor allele frequency- T:0.00NA CSA 4
    C--95390204(+) AAAAA-/AAAGATTC 2 -- int11Minor allele frequency- AAA:0.00NA 2
    C--95393356(+) CTTTT-/AAAAAA 2 -- int11Minor allele frequency- A:0.00NA 2
    C--95396441(+) GCAAC-/ATTATT 2 -- int11Minor allele frequency- A:0.00NA 2
    C--95396749(+) TAGAT-/TTCAGTTTTGT
    2 -- int11Minor allele frequency- TTCAGTTTTGTTTGCAAAACTGAA:0.00NA 2

    HapMap Linkage Disequilibrium report for RAD54B (95384188 - 95487343 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 3 variations for RAD54B:    About this table     
    Variant IDTypeSubtypePubMed ID
    nsv6313CNV Insertion18451855
    nsv891202CNV Loss21882294
    nsv831401CNV Loss17160897

    Human Gene Mutation Database (HGMD): RAD54B
    SABiosciences Cancer Mutation PCR Assays
    SeqTarget long-range PCR primers for resequencing RAD54B
    DNA2.0 Custom Variant and Variant Library Synthesis for RAD54B

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section
    OMIM gene information: 604289    OMIM disorders: --

    14 diseases for RAD54B:    About MalaCards
    hereditary pancreatitis    colon cancer    nijmegen breakage syndrome    werner syndrome
    cervical cancer    pneumonia    pancreatitis    multiple sclerosis
    pancreatic cancer    cervicitis    tuberculosis    colorectal cancer
    breast cancer    prostatitis

    RAD54B for disorders           About GeneDecksing

    1 Novoseek inferred disease relationship for RAD54B gene    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    tumors 0 2 15056673 (1)

    Genetic Association Database (GAD): RAD54B
    Human Genome Epidemiology (HuGE) Navigator: RAD54B (10 documents)

    Export disorders for RAD54B gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for RAD54B gene, integrated from 9 sources (see all 40):
    (articles sorted by number of sources associating them with RAD54B)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Mutations of a novel human RAD54 homologue, RAD54B, in primary cancer. (PubMed id 10362364)1, 2, 3, 9 Hiramoto T.... Kamiya K. (1999)
    2. A novel human rad54 homologue, Rad54B, associates with Rad51. (PubMed id 10851248)1, 2, 3, 9 Tanaka K....Miyagawa K. (2000)
    3. Human Rad54B is a double-stranded DNA-dependent ATPase and has biochemical properties different from its structural homolog in yeast, Tid1/Rdh54. (PubMed id 11884632)1, 2, 9 Tanaka K.... Miyagawa K. (2002)
    4. Gamma-radiation sensitivity and polymorphisms in RAD5 1L1 modulate glioma risk. (PubMed id 20610542)1, 4 Liu Y....Bondy M.L. (2010)
    5. Variation within DNA repair pathway genes and risk of multiple sclerosis. (PubMed id 20522537)1, 4 Briggs F.B....Barcellos L.F. (2010)
    6. Polymorphic variants in hereditary pancreatic cancer genes are not associated with pancreatic cancer risk. (PubMed id 19690177)1, 4 McWilliams R.R....Petersen G.M. (2009)
    7. Common genetic variation in candidate genes and susceptibility to subtypes of breast cancer. (PubMed id 19124506)1, 4 Mavaddat N....Pharoah P.D. (2009)
    8. Explorative study to identify novel candidate genes r elated to oxaliplatin efficacy and toxicity using a DNA repair array. (PubMed id 19536092)1, 4 Kweekel D.M....Guchelaar H.J. (2009)
    9. Common Variants in Immune and DNA Repair Genes and Risk for Human Papillomavirus Persistence and Progression to Cervical Cancer. (PubMed id 19012493)1, 4 Wang S.S....Hildesheim A. (2009)
    10. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S....Malek J. (2004)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
    Free Text  

      Query String
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 25788 HGNC: 17228 AceView: FSBP Ensembl:ENSG00000197275 euGenes: HUgn25788
    ECgene: RAD54B Kegg: 25788 H-InvDB: RAD54B

    (According to HUGE)
    About This Section

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    PharmGKB entry for RAD54B Pharmacogenomics, SNPs, Pathways
    ATLAS Chromosomes in Cancer entry for RAD54B Genetics and Cytogenetics in Oncology and Haematology

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for RAD54B gene:
    Search GeneIP for patents involving RAD54B

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search

    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Sirion Biotech, Cell lines from GenScript, and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

     Browse Small Molecules at EMD Millipore
     Browse Kits and Assays available from EMD Millipore
     Browse for Gene Knock-down Tools from EMD Millipore
     Browse Purified and Recombinant Proteins at EMD Millipore
     Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
     EMD Millipore Mono- and Polyclonal Antibodies for the study of RAD54B
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Protease Activity Assays and Reagents   Browse Recombinant/Natural Proteins  
     Browse Stem Cell Products   Browse Tocris Biochemicals & Compounds  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for RAD54B  
     OriGene qPCR primer pairs and template standards for RAD54B   Browse OriGene Protein Over-expression Lysates  
     OriGene Custom Mass Spec   OriGene clones in human, mouse for RAD54B  
     OriGene qSTAR qPCR primer pairs in human, mouse for RAD54B   Browse OriGene full length recombinant human proteins expressed in human HEK293 cells  
     OriGene ORF clones in mouse, rat for RAD54B   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for RAD54B   OriGene Custom Protein Services for RAD54B  

     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat RAD54B
     QIAGEN SeqTarget long-range PCR primers for resequencing RAD54B
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat RAD54B
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat RAD54B
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat RAD54B
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat RAD54B
     GenScript Custom Purified and Recombinant Proteins Services for RAD54B GenScript cDNA clones with any tag delivered in your preferred vector for RAD54B
     GenScript Custom Assay Services for RAD54B GenScript Custom Superior Antibodies Services for RAD54B
     GenScript Custom overexpressing Cell Line Services for RAD54B CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in RAD54B promoter
     Search Chromatin IP Primers for RAD54B
     RT2 qPCR Primer Assay in human, mouse, rat RAD54B
     GNC Network for RAD54B
     SABiosciences Custom PCR Arrays for RAD54B
     Search Tocris compounds for RAD54B (RA54B)
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     RAD54B antibodies
     RAD54B proteins
     RAD54B lysates
     Antibodies for RAD54B
     See all of Abcam's Antibodies, Kits and Proteins for RAD54B
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins

     Browse Proteins at Cloud-Clone Corp.
     Browse Antibodies at Cloud-Clone Corp.
     Browse ELISAs at Cloud-Clone Corp.
     Browse CLIAs at Cloud-Clone Corp.
     Search LifeMap BioReagents cell lines for RAD54B
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for RAD54B
     SwitchGear 3'UTR luciferase reporter plasmids for RAD54B
     SwitchGear Promoter luciferase reporter plasmids for RAD54B
     ThermoFisher Antibodies for RAD54B
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat RAD54B
     inGenious Targeting Laboratory - Custom generated mouse model solutions for RAD54B
     inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for RAD54B
     lentivirus for stable overexpression of RAD54B
     lentivirus expression plasmids for stable overexpression of RAD54B
     adenovirus for overexpression of RAD54B
     LSBio Antibodies in human, mouse, rat for RAD54B
    Customized transgenic rodents for:
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
    GeneCards Homepage - Last full update: 23 Oct 2013 - Incrementals: 3 Nov 2013 , 7 Nov 2013 , 23 Jan 2014

    View Random Gene

    (GIFtS: 73)
    transforming growth factor, beta 1
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 

    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      RAD54B gene at Home site.
    hostname: index build: 106 solr: 1.4