Free for academic non-profit institutions. Other users need a Commercial license

Aliases for RAC3 Gene

Aliases for RAC3 Gene

  • Rac Family Small GTPase 3 2 3 5
  • Ras-Related C3 Botulinum Toxin Substrate 3 (Rho Family, Small GTP Binding Protein Rac3) 2 3
  • P21-Rac3 3 4
  • Ras-Related C3 Botulinum Toxin Substrate 3 3
  • Rho Family, Small GTP Binding Protein Rac3 3

External Ids for RAC3 Gene

Previous GeneCards Identifiers for RAC3 Gene

  • GC17P079412
  • GC17P9J0031
  • GC17P080525
  • GC17P077582
  • GC17P079989
  • GC17P075389

Summaries for RAC3 Gene

Entrez Gene Summary for RAC3 Gene

  • The protein encoded by this gene is a GTPase which belongs to the RAS superfamily of small GTP-binding proteins. Members of this superfamily appear to regulate a diverse array of cellular events, including the control of cell growth, cytoskeletal reorganization, and the activation of protein kinases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]

GeneCards Summary for RAC3 Gene

RAC3 (Rac Family Small GTPase 3) is a Protein Coding gene. Among its related pathways are PAK Pathway and Beta-Adrenergic Signaling. Gene Ontology (GO) annotations related to this gene include GTP binding and calcium-dependent protein binding. An important paralog of this gene is RAC1.

UniProtKB/Swiss-Prot for RAC3 Gene

  • Plasma membrane-associated small GTPase which cycles between an active GTP-bound and inactive GDP-bound state. In active state binds to a variety of effector proteins to regulate cellular responses, such as cell spreading and the formation of actin-based protusions including lamellipodia and membrane ruffles. Promotes cell adhesion and spreading on fibrinogen in a CIB1 and alpha-IIb/beta3 integrin-mediated manner.

Tocris Summary for RAC3 Gene

  • Small G proteins (small GTPases) are homologous to Galpha proteins and are often referred to as the Ras proto-oncogene superfamily. Small GTPases regulate a wide variety of processes in the cell, including growth, differentiation, movement and lipid vesicle transport.

Gene Wiki entry for RAC3 Gene

Additional gene information for RAC3 Gene

No data available for CIViC summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for RAC3 Gene

Genomics for RAC3 Gene

GeneHancer (GH) Regulatory Elements for RAC3 Gene

Promoters and enhancers for RAC3 Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH17I082030 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 550.8 -0.3 -284 2.6 SMAD1 ARID4B SIN3A ZNF2 POLR2B ZNF213 ZNF143 SP3 REST ZNF592 RAC3 DCXR CENPX GCGR LRRC45
GH17I082095 Promoter/Enhancer 2.9 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 2.8 +70.2 70186 13.5 CLOCK MLX ZFP64 DMAP1 YY1 SLC30A9 ZNF143 SP3 NFYC SSRP1 FASN CCDC57 TBCD ENSG00000262877 CEP131 LOC105371942 ALYREF WDR45B ARL16 DCXR
GH17I081056 Enhancer 1.4 Ensembl ENCODE dbSUPER 5.6 -973.9 -973885 2.8 HDGF PKNOX1 CLOCK ATF1 SIN3A GLIS2 CBX5 ATF7 ZNF263 REST RAC3 SLC26A11 BAIAP2 GC17M081121
GH17I082125 Enhancer 0.7 Ensembl ENCODE dbSUPER 7.9 +95.7 95720 3.2 GLIS1 CCDC57 RAC3 ACTG1 PIR53542 ENSG00000265678
GH17I082034 Enhancer 0.7 ENCODE 0.8 +3.3 3306 0.2 KLF1 SP3 RXRA SP2 MNT ZFP69B SP1 POLR2B ZNF692 POLR2A ENSG00000279372 DCXR ASPSCR1 RAC3
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around RAC3 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the RAC3 gene promoter:

Genomic Locations for RAC3 Gene

Genomic Locations for RAC3 Gene
chr17:82,031,624-82,034,204
(GRCh38/hg38)
Size:
2,581 bases
Orientation:
Plus strand
chr17:79,989,500-79,992,080
(GRCh37/hg19)

Genomic View for RAC3 Gene

Genes around RAC3 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
RAC3 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for RAC3 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for RAC3 Gene

Proteins for RAC3 Gene

  • Protein details for RAC3 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P60763-RAC3_HUMAN
    Recommended name:
    Ras-related C3 botulinum toxin substrate 3
    Protein Accession:
    P60763
    Secondary Accessions:
    • O14658
    • Q5U0M8

    Protein attributes for RAC3 Gene

    Size:
    192 amino acids
    Molecular mass:
    21379 Da
    Quaternary structure:
    • Interacts with the GEF protein DOCK7, which promotes the exchange between GDP and GTP, and therefore activates it. Interacts with C1D. Interacts (via C-terminal region) with CIB1; the interaction induces their association with the cytoskeleton upon alpha-IIb/beta3 integrin-mediated adhesion.

    Three dimensional structures from OCA and Proteopedia for RAC3 Gene

neXtProt entry for RAC3 Gene

Post-translational modifications for RAC3 Gene

  • (Microbial infection) Glycosylated at Tyr-32 by Photorhabdus asymbiotica toxin PAU_02230. Mono-O-GlcNAcylation by PAU_02230 inhibits downstream signaling by an impaired interaction with diverse regulator and effector proteins of Rac and leads to actin disassembly.
  • Ubiquitination at isoforms=153

Other Protein References for RAC3 Gene

No data available for DME Specific Peptides for RAC3 Gene

Domains & Families for RAC3 Gene

Gene Families for RAC3 Gene

Suggested Antigen Peptide Sequences for RAC3 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

P60763

UniProtKB/Swiss-Prot:

RAC3_HUMAN :
  • Belongs to the small GTPase superfamily. Rho family.
Family:
  • Belongs to the small GTPase superfamily. Rho family.
genes like me logo Genes that share domains with RAC3: view

Function for RAC3 Gene

Molecular function for RAC3 Gene

GENATLAS Biochemistry:
ras-related C3 botulinism toxin substrate 3,Ras-like protein 2,member of the Rho family of GTPase,specifically expressed in hemopoietic lineage,involved in the production of superoxide in neutrophils,putative regulator of mitogen-induced cytoskeletal changes,essential for membrane ruffling and C-jun aminoterminal kinase JNK,key downstream target in Ras signaling putatively mediated by EPS58 and SSH3BP1
UniProtKB/Swiss-Prot Function:
Plasma membrane-associated small GTPase which cycles between an active GTP-bound and inactive GDP-bound state. In active state binds to a variety of effector proteins to regulate cellular responses, such as cell spreading and the formation of actin-based protusions including lamellipodia and membrane ruffles. Promotes cell adhesion and spreading on fibrinogen in a CIB1 and alpha-IIb/beta3 integrin-mediated manner.
UniProtKB/Swiss-Prot Induction:
Expression down-regulated in quiescent fibroblasts and clearly induced by serum stimulation.

Phenotypes From GWAS Catalog for RAC3 Gene

Gene Ontology (GO) - Molecular Function for RAC3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003924 GTPase activity IDA,IEA 11956649
GO:0005515 protein binding IPI 11956649
GO:0005525 GTP binding IEA --
GO:0048306 calcium-dependent protein binding IPI 11756406
genes like me logo Genes that share ontologies with RAC3: view
genes like me logo Genes that share phenotypes with RAC3: view

Animal Models for RAC3 Gene

MGI Knock Outs for RAC3:

Clone Products

  • Addgene plasmids for RAC3

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for RAC3 Gene

Localization for RAC3 Gene

Subcellular locations from UniProtKB/Swiss-Prot for RAC3 Gene

Cytoplasm. Endomembrane system. Cell projection, lamellipodium. Cytoplasm, perinuclear region. Cell membrane. Cytoplasm, cytoskeleton. Note=Membrane-associated when activated. Colocalizes with NRBP to endomembranes and at the cell periphery in lamellipodia. Colocalized with CIB1 in the perinuclear area and at the cell periphery.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for RAC3 gene
Compartment Confidence
plasma membrane 5
extracellular 5
cytoskeleton 5
cytosol 5
nucleus 2
mitochondrion 1

Gene Ontology (GO) - Cellular Components for RAC3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005622 intracellular IEA --
GO:0005737 cytoplasm IEA --
GO:0005829 cytosol IEA,TAS --
GO:0005856 cytoskeleton IEA --
GO:0005886 plasma membrane TAS --
genes like me logo Genes that share ontologies with RAC3: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for RAC3 Gene

Pathways & Interactions for RAC3 Gene

genes like me logo Genes that share pathways with RAC3: view

SIGNOR curated interactions for RAC3 Gene

Is inactivated by:

Gene Ontology (GO) - Biological Process for RAC3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007264 small GTPase mediated signal transduction IEA --
GO:0014041 regulation of neuron maturation IEA --
GO:0021894 cerebral cortex GABAergic interneuron development IEA --
GO:0022604 regulation of cell morphogenesis IEA --
GO:0030031 cell projection assembly IDA 11956649
genes like me logo Genes that share ontologies with RAC3: view

Drugs & Compounds for RAC3 Gene

(5) Drugs for RAC3 Gene - From: ApexBio, HMDB, and Tocris

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Guanosine triphosphate Experimental Pharma 0
EHop-016 Pharma Rac1/Rac3 GTPase inhibitor,potent and specific 0
NSC 23766 Pharma Selective inhibitor of Rac1-GEF interaction., Selective inhibitor of Rac1-GEF interaction; antioncogenic 0

(2) Additional Compounds for RAC3 Gene - From: Tocris

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
SecinH3
853625-60-2

(5) Tocris Compounds for RAC3 Gene

Compound Action Cas Number
NSC 23766 Selective inhibitor of Rac1-GEF interaction; antioncogenic 1177865-17-6
QS 11 ARFGAP1 inhibitor; modulates Wnt/beta-catenin signaling 944328-88-5
Rac1 Inhibitor F56, control peptide Control peptide version of Rac1 Inhibitor W56 (Cat. No. 2221) 1315378-77-8
Rac1 Inhibitor W56 Selective inhibitor of Rac1-GEF interaction 1095179-01-3
SecinH3 Sec7-specific GEF inhibitor (cytohesins) 853625-60-2

(1) ApexBio Compounds for RAC3 Gene

Compound Action Cas Number
EHop-016 Rac1/Rac3 GTPase inhibitor,potent and specific 1380432-32-5
genes like me logo Genes that share compounds with RAC3: view

Drug Products

Transcripts for RAC3 Gene

Unigene Clusters for RAC3 Gene

Ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3):
Representative Sequences:

Clone Products

  • Addgene plasmids for RAC3

Alternative Splicing Database (ASD) splice patterns (SP) for RAC3 Gene

ExUns: 1a · 1b ^ 2a · 2b · 2c · 2d ^ 3 ^ 4a · 4b ^ 5 ^ 6a · 6b · 6c
SP1: - - - -
SP2: - - - -
SP3: - -
SP4: -
SP5:

Relevant External Links for RAC3 Gene

GeneLoc Exon Structure for
RAC3
ECgene alternative splicing isoforms for
RAC3

Expression for RAC3 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for RAC3 Gene

mRNA differential expression in normal tissues according to GTEx for RAC3 Gene

This gene is overexpressed in Brain - Cerebellum (x4.9) and Brain - Cerebellar Hemisphere (x4.6).

Protein differential expression in normal tissues from HIPED for RAC3 Gene

This gene is overexpressed in Brain (26.7), Fetal Brain (20.7), and Frontal cortex (14.1).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for RAC3 Gene



Protein tissue co-expression partners for RAC3 Gene

NURSA nuclear receptor signaling pathways regulating expression of RAC3 Gene:

RAC3

SOURCE GeneReport for Unigene cluster for RAC3 Gene:

Hs.45002

mRNA Expression by UniProt/SwissProt for RAC3 Gene:

P60763-RAC3_HUMAN
Tissue specificity: Highest levels in brain, also detected in heart, placenta and pancreas.

Evidence on tissue expression from TISSUES for RAC3 Gene

  • Nervous system(4.3)
genes like me logo Genes that share expression patterns with RAC3: view

No data available for Phenotype-based relationships between genes and organs from Gene ORGANizer for RAC3 Gene

Orthologs for RAC3 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for RAC3 Gene

Organism Taxonomy Gene Similarity Type Details
dog
(Canis familiaris)
Mammalia RAC3 34
  • 97 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia -- 34
  • 92 (a)
ManyToMany
cow
(Bos Taurus)
Mammalia RAC3 33 34
  • 91.49 (n)
chimpanzee
(Pan troglodytes)
Mammalia RAC3 34
  • 90 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Rac3 33 16 34
  • 89.41 (n)
rat
(Rattus norvegicus)
Mammalia Rac3 33
  • 89.26 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia -- 34
  • 70 (a)
ManyToMany
chicken
(Gallus gallus)
Aves RAC3 33 34
  • 82.12 (n)
lizard
(Anolis carolinensis)
Reptilia -- 34
  • 99 (a)
ManyToMany
tropical clawed frog
(Silurana tropicalis)
Amphibia rac3 33
  • 79.69 (n)
zebrafish
(Danio rerio)
Actinopterygii rac3b 34
  • 96 (a)
ManyToMany
rac3a 33
  • 79.17 (n)
fruit fly
(Drosophila melanogaster)
Insecta Rac1 35 34
  • 89 (a)
Rac2 35 34
  • 86 (a)
Mtl 35
  • 68 (a)
RhoL 35
  • 54 (a)
worm
(Caenorhabditis elegans)
Secernentea ced-10 35 33
  • 69.3 (n)
mig-2 35 34
  • 65 (a)
F22E12.2 35
  • 47 (a)
Y32F6B.3 35
  • 43 (a)
thale cress
(Arabidopsis thaliana)
eudicotyledons RAC2 33
  • 58.87 (n)
rice
(Oryza sativa)
Liliopsida Os02g0312600 33
  • 64.55 (n)
corn
(Zea mays)
Liliopsida Zm.289 33
Species where no ortholog for RAC3 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for RAC3 Gene

ENSEMBL:
Gene Tree for RAC3 (if available)
TreeFam:
Gene Tree for RAC3 (if available)

Paralogs for RAC3 Gene

Paralogs for RAC3 Gene

genes like me logo Genes that share paralogs with RAC3: view

Variants for RAC3 Gene

Sequence variations from dbSNP and Humsavar for RAC3 Gene

SNP ID Clin Chr 17 pos Variation AA Info Type
rs1064797229 uncertain-significance, not provided 82,032,787(+) G/A coding_sequence_variant, missense_variant
rs1001060305 -- 82,031,245(+) C/T upstream_transcript_variant
rs1001188123 -- 82,032,059(+) G/C/T intron_variant
rs1001387664 -- 82,031,886(+) C/T intron_variant
rs1001611613 -- 82,031,547(+) CCCCGCCAGCCGCGCGGCCGGGCGCCCCCCGCC/CCCCGCC upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for RAC3 Gene

Variant ID Type Subtype PubMed ID
dgv5800n54 CNV loss 21841781
esv21913 CNV gain+loss 19812545
nsv1071415 CNV deletion 25765185
nsv1118776 CNV deletion 24896259
nsv428351 CNV gain 18775914
nsv457975 CNV loss 19166990
nsv470620 CNV loss 18288195
nsv576183 CNV loss 21841781
nsv576186 CNV loss 21841781
nsv952392 CNV deletion 24416366

Variation tolerance for RAC3 Gene

Residual Variation Intolerance Score: 23.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.26; 5.74% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for RAC3 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
RAC3

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for RAC3 Gene

Disorders for RAC3 Gene

Additional Disease Information for RAC3

No disorders were found for RAC3 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for RAC3 Gene

Publications for RAC3 Gene

  1. The small GTPase Rac3 interacts with the integrin-binding protein CIB and promotes integrin alpha(IIb)beta(3)-mediated adhesion and spreading. (PMID: 11756406) Haataja L … Heisterkamp N (The Journal of biological chemistry 2002) 3 4 22 58
  2. Interaction of the small GTPase Rac3 with NRBP, a protein with a kinase-homology domain. (PMID: 11956649) De Langhe S … Heisterkamp N (International journal of molecular medicine 2002) 3 4 22 58
  3. Characterization of RAC3, a novel member of the Rho family. (PMID: 9252344) Haataja L … Heisterkamp N (The Journal of biological chemistry 1997) 3 4 22 58
  4. Rac3 inhibits adhesion and differentiation of neuronal cells by modifying GIT1 downstream signaling. (PMID: 19494130) Hajdo-Milasinovic A … Collard JG (Journal of cell science 2009) 3 22 58
  5. PAK is required for the disruption of E-cadherin adhesion by the small GTPase Rac. (PMID: 18319303) Lozano E … Braga VM (Journal of cell science 2008) 3 22 58

Products for RAC3 Gene

  • Addgene plasmids for RAC3

Sources for RAC3 Gene

Content
Loading form....