Free for academic non-profit institutions. Other users need a Commercial license

Aliases for RAC3 Gene

Aliases for RAC3 Gene

  • Ras-Related C3 Botulinum Toxin Substrate 3 (Rho Family, Small GTP Binding Protein Rac3) 2 3 5
  • P21-Rac3 3 4
  • Ras-Related C3 Botulinum Toxin Substrate 3 3
  • Rho Family, Small GTP Binding Protein Rac3 3

External Ids for RAC3 Gene

Previous GeneCards Identifiers for RAC3 Gene

  • GC17P079412
  • GC17P9J0031
  • GC17P080525
  • GC17P077582
  • GC17P079989
  • GC17P075389

Summaries for RAC3 Gene

Entrez Gene Summary for RAC3 Gene

  • The protein encoded by this gene is a GTPase which belongs to the RAS superfamily of small GTP-binding proteins. Members of this superfamily appear to regulate a diverse array of cellular events, including the control of cell growth, cytoskeletal reorganization, and the activation of protein kinases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]

GeneCards Summary for RAC3 Gene

RAC3 (Ras-Related C3 Botulinum Toxin Substrate 3 (Rho Family, Small GTP Binding Protein Rac3)) is a Protein Coding gene. Among its related pathways are Bisphosphonate Pathway, Pharmacodynamics and GPCR Pathway. GO annotations related to this gene include GTP binding and calcium-dependent protein binding. An important paralog of this gene is RAC1.

UniProtKB/Swiss-Prot for RAC3 Gene

  • Plasma membrane-associated small GTPase which cycles between an active GTP-bound and inactive GDP-bound state. In active state binds to a variety of effector proteins to regulate cellular responses, such as cell spreading and the formation of actin-based protusions including lamellipodia and membrane ruffles. Promotes cell adhesion and spreading on fibrinogen in a CIB1 and alpha-IIb/beta3 integrin-mediated manner.

Tocris Summary for RAC3 Gene

  • Small G proteins (small GTPases) are homologous to Galpha proteins and are often referred to as the Ras proto-oncogene superfamily. Small GTPases regulate a wide variety of processes in the cell, including growth, differentiation, movement and lipid vesicle transport.

Gene Wiki entry for RAC3 Gene

No data available for CIViC summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for RAC3 Gene

Genomics for RAC3 Gene

Regulatory Elements for RAC3 Gene

Enhancers for RAC3 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH17G082125 1.1 Ensembl ENCODE dbSUPER 7.9 +95.7 95721 3.2 FOXA2 ATF1 NRF1 KAT8 GATAD1 GLIS1 CREB1 HNRNPL CREM CCDC57 RAC3 ACTG1 PIR53542 ENSG00000265678
GH17G081056 1.5 Ensembl ENCODE dbSUPER 5.6 -973.9 -973885 2.8 HDGF PKNOX1 ATF1 SIN3A GLIS2 CBX5 GATA2 ELK1 KLF13 ZNF263 RAC3 SLC26A11 BAIAP2 GC17M081121
GH17G082095 2.1 FANTOM5 Ensembl ENCODE dbSUPER 2.7 +70.2 70186 13.5 MLX CREB3L1 AGO1 ZFP64 DMAP1 FEZF1 YY1 SLC30A9 ZNF143 ZNF263 CCDC57 ARL16 DCXR TSPAN10 ENSG00000262049 RFNG DUS1L HEXDC GCGR OXLD1
GH17G082030 1.1 ENCODE 0.7 -0.3 -285 2.6 FOXA2 CREB3L1 MLX AGO1 ARID4B SIN3A DMAP1 ZNF2 YY1 SLC30A9 DCXR ENSG00000262049 ENSG00000262663 ENSG00000262652 NARF-IT1 ARL2BPP9 OGFOD3 CENPX GCGR RAC3
GH17G082034 0.8 ENCODE 0.7 +3.3 3306 0.3 TBP AGO1 ZNF366 CREM THAP11 ZNF263 PAF1 SP3 TGIF2 ZFP69B DCXR ASPSCR1 RAC3 ENSG00000279372
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around RAC3 on UCSC Golden Path with GeneCards custom track

Promoters for RAC3 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000099522 -224 1601 FOXA2 CREB3L1 MLX AGO1 ARID4B SIN3A DMAP1 ZNF2 YY1 SLC30A9

Genomic Location for RAC3 Gene

Chromosome:
17
Start:
82,031,624 bp from pter
End:
82,034,204 bp from pter
Size:
2,581 bases
Orientation:
Plus strand

Genomic View for RAC3 Gene

Genes around RAC3 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
RAC3 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for RAC3 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for RAC3 Gene

Proteins for RAC3 Gene

  • Protein details for RAC3 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P60763-RAC3_HUMAN
    Recommended name:
    Ras-related C3 botulinum toxin substrate 3
    Protein Accession:
    P60763
    Secondary Accessions:
    • O14658
    • Q5U0M8

    Protein attributes for RAC3 Gene

    Size:
    192 amino acids
    Molecular mass:
    21379 Da
    Quaternary structure:
    • Interacts with the GEF protein DOCK7, which promotes the exchange between GDP and GTP, and therefore activates it. Interacts with C1D. Interacts (via C-terminal region) with CIB1; the interaction induces their association with the cytoskeleton upon alpha-IIb/beta3 integrin-mediated adhesion.

    Three dimensional structures from OCA and Proteopedia for RAC3 Gene

neXtProt entry for RAC3 Gene

Post-translational modifications for RAC3 Gene

  • (Microbial infection) Glycosylated at Tyr-32 by Photorhabdus asymbiotica toxin PAU_02230. Mono-O-GlcNAcylation by PAU_02230 inhibits downstream signaling by an impaired interaction with diverse regulator and effector proteins of Rac and leads to actin disassembly.
  • Ubiquitination at isoforms=153
  • Modification sites at PhosphoSitePlus

Other Protein References for RAC3 Gene

No data available for DME Specific Peptides for RAC3 Gene

Domains & Families for RAC3 Gene

Gene Families for RAC3 Gene

Suggested Antigen Peptide Sequences for RAC3 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

P60763

UniProtKB/Swiss-Prot:

RAC3_HUMAN :
  • Belongs to the small GTPase superfamily. Rho family.
Family:
  • Belongs to the small GTPase superfamily. Rho family.
genes like me logo Genes that share domains with RAC3: view

Function for RAC3 Gene

Molecular function for RAC3 Gene

GENATLAS Biochemistry:
ras-related C3 botulinism toxin substrate 3,Ras-like protein 2,member of the Rho family of GTPase,specifically expressed in hemopoietic lineage,involved in the production of superoxide in neutrophils,putative regulator of mitogen-induced cytoskeletal changes,essential for membrane ruffling and C-jun aminoterminal kinase JNK,key downstream target in Ras signaling putatively mediated by EPS58 and SSH3BP1
UniProtKB/Swiss-Prot Function:
Plasma membrane-associated small GTPase which cycles between an active GTP-bound and inactive GDP-bound state. In active state binds to a variety of effector proteins to regulate cellular responses, such as cell spreading and the formation of actin-based protusions including lamellipodia and membrane ruffles. Promotes cell adhesion and spreading on fibrinogen in a CIB1 and alpha-IIb/beta3 integrin-mediated manner.
UniProtKB/Swiss-Prot Induction:
Expression down-regulated in quiescent fibroblasts and clearly induced by serum stimulation.

Gene Ontology (GO) - Molecular Function for RAC3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003924 GTPase activity IDA 11956649
GO:0005515 protein binding IPI 11956649
GO:0005525 GTP binding IEA --
GO:0048306 calcium-dependent protein binding IPI 11756406
genes like me logo Genes that share ontologies with RAC3: view
genes like me logo Genes that share phenotypes with RAC3: view

Animal Models for RAC3 Gene

MGI Knock Outs for RAC3:

Animal Model Products

CRISPR Products

Inhibitory RNA Products

Clone Products

  • Addgene plasmids for RAC3
  • Applied Biological Materials Clones for RAC3

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for RAC3 Gene

Localization for RAC3 Gene

Subcellular locations from UniProtKB/Swiss-Prot for RAC3 Gene

Cytoplasm. Endomembrane system. Cell projection, lamellipodium. Cytoplasm, perinuclear region. Cell membrane. Cytoplasm, cytoskeleton. Note=Membrane-associated when activated. Colocalizes with NRBP to endomembranes and at the cell periphery in lamellipodia. Colocalized with CIB1 in the perinuclear area and at the cell periphery.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for RAC3 gene
Compartment Confidence
plasma membrane 5
extracellular 5
cytoskeleton 5
cytosol 5
nucleus 2
mitochondrion 1

Gene Ontology (GO) - Cellular Components for RAC3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005622 intracellular IEA --
GO:0005737 cytoplasm IEA --
GO:0005829 cytosol TAS --
GO:0005856 cytoskeleton IEA --
GO:0005886 plasma membrane TAS --
genes like me logo Genes that share ontologies with RAC3: view

Pathways & Interactions for RAC3 Gene

genes like me logo Genes that share pathways with RAC3: view

SIGNOR curated interactions for RAC3 Gene

Is inactivated by:

Gene Ontology (GO) - Biological Process for RAC3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007264 small GTPase mediated signal transduction IEA --
GO:0014041 regulation of neuron maturation IEA --
GO:0021894 cerebral cortex GABAergic interneuron development IEA --
GO:0022604 regulation of cell morphogenesis IEA --
GO:0030031 cell projection assembly IDA 11956649
genes like me logo Genes that share ontologies with RAC3: view

Drugs & Compounds for RAC3 Gene

(5) Drugs for RAC3 Gene - From: ApexBio, HMDB, and Tocris

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Guanosine triphosphate Experimental Pharma 0
EHop-016 Pharma Rac1/Rac3 GTPase inhibitor,potent and specific 0
EHT 1864 Pharma Rac family small GTPases inhibitor, Potent inhibitor of Rac family GTPases 0
NSC 23766 Pharma Selective inhibitor of Rac1-GEF interaction., Selective inhibitor of Rac1-GEF interaction; antioncogenic 0
ZCL278 Pharma Selective Cdc42 inhibitor, Cdc42 inhibitor 0

(2) Additional Compounds for RAC3 Gene - From: Tocris

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
CASIN
425399-05-9
SecinH3
853625-60-2

(5) Tocris Compounds for RAC3 Gene

Compound Action Cas Number
CASIN Cdc42 GTPase inhibitor 425399-05-9
EHT 1864 Potent inhibitor of Rac family GTPases 754240-09-0
NSC 23766 Selective inhibitor of Rac1-GEF interaction; antioncogenic 1177865-17-6
SecinH3 Sec7-specific GEF inhibitor (cytohesins) 853625-60-2
ZCL 278 Cdc42 inhibitor 587841-73-4

(1) ApexBio Compounds for RAC3 Gene

Compound Action Cas Number
EHop-016 Rac1/Rac3 GTPase inhibitor,potent and specific 1380432-32-5
genes like me logo Genes that share compounds with RAC3: view

Drug Products

Transcripts for RAC3 Gene

Unigene Clusters for RAC3 Gene

Ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3):
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

  • Addgene plasmids for RAC3
  • Applied Biological Materials Clones for RAC3

Alternative Splicing Database (ASD) splice patterns (SP) for RAC3 Gene

ExUns: 1a · 1b ^ 2a · 2b · 2c · 2d ^ 3 ^ 4a · 4b ^ 5 ^ 6a · 6b · 6c
SP1: - - - -
SP2: - - - -
SP3: - -
SP4: -
SP5:

Relevant External Links for RAC3 Gene

GeneLoc Exon Structure for
RAC3
ECgene alternative splicing isoforms for
RAC3

Expression for RAC3 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for RAC3 Gene

mRNA differential expression in normal tissues according to GTEx for RAC3 Gene

This gene is overexpressed in Brain - Cerebellum (x4.9) and Brain - Cerebellar Hemisphere (x4.6).

Protein differential expression in normal tissues from HIPED for RAC3 Gene

This gene is overexpressed in Brain (26.7), Fetal Brain (20.7), and Frontal cortex (14.1).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for RAC3 Gene



Protein tissue co-expression partners for RAC3 Gene

NURSA nuclear receptor signaling pathways regulating expression of RAC3 Gene:

RAC3

SOURCE GeneReport for Unigene cluster for RAC3 Gene:

Hs.45002

mRNA Expression by UniProt/SwissProt for RAC3 Gene:

P60763-RAC3_HUMAN
Tissue specificity: Highest levels in brain, also detected in heart, placenta and pancreas.

Evidence on tissue expression from TISSUES for RAC3 Gene

  • Nervous system(4.3)
genes like me logo Genes that share expression patterns with RAC3: view

Primer Products

No data available for Phenotype-based relationships between genes and organs from Gene ORGANizer for RAC3 Gene

Orthologs for RAC3 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for RAC3 Gene

Organism Taxonomy Gene Similarity Type Details
dog
(Canis familiaris)
Mammalia RAC3 35
  • 97 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia -- 35
  • 92 (a)
ManyToMany
cow
(Bos Taurus)
Mammalia RAC3 34 35
  • 91.49 (n)
chimpanzee
(Pan troglodytes)
Mammalia RAC3 35
  • 90 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Rac3 34 16 35
  • 89.41 (n)
rat
(Rattus norvegicus)
Mammalia Rac3 34
  • 89.26 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia -- 35
  • 70 (a)
ManyToMany
chicken
(Gallus gallus)
Aves RAC3 34 35
  • 82.12 (n)
lizard
(Anolis carolinensis)
Reptilia -- 35
  • 99 (a)
ManyToMany
tropical clawed frog
(Silurana tropicalis)
Amphibia rac3 34
  • 79.69 (n)
zebrafish
(Danio rerio)
Actinopterygii rac3b 35
  • 96 (a)
ManyToMany
rac3a 34
  • 79.17 (n)
fruit fly
(Drosophila melanogaster)
Insecta Rac1 36 35
  • 89 (a)
Rac2 36 35
  • 86 (a)
Mtl 36
  • 68 (a)
RhoL 36
  • 54 (a)
worm
(Caenorhabditis elegans)
Secernentea ced-10 36 34
  • 69.3 (n)
mig-2 36 35
  • 65 (a)
F22E12.2 36
  • 47 (a)
Y32F6B.3 36
  • 43 (a)
thale cress
(Arabidopsis thaliana)
eudicotyledons RAC2 34
  • 58.87 (n)
rice
(Oryza sativa)
Liliopsida Os02g0312600 34
  • 64.55 (n)
corn
(Zea mays)
Liliopsida Zm.289 34
Species where no ortholog for RAC3 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for RAC3 Gene

ENSEMBL:
Gene Tree for RAC3 (if available)
TreeFam:
Gene Tree for RAC3 (if available)

Paralogs for RAC3 Gene

Paralogs for RAC3 Gene

genes like me logo Genes that share paralogs with RAC3: view

Variants for RAC3 Gene

Sequence variations from dbSNP and Humsavar for RAC3 Gene

SNP ID Clin Chr 17 pos Sequence Context AA Info Type
rs1001060305 -- 82,031,245(+) CCTGC(C/T)GGGGT intron-variant, downstream-variant-500B, upstream-variant-2KB
rs1001188123 -- 82,032,059(+) GCCCT(C/G/T)TCCTC intron-variant
rs1001387664 -- 82,031,886(+) GGTGG(C/T)GCCCG intron-variant
rs1001611613 -- 82,031,547(+) CCCCG(-/CCCCGCCAGCCGCGCGGCCGGGCGCC)CCCCG intron-variant, downstream-variant-500B, upstream-variant-2KB
rs1002189287 -- 82,032,166(+) CCCCA(G/T)TGTGG intron-variant

Structural Variations from Database of Genomic Variants (DGV) for RAC3 Gene

Variant ID Type Subtype PubMed ID
dgv5800n54 CNV loss 21841781
esv21913 CNV gain+loss 19812545
nsv1071415 CNV deletion 25765185
nsv1118776 CNV deletion 24896259
nsv428351 CNV gain 18775914
nsv457975 CNV loss 19166990
nsv470620 CNV loss 18288195
nsv576183 CNV loss 21841781
nsv576186 CNV loss 21841781
nsv952392 CNV deletion 24416366

Variation tolerance for RAC3 Gene

Residual Variation Intolerance Score: 23.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.26; 5.74% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for RAC3 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
RAC3

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for RAC3 Gene

Disorders for RAC3 Gene

Relevant External Links for RAC3

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
RAC3

No disorders were found for RAC3 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for RAC3 Gene

Publications for RAC3 Gene

  1. Interaction of the small GTPase Rac3 with NRBP, a protein with a kinase-homology domain. (PMID: 11956649) De Langhe S. … Heisterkamp N. (Int. J. Mol. Med. 2002) 3 4 22 64
  2. The small GTPase Rac3 interacts with the integrin-binding protein CIB and promotes integrin alpha(IIb)beta(3)-mediated adhesion and spreading. (PMID: 11756406) Haataja L. … Heisterkamp N. (J. Biol. Chem. 2002) 3 4 22 64
  3. Characterization of RAC3, a novel member of the Rho family. (PMID: 9252344) Haataja L. … Heisterkamp N. (J. Biol. Chem. 1997) 3 4 22 64
  4. Rac3 inhibits adhesion and differentiation of neuronal cells by modifying GIT1 downstream signaling. (PMID: 19494130) Hajdo-Milasinovic A. … Collard J.G. (J. Cell. Sci. 2009) 3 22 64
  5. PAK is required for the disruption of E-cadherin adhesion by the small GTPase Rac. (PMID: 18319303) Lozano E. … Braga V.M. (J. Cell. Sci. 2008) 3 22 64

Products for RAC3 Gene

  • Addgene plasmids for RAC3

Sources for RAC3 Gene

Content
Loading form....