Home
GeneCards Guide
Suite
- MalaCards
- GeneALaCart
- GeneDecks
- GeneIP
- GeneLoc
Terms and Conditions
- Terms of Use
- 3rd Party Notice
About Us
User Feedback
Mirror sites

Set Analyses:

Generates a file of GeneCards annotations for your list of genes

Advanced Search

Search By

Section (entire)

for

All GeneCards Within gene subset (to enable gene prioritization):
or upload a file of gene symbols

Category Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21

GIFtS
-

RAC2 Gene

protein-coding GIFtS: 70
GCID: GC22M037621

ras-related C3 botulinum toxin substrate 2 (rho family,...

Explore 25 diseases affiliated with
RAC2 via

MalaCards

our new
Human Malady Compendium

(According to ¹HGNC, ²Entrez Gene,
³UniProtKB/Swiss-Prot, ⁴UniProtKB/TrEMBL, ⁵OMIM, ⁶GeneLoc, ⁷Ensembl, ⁸DME, ⁹miRBase, and/or ¹⁰fRNAdb)
About This Section

Aliases
Ras-Related C3 Botulinum Toxin Substrate 2 (Rho Family, Small GTP Binding Protein Rac2)¹ ²		HSPC022²
EN-7¹ ²		Ras-Related C3 Botulinum Toxin Substrate 2²
Small G Protein² ³		Ras-Related C3 Botulinum Toxin Substrate 3 (Rho Family, Small GTP-Binding Protein Rac2)²
P21-Rac2¹		Rho Family, Small GTP Binding Protein Rac2²
Gx²		GX³

External Ids:	HGNC: 9802¹	Entrez Gene: 5880²	Ensembl: ENSG00000128340⁷	OMIM: 602049⁵	UniProtKB: P15153³

Export aliases for RAC2 gene to outside databases

Previous GC identifers: GC22M034235 GC22M035864 GC22M035945 GC22M020586

(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for RAC2:

The protein encoded by this gene is a GTPase which belongs to the RAS superfamily of small GTP-binding proteins.

Members of this superfamily appear to regulate a diverse array of cellular events, including the control of cell

growth, cytoskeletal reorganization, and the activation of protein kinases. (provided by RefSeq, Jul 2008)

UniProtKB/Swiss-Prot: RAC2_HUMAN, P15153

Function: Plasma membrane-associated small GTPase which cycles between an active GTP-bound and inactive GDP-bound

state. In active state binds to a variety of effector proteins to regulate cellular responses, such as secretory

processes, phagocytose of apoptotic cells and epithelial cell polarization. Augments the production of reactive oxygen

species (ROS) by NADPH oxidase

summary for RAC2:

Small G proteins (small GTPases) are homologous to Galpha proteins and are often referred to as the Ras

proto-oncogene superfamily. The Ras superfamily contains over 100 small GTPases grouped into eight families;

Ras, Rho, Rab, Rap, Arf, Ran, Rheb and Rad. Small GTPases regulate a wide variety of processes in the cell,

including growth, differentiation, movement and lipid vesicle transport. Like Galpha proteins, small GTPases

alternate between an 'on' state (bound to GTP) and an 'off' state (bound to GDP). This cyclic process

requires guanine nucleotide exchange factor (GEF) and GTPase-activating protein (GAP). Small GTPases are the

downstream effectors of most receptor tyrosine kinases (RTKs) and are linked via two proteins, GRB2 and SOS.

They are coupled to intracellular signaling cascades including the MAPK pathway, through interactions with

Raf kinase. Normally, activation of small GTPases is induced by ligand binding to a RTK. In many transformed

cells activating mutations of GTPases, often Ras, produce a cellular response in the absence of a ligand,

thus promoting malignant progression.

Gene Wiki entry for RAC2

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section

RefSeq DNA sequence:

NC_000022.10 NC_018933.1 NT_011520.12

Regulatory elements:

SABiosciences Regulatory transcription factor binding sites in the RAC2 gene promoter:
FAC1 AML1a AP-1 ATF-2 Hand1 STAT3 c-Jun
Other transcription factors

SwitchGear Promoter luciferase reporter plasmid: RAC2 promoter sequence

Search SABiosciences Chromatin IP Primers for RAC2

Epigenetics:

QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat RAC2

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 22q13.1 Ensembl cytogenetic band: 22q13.1 HGNC cytogenetic band: 22q13.1

RAC2 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
RAC2 gene location

GeneLoc information about chromosome 22 GeneLoc Exon Structure

GeneLoc location for GC22M037621: view genomic region (about GC identifiers)

Start:	37,621,301 bp from pter	End:	37,640,488 bp from pter
Size:	19,188 bases	Orientation:	minus strand

(According to ¹UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to ²PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: RAC2_HUMAN, P15153 (See protein sequence)

Recommended Name: Ras-related C3 botulinum toxin substrate 2 precursor

Size: 192 amino acids; 21429 Da

Subunit: Interacts with DOCK2, which may activate it. Interacts with S100A8 and calprotectin (S100A8/9)

Subcellular location: Cytoplasm. Note=Membrane-associated when activated

4 PDB 3D structures from and Proteopedia for RAC2:

1DS6 (3D)

2W2T (3D)

2W2V (3D)

2W2X (3D)

Secondary accessions: Q9UDJ4

Explore the universe of human proteins at neXtProt for RAC2: NX_P15153

Post-translational modifications:

View modification sites using PhosphoSitePlus²

View neXtProt modification sites for NX_P15153

RAC2 Protein expression data from MOPED and PaxDb: About this image

REFSEQ proteins: NP_002863.1

ENSEMBL proteins:

ENSP00000249071 ENSP00000385270 ENSP00000385590 ENSP00000403778 ENSP00000385666

Reactome Protein details: P15153
Human Recombinant Protein Products:

	Browse Purified and Recombinant Proteins at EMD Millipore
	Browse R&D Systems for human recombinant proteins
	Browse recombinant and purified proteins available from Enzo Life Sciences
	Browse OriGene full length recombinant human proteins expressed in human HEK293 cells OriGene Protein Over-expression Lysate: RAC2 OriGene Custom Protein Services for RAC2
	GenScript Custom Purified and Recombinant Proteins Services for RAC2
	Novus Biologicals RAC2 Proteins Novus Biologicals RAC2 Lysate
	Browse Sino Biological Recombinant Proteins
	ProSpec Recombinant Protein for RAC2
	Browse Proteins at Uscn

Gene Ontology (GO): 5/7 cellular component terms (GO ID links to tree view) (see all 7): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0005622	intracellular	--	--
GO:0005624	membrane fraction	--	--
GO:0005635	nuclear envelope	IEA	--
GO:0005737	cytoplasm	--	--
GO:0005829	cytosol	TAS	--

RAC2 for ontologies About GeneDecksing

RAC2 Antibody Products:

	EMD Millipore Mono- and Polyclonal Antibodies for the study of RAC2
	Browse R&D Systems for Antibodies
	Cell Signaling Technology (CST) Antibodies for RAC2
	OriGene Antibodies: RAC2 OriGene Custom Antibody Services for RAC2
	GenScript Custom Superior Antibodies Services for RAC2
	Novus Biologicals RAC2 Antibodies
	Abcam antibodies for RAC2
	Browse Antibodies at Uscn
	ThermoFisher Antibody for RAC2

Assay Products for RAC2:

	EMD Millipore Kits and Assays for the Analysis of RAC2
	OriGene Custom Immunoassay Development Browse OriGene Fluorogenic Cell Assay Kits
	Browse R&D Systems for biochemical assays
	GenScript Custom Assay Services for RAC2
	Browse Enzo Life Sciences for kits & assays
	Browse ELISAs and CLIAs at Uscn

(According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section

RAC2 for domains About GeneDecksing

3 InterPro domains/families:

IPR003578 Small_GTPase_Rho

IPR005225 Small_GTP-bd_dom

IPR001806 Small_GTPase

Graphical View of Domain Structure for InterPro Entry P15153

ProtoNet protein and cluster: P15153

2 Blocks protein families:

IPB001806 Transforming protein P21 RAS signature

IPB003578 Ras small GTPase

UniProtKB/Swiss-Prot: RAC2_HUMAN, P15153

Similarity: Belongs to the small GTPase superfamily. Rho family

(According to ¹UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or ²DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
About This Section

Function Summary:

UniProtKB/Swiss-Prot: RAC2_HUMAN, P15153

Function: Plasma membrane-associated small GTPase which cycles between an active GTP-bound and inactive GDP-bound

state. In active state binds to a variety of effector proteins to regulate cellular responses, such as secretory

processes, phagocytose of apoptotic cells and epithelial cell polarization. Augments the production of reactive oxygen

species (ROS) by NADPH oxidase

Enzyme regulation: Regulated by guanine nucleotide exchange factors (GEFs) which promote the exchange of bound GDP for

free GTP, GTPase activating proteins (GAPs) which increase the GTP hydrolysis activity, and GDP dissociation

inhibitors which inhibit the dissociation of the nucleotide from the GTPase

Genatlas biochemistry entry for RAC2:

ras-related C3 botulinism toxin substrate 2,Ras-like protein,member of the Rho family of GTPase,specifically expressed

in hemopoietic lineage,involved in the production of superoxide in neutrophils,putative regulator of mitogen-induced

cytoskeletal changes essential for membrane ruffling,and C-jun aminoterminal kinase JNK,key downstream target in Ras

signaling putatively mediated by EPS58 and SSH3BP1

miRNA Products:		OriGene 3'-UTR Clone: RAC2 Browse MicroRNA Expression Plasmids
		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat RAC2
		3 QIAGEN miScript miRNA Assays for microRNAs that regulate RAC2:
		hsa-miR-1184 hsa-miR-378* hsa-miR-1205
		SwitchGear 3'UTR luciferase reporter plasmid: RAC2 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for RAC2 (see all 6) Browse OriGene siRNA
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat RAC2

Gene Editing
Products:

DNA2.0 Custom Protein Engineering Service for RAC2

Clone Products:		Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for RAC2 (see all 3) OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for RAC2 OriGene custom cloning services � gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector: RAC2 (NM_002872)
		Browse Sino Biological Human cDNA Clones
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for RAC2
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat RAC2

Cell Line Products:		GenScript Custom overexpressing Cell Line Services for RAC2
		Search LifeMap BioReagents cell lines for RAC2

In Situ Assay
Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for RAC2

Gene Ontology (GO): 2 molecular function terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0003924	GTPase activity	IEA	--
GO:0005525	GTP binding	IEA	--

RAC2 for ontologies About GeneDecksing

4 GenomeRNAi human phenotypes for RAC2:

Altered focal adhesion (FA) or

Cell cycle / mitosis defect

Increased cell death HMECs cel

Upregulation of Wnt/beta-caten

Animal Models:
Mouse knock-out Rac2^tm1Mddw for RAC2
6 MGI mutant phenotypes (inferred from 1 allele) (MGI details for Rac2):

cardiovascular system	cellular	hematopoietic system	homeostasis/metabolism	immune system
mortality/aging

RAC2 for phenotypes About GeneDecksing

(Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to ¹UniProtKB, ²MINT, ³I2D, and/or ⁴STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
About This Section

Unified GeneCards pathways - 5/60 super-pathways (see all 60) About this table

See pathways by source

Super-pathway

contained gene-specific pathways

PKC-Theta Pathway

	PKC-Theta Pathway	1.00			ITK and TCR Signaling	0.54
	TCR Signaling	0.68			Fc-EpsilonRI Pathway	0.42

Integrin Pathway

	Integrin Pathway	1.00			GnRH Signaling	0.56
	FAK1 Signaling	0.67			Transendothelial Migration of Leukocytes	0.38

GPCR Pathway

	GPCR Pathway	1.00			Breast Cancer Regulation by Stathmin1	0.58
	Ras Pathway	0.62			Pancreatic Adenocarcinoma	0.55

CCR3 Pathway in Eosinophils

	CCR3 Pathway in Eosinophils	1.00			CXCR4 Pathway	0.39
	fMLP Pathway	0.43			Internalin Pathway	0.19

Immune response _CCR3 signaling in eosinophils

	Immune response _CCR3 signaling in eosinophils	1.00			Inhibitory action of Lipoxins on neutrophil migration	0.51
	Immune response CCR3 signaling in eosinophils	1.00

Pathway sources
See GeneCards unified pathways
Show all pathways

2 EMD Millipore Pathways for RAC2

	G-protein signaling Rac2 regulation pathway
	Immune response CCR3 signaling in eosinophils

1 R&D Systems Pathway for RAC2

Wnt Signaling Pathway

5/51 Downloadable PowerPoint Slides of QIAGEN Pathway Central Maps for RAC2 (see all 51)

	Fc-GammaR Pathway
	Molecular Mechanisms of Cancer
	Antioxidant Action of Vitamin-C
	G12-G13 in Cellular Signaling
	TRKA Signaling

2 Cell Signaling Technology (CST) Pathways for RAC2

	MAP Kinase Signaling
	Cytoskeletal Signaling

4 GeneGo (Thomson Reuters) Pathways for RAC2

	G-protein signaling Rac2 regulation pathway
	Inhibitory action of Lipoxins on Superoxide production in neutrophils
	Inhibitory action of Lipoxins on neutrophil migration
	Immune response CCR3 signaling in eosinophils

5/8 BioSystems Pathways for RAC2 (see all 8)

	Focal Adhesion
	DNA damage response (only ATM dependent)
	MAPK signaling pathway
	RalA downstream regulated genes
	Integrin-mediated cell adhesion

5/14 Reactome Pathways for RAC2 (see all 14)

	GPCR downstream signaling
	Hemostasis
	Signaling by Rho GTPases
	Developmental Biology
	G alpha (12/13) signalling events

2 PharmGKB Pathways for RAC2

	Bisphosphonate Pathway, Pharmacodynamics
	Doxorubicin Pathway (Cardiomyocyte Cell), Pharmacodynamics

5/17 Kegg Pathways (Kegg details for RAC2) (see all 17):

	MAPK signaling pathway
	Chemokine signaling pathway
	Wnt signaling pathway
	Axon guidance
	VEGF signaling pathway

RAC2 for pathways About GeneDecksing

Interactions:

SABiosciences Gene Network Central^TM Interacting Genes and Proteins Network for RAC2

STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

5/164 Interacting proteins for RAC2 (P15153^{2, 3} ENSP00000249071⁴) via UniProtKB, MINT, STRING, and/or I2D (see all 164)

Interactant		Interaction Details
GeneCard	External ID(s)	Interaction Details
CHGB	P05060²^,³, ENSP00000368244⁴	MINT-8267918 I2D: score=2 STRING: ENSP00000368244
ARHGDIB	P52566²^,³, ENSP00000228945⁴	MINT-16596 MINT-24949 I2D: score=5 STRING: ENSP00000228945
AFG3L2	Q9Y4W6²^,³, ENSP00000269143⁴	MINT-8267907 I2D: score=2 STRING: ENSP00000269143
NCF2	P19878³, ENSP00000356505⁴	I2D: score=4 STRING: ENSP00000356505
NOS2	P35228³, ENSP00000327251⁴	I2D: score=4 STRING: ENSP00000327251

About this table

Gene Ontology (GO): 5/14 biological process terms (GO ID links to tree view) (see all 14): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0006184	GTP catabolic process	--	--
GO:0006935	chemotaxis	--	--
GO:0007165	signal transduction	TAS	2674130
GO:0007264	small GTPase mediated signal transduction	TAS	--
GO:0007411	axon guidance	TAS	--

RAC2 for ontologies About GeneDecksing

(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
About This Section

RAC2 for compounds About GeneDecksing

Browse Small Molecules at EMD Millipore

Browse drugs & compounds from Enzo Life Sciences

Compounds for RAC2 available from Tocris Bioscience About this table

Compound	Action	CAS #
EHT 1864	Potent inhibitor of Rac family GTPases	--

4 HMDB Compounds for RAC2 About this table

Compound	Synonyms	CAS #	PubMed Ids
Guanosine diphosphate	5'-GDP (see all 10)	146-91-8	--
Guanosine monophosphate	5'-GMP (see all 14)	85-32-5	--
Guanosine triphosphate	5'-GTP (see all 10)	86-01-1	--
NADPH	2'-(dihydrogen phosphate) 5'-(trihydrogen pyrophosphate) Adenosine 5'-ester with 1,4-dihydro-1-b-D-ribofuranosylnicotinamide (see all 23)	53-57-6	--

10/15 Novoseek chemical compound relationships for RAC2 gene (see all 15) About this table

Compound	-log (P-Val)	Hits	PubMed IDs for Articles with Shared Sentences (# sentences)
nadph	80.9	43	12471136 (3), 15981461 (2), 14660749 (2), 8670049 (2) (see all 32)
fmlp	64	13	12391220 (2), 10364257 (2), 8670049 (2), 17060455 (1) (see all 6)
superoxide	61.9	21	15504745 (3), 1328203 (2), 12471136 (2), 19534724 (2) (see all 14)
guanosine	58.5	3	10779444 (1), 16582540 (1), 15170212 (1)
gtp	58.3	9	9748241 (2), 8305740 (2), 8089125 (1), 7479768 (1) (see all 5)
n-formylmethionyl-leucylphenylalanine	43.4	2	10364257 (1)
oxygen	36.3	6	9343750 (1), 16820949 (1), 10540223 (1), 8670049 (1) (see all 6)
tyrosine	29.6	4	15944312 (2), 14550529 (1), 7616102 (1)
phorbol	26.3	1	15504745 (1)
asparagine	14.2	1	14676277 (1)

1 PharmGKB related drug/compound annotation for RAC2 gene

Drug/compound	PharmGKB Annotation
doxorubicin	CA

About this table

Search CenterWatch for drugs/clinical trials and news about RAC2

(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
RNAi Products from EMD Millipore,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
About This Section

REFSEQ mRNAs for RAC2 gene:

NM_002872.3

Unigene Cluster for RAC2:

Ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)

Hs.517601 [show with all ESTs]

Unigene Representative Sequence: AK096924

7 Ensembl transcripts including schematic representations, and UCSC links where relevant:

ENST00000249071(uc003arc.3) ENST00000406508 ENST00000481215 ENST00000405484

ENST00000441619 ENST00000469532 ENST00000401529

miRNA Products:		OriGene 3'-UTR Clone: RAC2 Browse OriGene MicroRNA Expression Plasmids
		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat RAC2
		3 QIAGEN miScript miRNA Assays for microRNAs that regulate RAC2:
		hsa-miR-1184 hsa-miR-378* hsa-miR-1205
		SwitchGear 3'UTR luciferase reporter plasmid: RAC2 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for RAC2 (see all 6) Browse OriGene siRNA
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat RAC2

Clone Products:		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for RAC2 (see all 3) OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for RAC2 OriGene custom cloning services � gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector: RAC2 (NM_002872)
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for RAC2
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat RAC2

Primer Products:		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for RAC2 Browse OriGene validated miRNA SYBR primer pairs
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat RAC2
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat RAC2
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat RAC2

Additional cDNA sequence:

AF077208.1 AF498965.1 AK096924.1 BC001485.2 BC018735.1 BC051899.1 BT006919.1 CR456555.1

M29871.1

12 DOTS entries:

DT.416967 DT.100827641 DT.100716835 DT.99930448 DT.100827645 DT.91846232 DT.100827643 DT.100827650

DT.100827653 DT.416969 DT.92445198 DT.92445205

24/341 AceView cDNA sequences (see all 341):

BC018735 AJ714515 BM820881 CR608461 BM552059 AA829948 CR616302 AA768493

BQ934070 BM851882 BI908639 AA310079 BM851955 BG106565 CR615260 BQ059790

AA641662 BI906866 BI261649 BM849925 BM458676 BI020972 BM820025 BE616329

GeneLoc Exon Structure

4 Alternative Splicing Database (ASD) splice patterns (SP) for RAC2 About this scheme

ExUns:	1a	·	1b	·	1c	·	1d	^	2	^	3	^	4a	·	4b	^	5	^	6	^	7	^	8
SP1:											-				-
SP2:							-				-				-
SP3:											-
SP4:

ECgene alternative splicing isoforms for RAC2

(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

RAC2 expression in normal human tissues (normalized intensities)
See probesets specificity/sensitivity at GeneAnnot
About this imageBioGPS
CGAP TAG: TGGAAGCATC

About this image

RAC2 expression in embryonic tissues and stem cells

Expression by the Database of Embryonic development, Stem cell research, and Regenerative medicine About this table

1 LifeMap In Vivo Development Anatomical Compartment/Cell

Tissue

Anatomical Compartment

Cell

Category (developmental path)

Liver

Liver Bud

Liver

Expression:

Positive

Negative

Selective marker

Experimental details:

Curated

Microarrays

In-situ hybridization

Stem Cell Differentiation: 6 LifeMap Cells

Name

Category

PureStem™ endothelial progenitor 30-SM2-1 (Embryonic Progenitor Cell)

Endothelium

PureStem™ endothelial progenitor RP1-MV2-18 (Embryonic Progenitor Cell)

Endothelium

PureStem™ mesenchymal progenitor 7PEND24 (Embryonic Progenitor Cell)

Cartilage, Neural Crest

PureStem™ progenitor EN2 (Embryonic Progenitor Cell)

PureStem™ progenitor EN27 (Embryonic Progenitor Cell)

PureStem™ progenitor EN7 (Embryonic Progenitor Cell)

See RAC2 Protein Expression from SPIRE MOPED and PaxDB
Genevestigator expression for RAC2

SOURCE GeneReport for Unigene cluster: Hs.517601

UniProtKB/Swiss-Prot: RAC2_HUMAN, P15153

Tissue specificity: Hematopoietic specific

SABiosciences Expression via Pathway-Focused PCR Arrays including RAC2:

Adherens Junctions in human mouse rat

Leukemia in human mouse rat

VEGF Signaling in human mouse rat

Focal Adhesions in human mouse rat

Cell Motility in human mouse rat

Primer Products:		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for RAC2 Browse OriGene validated miRNA SYBR primer pairs
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat RAC2
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat RAC2
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat RAC2

In Situ
Assay Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for RAC2

(Orthologs according to ^1,2HomoloGene (²older version, for species not in ¹newer version), ³euGenes, ⁴SGD , ⁵MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or ⁶Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section

This gene was present in the common ancestor of eukaryotes.

Orthologs for RAC2 gene from 8/29 species (see all 29) About this table

Organism	Taxonomic classification	Gene	Description	Human Similarity	Orthology Type	Details
chicken (Gallus gallus)	Aves	RAC2¹	ras-related C3 botulinum toxin substrate 2 (rho family, more	83.51(n) 98.44(a)		418044 NM_001201452.1 NP_001188381.1
lizard (Anolis carolinensis)	Reptilia	RAC2⁶	--	96(a)	1 ↔ 1	5(22873979-22888339)
tropical clawed frog (Xenopus tropicalis)	Amphibia	Str.15383²	Transcribed sequence with strong similarity to protein more	79.72(n)		BX702895.1
zebrafish (Danio rerio)	Actinopterygii	rac2¹	ras-related C3 botulinum toxin substrate 2 (rho family, more	79.17(n) 93.75(a)		415151 NM_001002061.1 NP_001002061.1
fruit fly (Drosophila melanogaster)	Insecta	Rac1³	cell proliferation GTPase	89(a) (best of 4)		3 61F5 --
worm (Caenorhabditis elegans)	Secernentea	ced-10³	RAS-related protein	95(a) (best of 4)		IV(3507381-3509495) --
thale cress (Arabidopsis thaliana)	eudicotyledons	RAC10¹	Rac-like GTP-binding protein ARAC10	58.2(n) 60.77(a)		836408 NM_125682.4 NP_201093.1
rice (Oryza sativa)	Liliopsida	Os.5505²	Oryza sativa mRNA for small GTP-binding protein OsRac3, more	73.03(n)		AB029510.1

ENSEMBL Gene Tree for RAC2 (if available)
TreeFam Gene Tree for RAC2 (if available)

(Paralogs according to ¹HomoloGene,
²Ensembl, and ³SIMAP, Pseudogenes according to ⁴Pseudogene.org Build 68)
About This Section

Paralogs for RAC2 gene

RHOBTB2² RHOH² RHOQ² RAC1² RHOBTB1² RHOV² CDC42² RHOJ²

RHOG² RHOU² RAC3²

18/53 SIMAP similar genes for RAC2 using alignment to 5 protein entries: RAC2_HUMAN (see all proteins) (see all similar genes):

RAC3 RAC1 CDC42 RHOJ ARHG RHOG

RHOQ RHOV RHOF RHOU RHOD RHOH

RHOA RHOC RHOB RND2 ARHE RND3

RAC2 for paralogs About GeneDecksing

5/6 Pseudogenes.org Pseudogenes for RAC2 (see all 6)
PGOHUM00000248381 PGOHUM00000258726 PGOHUM00000245512 PGOHUM00000245647 PGOHUM00000243694

(SNPs/Variants according to the ¹NCBI SNP Database, ²Ensembl, ³PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
About This Section

SNP ID	Valid	Clinical significance	Chr 22 pos	Sequence	#	AA Chg	Type	More	#	Allele freq	Pop	Total sample	More
Genomic Data					Transcription Related Data				Allele Frequencies
				--	--	--		--	--
rs74315507^1,2	C	pathogenic	37628897(-)	`TGTGGA/GACACT`	2	N D	mis¹		0	--	--	--	--
rs56211145^1,2	C,	--	20585826(-)	`GAAATA/GAAACA`	1	--	ds500¹		0	--	--	--	--
rs55964914^1,2	C,	--	20585848(-)	`GGAAAG/TTGTTC`	1	--	ds500¹		2		WA	120
rs13054143^1,2	C,	--	37620868(+)	`TTCCCG/ACCAGG`	1	--	ds500¹		3		NA EA	242
rs56034561^1,2	C,	--	37620905(-)	`ACTGGA/GGGGGA`	1	--	ds500¹		0	--	--	--	--
rs5995400^1,2	C,A,H,	--	37620917(+)	`CACACA/GCTTTC`	1	--	ds500¹		8		NA WA CSA EA	367
rs5995401^1,2	C,A,H,	--	37620935(+)	`TTGCCA/GCAGTT`	1	--	ds500¹		8		NA WA CSA EA	367
rs7288684^1,2	C,H,	--	37621109(+)	`CTGAAC/GTTGAA`	1	--	ds500¹		7		EA NS NA CSA	516
rs78353659^1,2		--	37621119(+)	`ACTTGG/TAAGGA`	1	--	ds500¹		0	--	--	--	--
rs139104575^1,2	C,	--	37621130(+)	`TGAGG-/CCCTGAACTTGAA CTTGGAAGGATGAAACCCTG`	1	--	ds500¹		0	--	--	--	--

HapMap Linkage Disequilibrium report for RAC2 (37621301 - 37640488 bp)
Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
Database of Genomic Variants (DGV) variations for RAC2: --
Human Gene Mutation Database (HGMD): RAC2

Locus Specific Mutation Databases (LSDB): RAC2

SABiosciences Cancer Mutation PCR Assays

QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing RAC2

DNA2.0 Custom Variant and Variant Library Synthesis for RAC2

(in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
About This Section

RAC2 for disorders           About GeneDecksing

OMIM gene information: 602049
OMIM disorders: 608203
UniProtKB/Swiss-Prot: RAC2_HUMAN, P15153

Defects in RAC2 are the cause of neutrophil immunodeficiency syndrome (NEUID) [MIM:608203]

20/25 diseases for RAC2 (see all 25): About MalaCards

severe congenital neutropenia non-hodgkin lymphoma neutrophil immunodeficiency syndrome systemic mastocytosis

mastocytosis hodgkin's lymphoma megakaryoblastic leukemia acute myeloid leukemia

neutropenia myeloid leukemia parkinson's disease fibrosarcoma

immunodeficiency pertussis leukemia meningioma

pancreatic cancer colorectal cancer prostate cancer pancreatitis

7 Novoseek disease relationships for RAC2 gene About this table

Disease	-log (P-Val)	Hits	PubMed IDs for Articles with Shared Sentences (# sentences)
granulomatous disease chronic	43.5	1	8670049 (1)
tumors	1	1	16491116 (1)
bacterial infections	0	1	14676277 (1)
inflammation	0	1	17975262 (1)
gastric cancer	0	1	14975755 (1)
metastasis	0	1	16491116 (1)
immunodeficiency	0	4	10758162 (1), 11278678 (1), 10961859 (1), 12468931 (1)

Genetic Association Database (GAD): RAC2
Human Genome Epidemiology (HuGE) Navigator: RAC2 (14 documents)

Export disorders for RAC2 gene to outside databases

(in PubMed. Associations of this gene to articles via ¹Entrez Gene, ²UniProtKB/Swiss-Prot, ³HGNC, ⁴GAD, ⁵PharmGKB, ⁶HMDB, ⁷DrugBank, ⁸UniProtKB/TrEMBL, ⁹ Novoseek, and/or ¹⁰fRNAdb)
About This Section

PubMed articles for RAC2 gene, integrated from 9 sources (see all 194):
(articles sorted by number of sources associating them with RAC2)

Utopia: connect your pdf to the dynamic
world of online information

Human neutrophil immunodeficiency syndrome is associated with an inhibitory Rac2 mutation. (PubMed id 10758162)^{1, 2, 4, 9} Ambruso D.R.... Roos D. (2000)
Rac, a novel ras-related family of proteins that are botulinum toxin substrates. (PubMed id 2674130)^{1, 2, 3} Didsbury J.... Snyderman R. (1989)
Carboxyl-terminal isoprenylation of ras-related GTP-binding proteins encoded by rac1, rac2, and ralA. (PubMed id 1903399)^{1, 2, 9} Kinsella B.T.... Maltese W.A. (1991)
Regulation of the human neutrophil NADPH oxidase by rho-related G- proteins. (PubMed id 8504089)^{1, 2, 9} Kwong C.H.... Leto T.L. (1993)
A genome annotation-driven approach to cloning the human ORFeome. (PubMed id 15461802)^{1, 2} Collins J.E.... Dunham I. (2004)
The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)^{1, 2} Gerhard D.S....Malek J. (2004)
The Rac-RhoGDI complex and the structural basis for the regulation of Rho proteins by RhoGDI. (PubMed id 10655614)^{1, 2} Scheffzek K.... Gierschik P. (2000)
The DNA sequence of human chromosome 22. (PubMed id 10591208)^{1, 2} Dunham I....O'Brien K.P. (1999)
Non-adherent cell-specific expression of DOCK2, a member of the human CDM-family proteins. (PubMed id 10559471)^{1, 2} Nishihara H.... Matsuda M. (1999)
Regulation of the superoxide-generating NADPH oxidase by a small GTP- binding protein and its stimulatory and inhibitory GDP/GTP exchange proteins. (PubMed id 1316893)^{1, 2} Mizuno T.... Takai Y. (1992)

(in PubMed, OMIM, and NCBI Bookshelf)
About This Section

		AND	OR
Aliases
Disorders
Free Text

Query String		PubMed OMIM NCBI Bookshelf
	(Note: In FireFox, select the above section and copy using Ctrl-C)

(According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
About This Section

Entrez Gene: 5880	HGNC: 9802	AceView: RAC2	Ensembl:ENSG00000128340	euGenes: HUgn5880
ECgene: RAC2	Kegg: 5880	H-InvDB: RAC2

(According to HUGE)
About This Section

(According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
About This Section

Name	Description
PharmGKB entry for RAC2	Pharmacogenomics, SNPs, Pathways
ATLAS Chromosomes in Cancer entry for RAC2	Genetics and Cytogenetics in Oncology and Haematology
RAC2base	http://bioinf.uta.fi/RAC2base/

Intellectual Property for RAC2 gene
(Patent information from GeneIP, Licensable technologies from WIS Yeda, Salk, Tufts, IP news from LifeMap Sciences, Inc.)

About This Section

Patent Information for RAC2 gene:
Search GeneIP for patents involving RAC2

GeneCards and IP:
Japan Patent Office Licenses GeneCards European Patent Office Licenses GeneCards Improving the IP Search

(Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences),
In Situ Hybridization Assays from
Advanced Cell Diagnostics
About This Section

	EMD Millipore Mono- and Polyclonal Antibodies for the study of RAC2
	Browse Purified and Recombinant Proteins at EMD Millipore
	Browse Small Molecules at EMD Millipore
	EMD Millipore Kits and Assays for the Analysis of RAC2
	Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
	Browse for Gene Knock-down Tools from EMD Millipore

	EMD Millipore Custom Antibody & Bulk Services
	EMD Millipore Preclinical / Clinical Development Services
	EMD Millipore Immunoassay Services
	EMD Millipore Target Screening & Profiling Services

	Browse Antibodies		Browse Cell Culture Products
	Browse ELISAs		Browse Flow Cytometry Kits
	Browse Primer Pairs		Browse Kinase Activity Assays/Reagents
	Browse ELISpot Kits/Development Modules		Browse TFB/Immunoprecipitation Assays
	Browse Apoptosis Detection Kits/Reagents		Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents
	Browse DNA Damage/Repair Kits/Reagents		Browse Multiplex/Array Assay Kits/Reagents
	Browse Cell Selection/Detection Kits/Reagents		Browse Secondary Antibodies/Controls/Staining Reagents
	Browse Phosphatase Activity Assays/Reagents		Browse Recombinant/Natural Proteins

	OriGene Antibodies for RAC2		Browse OriGene shRNA RFPs
	OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for RAC2		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for RAC2
	OriGene Protein Over-expression Lysate for RAC2		Browse OriGene Fluorogenic Cell Assay Kits
	Browse OriGene siRNAs		OriGene 3'-UTR Clone for RAC2
	OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for RAC2		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for RAC2
	Browse OriGene GFP tagged cDNA clones in CMV expression vector		Browse OriGene MicroRNA Expression Plasmids
	Browse OriGene basic RS shRNAs		Browse OriGene validated miRNA SYBR primer pairs
	Browse OriGene full length recombinant human proteins expressed in human HEK293 cells		OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
	OriGene Custom Antibody Services for RAC2		OriGene Custom Protein Services for RAC2
	OriGene Custom Immunoassay Development

	QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat RAC2
	QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing RAC2
	QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat RAC2
	QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat RAC2
	QIAGEN QuantiFast Probe-based Assays in human, mouse, rat RAC2
	QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat RAC2

	GenScript Custom Purified and Recombinant Proteins Services for RAC2		GenScript cDNA clones with any tag delivered in your preferred vector for RAC2
	GenScript Custom Assay Services for RAC2		GenScript Custom Superior Antibodies Services for RAC2
	GenScript Custom overexpressing Cell Line Services for RAC2		CloneReady with Over 120,000 Genes
	Gene Synthesis: Any Gene in Any Vector		Vector-based siRNA and miRNA, Ready for Transfection
	Gene Mutant Library, Variants up to 10^11		Plasmid Preparation
	Custom Peptide Services

Antibodies & Assays for RAC2

	Regulatory tfbs in RAC2 promoter
	Search Chromatin IP Primers for RAC2
	RT² qPCR Primer Assay in human, mouse, rat RAC2
	GNC Network for RAC2
	SABiosciences PCR Arrays including human, mouse, rat RAC2

Tocris compounds for RAC2

	Browse Sino Biological Proteins and Antibodies
	Browse Sino Biological cDNA Clones
	Antibodies/Proteins Production Services
	Rabbit Monoclonal Antibody Platform
	Bulk Purchasing

Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

	Novus Tissue Slides
	RAC2 antibodies
	RAC2 proteins
	RAC2 lysates

	Antibodies for RAC2
	See all of Abcam's Antibodies, Kits and Proteins for RAC2
	Custom Antibody / Protein Production Service
	Bulk Purchasing
	Advantages of Rabbit Monoclonal antibodies
	Abcam protocols and scientific support

Recombinant Protein for RAC2

Browse ELISAs, CLIAs, Proteins, and Antibodies at Uscn

Search LifeMap BioReagents cell lines for RAC2

	Gene Synthesis
	Protein Engineering
	Variant Library Synthesis
	Codon Optimization
	Protein Production and Purification

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for RAC2

	SwitchGear 3'UTR luciferase reporter plasmids for RAC2
	SwitchGear Promoter luciferase reporter plasmids for RAC2

ThermoFisher Antibody for RAC2

Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat RAC2

GeneCards Homepage - Last full update: 19 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013

View Random Gene

Category			VWF (GIFTS: 73) von Willebrand factor
GIFtS Group

The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

The GeneCards Human Gene Database

Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

Hot genes Disease genes RAC2 gene at Home site.

hostname: 356980-web2.xennexinc.com index build: 100 solr: 1.4

Advanced Search

Export list of displayed genes

RAC2 Gene

ras-related C3 botulinum toxin substrate 2 (rho family,...

Aliases
for RAC2 gene

Summaries
for RAC2 gene

Genomic Views
for RAC2 gene

Proteins
for RAC2 gene

Protein Domains /
Families
for RAC2 gene

Function
for RAC2 gene

Pathways & Interactions
for RAC2 gene

Drugs & Compounds
for RAC2 gene

Transcripts
for RAC2 gene

Expression
for RAC2 gene

Orthologs
for RAC2 gene

Paralogs
for RAC2 gene

Genomic Variants
for RAC2 gene

Disorders / Diseases
for RAC2 gene

Publications
for RAC2 gene

External Searches for RAC2 gene

Genome Databases showing RAC2 gene

Other Databases showing RAC2 gene

Specialized Databases showing RAC2 gene

Intellectual Property
for RAC2 gene

Products
for RAC2 gene

View Random Gene

Advanced Search

Export list of displayed genes

RAC2 Gene

ras-related C3 botulinum toxin substrate 2 (rho family,...

Aliasesfor RAC2 gene

Summariesfor RAC2 gene

Genomic Viewsfor RAC2 gene

Proteinsfor RAC2 gene

Protein Domains /Familiesfor RAC2 gene

Functionfor RAC2 gene

Pathways & Interactionsfor RAC2 gene

Drugs & Compoundsfor RAC2 gene

Transcriptsfor RAC2 gene

Expression for RAC2 gene

Orthologsfor RAC2 gene

Paralogsfor RAC2 gene

Genomic Variantsfor RAC2 gene

Disorders / Diseasesfor RAC2 gene

Publicationsfor RAC2 gene

External Searches for RAC2 gene

Genome Databases showing RAC2 gene

Other Databases showing RAC2 gene

Specialized Databases showing RAC2 gene

Intellectual Propertyfor RAC2 gene

Productsfor RAC2 gene

View Random Gene

Aliases
for RAC2 gene

Summaries
for RAC2 gene

Genomic Views
for RAC2 gene

Proteins
for RAC2 gene

Protein Domains /
Families
for RAC2 gene

Function
for RAC2 gene

Pathways & Interactions
for RAC2 gene

Drugs & Compounds
for RAC2 gene

Transcripts
for RAC2 gene

Expression
for RAC2 gene

Orthologs
for RAC2 gene

Paralogs
for RAC2 gene

Genomic Variants
for RAC2 gene

Disorders / Diseases
for RAC2 gene

Publications
for RAC2 gene

Intellectual Property
for RAC2 gene

Products
for RAC2 gene