Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

RAB35 Gene

protein-coding   GIFtS: 57
GCID: GC12M120532

RAB35, member RAS oncogene family

 Explore 1 disease affiliated with
RAB35 via our new
 Human Malady Compendium 
Biological research products
for RAB35
    

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section

Aliases
RAB35, Member RAS Oncogene Family1 2     GTP-Binding Protein RAY2 3
H-Ray1     Ras-Related Protein Rab-1c (GTP-Binding Protein Ray)2
RAB1C2 3     Ras-Related Protein Rab-352
RAY2 3     Ras-Related Protein Rab-1C3

External Ids:    HGNC: 97741   Entrez Gene: 110212   Ensembl: ENSG000001117377   OMIM: 6041995   UniProtKB: Q152863   

Export aliases for RAB35 gene to outside databases

Previous GC identifers: GC12M119405 GC12M120060 GC12M120315 GC12M118944 GC12M118995 GC12M117542


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

UniProtKB/Swiss-Prot: RAB35_HUMAN, Q15286
Function: In the process of endocytosis, essential rate-limiting regulator of a fast recycling pathway back to the
plasma membrane. During cytokinesis, required for the postfurrowing terminal steps, namely for intercellular bridge
stability and abscission, possibly by controlling phosphatidylinositol 4,5-bis phosphate (PIP2) and SEPT2 localization
at the intercellular bridge

Gene Wiki entry for RAB35


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000012.11  NC_018923.1  NT_009775.17  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the RAB35 gene promoter:
         NF-1/L   NF-1   p53   GATA-2   c-Ets-1   CREB   POU2F1   POU2F1a   deltaCREB   STAT3   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmids (see all 3): RAB35 promoter sequence
   Search SABiosciences Chromatin IP Primers for RAB35

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat RAB35


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 12q24.31   Ensembl cytogenetic band:  12q24.23   HGNC cytogenetic band: 12q24

RAB35 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
RAB35 gene location

GeneLoc information about chromosome 12         GeneLoc Exon Structure

GeneLoc location for GC12M120532:  view genomic region     (about GC identifiers)

Start:
120,532,899 bp from pter      End:
120,555,306 bp from pter
Size:
22,408 bases      Orientation:
minus strand

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: RAB35_HUMAN, Q15286 (See protein sequence)
Recommended Name: Ras-related protein Rab-35  
Size: 201 amino acids; 23025 Da
Subunit: Interacts with DENND1A and DENND1B in a nucleotide-dependent manner. The low binding to DENND1C is
nucleotide-independent. All 3 DENND1 act as GEFs for RAB35 and thus activate the protein
Subcellular location: Cell membrane; Lipid-anchor; Cytoplasmic side (Potential). Membrane, clathrin-coated pit.
Cytoplasmic vesicle, clathrin-coated vesicle. Endosome. Melanosome. Note=Present on sorting endosomes and endosomal
tubules. Tends to be enriched in PIP2-positive cell membrane domains. During mitosis, associated with the plasma
membrane and present at the ingressing furrow during early cytokinesis as well as at the intercellular bridge later
during cytokinesis. Identified by mass spectrometry in melanosome fractions from stage I to stage IV
1 PDB 3D structure from and Proteopedia for RAB35:
3TW8 (3D)    
Secondary accessions: B2R6E0 B4E390
Alternative splicing: 2 isoforms:  Q15286-1   Q15286-2   (No experimental confirmation available)

Explore the universe of human proteins at neXtProt for RAB35: NX_Q15286

Post-translational modifications:

  • AMPylation at Tyr-77 by L.pneumophila DrrA occurs in the switch 2 region and leads to moderate inactivation of the
  • GTPase activity. It appears to prolong the lifetime of the GTP state of RAB1B by restricting access of GTPase
    effectors to switch 2 and blocking effector-stimulated GTP hydrolysis, thereby rendering RAB35 constitutively active1
  • Phosphocholinated by L.pneumophila AnkX. Both GDP-bound and GTP-bound forms can be phosphocholinated.
  • Phosphocholination inhibits the GEF activity of DENND1A1
  • View modification sites using PhosphoSitePlus2
  • View neXtProt modification sites for NX_Q15286

  • RAB35 Protein expression data from MOPED and PaxDb:    About this image 
    RAB35 Protein Expression
    REFSEQ proteins (2 alternative transcripts): 
    NP_001161078.1  NP_006852.1  

    ENSEMBL proteins: 
     ENSP00000229340   ENSP00000442555   ENSP00000441883   ENSP00000443994   ENSP00000399317  

    Human Recombinant Protein Products for RAB35: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein: RAB35
    OriGene Protein Over-expression Lysate (see all 2): RAB35
    OriGene Custom Protein Services for RAB35 
    GenScript Custom Purified and Recombinant Proteins Services for RAB35
    Novus Biologicals RAB35 Proteins
    Novus Biologicals RAB35 Lysate
    Browse Sino Biological Recombinant Proteins
    ProSpec Recombinant Protein for RAB35
    Uscn Proteins for RAB35

    Gene Ontology (GO): 5/8 cellular component terms (GO ID links to tree view) (see all 8):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005739mitochondrion IEA--
    GO:0005768endosome IEA--
    GO:0005886plasma membrane IDA16950109
    GO:0005905coated pit IDA16950109
    GO:0031253cell projection membrane IDA16950109

    RAB35 for ontologies           About GeneDecksing



    RAB35 Antibody Products: 
    EMD Millipore Mono- and Polyclonal Antibodies for the study of RAB35
    Browse R&D Systems for Antibodies
    Cell Signaling Technology (CST) Antibodies for RAB35 
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for RAB35 
    GenScript Custom Superior Antibodies Services for RAB35
    Novus Biologicals RAB35 Antibodies
    Abcam antibodies for RAB35 
    Uscn Antibodies for RAB35
    Search ThermoFisher Antibodies for RAB35

    Assay Products for RAB35: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Immunoassay Development
    Browse OriGene Fluorogenic Cell Assay Kits
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for RAB35
    Browse Enzo Life Sciences for kits & assays
    Uscn ELISAs and CLIAs for RAB35


    (According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    RAB35 for domains           About GeneDecksing

    3 InterPro domains/families:
     IPR005225 Small_GTP-bd_dom
     IPR001806 Small_GTPase
     IPR003579 Small_GTPase_Rab_type

    Graphical View of Domain Structure for InterPro Entry Q15286

    ProtoNet protein and cluster: Q15286

    1 Blocks protein family: IPB001806 Transforming protein P21 RAS signature

    UniProtKB/Swiss-Prot: RAB35_HUMAN, Q15286
    Similarity: Belongs to the small GTPase superfamily. Rab family


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, Sirion Biotech, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, Sirion Biotech, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
    About This Section

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: RAB35_HUMAN, Q15286
    Function: In the process of endocytosis, essential rate-limiting regulator of a fast recycling pathway back to the
    plasma membrane. During cytokinesis, required for the postfurrowing terminal steps, namely for intercellular bridge
    stability and abscission, possibly by controlling phosphatidylinositol 4,5-bis phosphate (PIP2) and SEPT2 localization
    at the intercellular bridge

         Genatlas biochemistry entry for RAB35:
    RAB35,RAS oncogene superfamily member 35,ubiquitously expressed

         Gene Ontology (GO): 4 molecular function terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0003924GTPase activity TAS7811277
    GO:0005525GTP binding IDA--
    GO:0005546phosphatidylinositol-4,5-bisphosphate binding IDA16950109
    GO:0019003GDP binding IDA--
         
    RAB35 for ontologies           About GeneDecksing


    Phenotypes:
         3 GenomeRNAi human phenotypes for RAB35:
     Decreased G3BP1 protein expres  Decreased cilium length  Decreased cilium length after  

    Animal Models:
       inGenious Targeting Laboratory - Customizable classic, inducible, and humanized mouse model solutions for RAB35 

    miRNA
    Products:
        
    OriGene 3'-UTR Clone: RAB35
    Browse MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat RAB35
    8/45 QIAGEN miScript miRNA Assays for microRNAs that regulate RAB35 (see all 45):
    hsa-miR-579 hsa-miR-4328 hsa-let-7a-2* hsa-miR-219-5p hsa-miR-508-3p hsa-miR-1184 hsa-miR-23a hsa-miR-761
    SwitchGear 3'UTR luciferase reporter plasmidRAB35 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for RAB35 (see all 7)
    OriGene shRNA RFP: RAB35
    OriGene siRNA: RAB35
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat RAB35
    Sirion Biotech Custom design and validation of potent shRNA sequences against RAB35 

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for RAB35
    Sirion Biotech Customized adenovirus for overexpression of RAB35 
    Sirion Biotech Customized adenovirus for potent knockdown of RAB35

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for RAB35 (see all 4)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for RAB35 (see all 2)
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector (see all 2): RAB35 (NM_006861)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for RAB35
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat RAB35 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for RAB35
    Search LifeMap BioReagents cell lines for RAB35
    Sirion Biotech Customized stable knockdown cell line services for RAB35 
    Sirion Biotech Customized inducible knockdown cell line services for RAB35
    Sirion Biotech Customized stable overexpressing cell line services for RAB35
    Sirion Biotech Customized inducible overexpressing cell line services for RAB35

    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for RAB35


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
    About This Section

    Unified GeneCards pathways  About this table 
    See pathways by source

    Super-pathwaycontained gene-specific pathways
    1Cytoskeletal Signaling
    Cytoskeletal Signaling1.00

    Pathway sources
    See GeneCards unified pathways
    Show all pathways


    1 Cell Signaling Technology (CST) Pathway for RAB35
        Cytoskeletal Signaling



    RAB35 for pathways           About GeneDecksing

    Interactions:

        Search SABiosciences Gene Network CentralTM Interacting Genes and Proteins Networks for RAB35

    STRING Interaction Network Preview (showing 5 interactants - click image to see 10)

    5/25 Interacting proteins for RAB35 (Q152862, 3 ENSP000002293404) via UniProtKB, MINT, STRING, and/or I2D (see all 25)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    ACTBP607092, 3, ENSP000003499604MINT-7012070 I2D: score=1 STRING: ENSP00000349960
    CBR3O758282, 3MINT-64229 I2D: score=5 
    C2orf44Q9H6R72, 3MINT-64233 I2D: score=4 
    CDC42P609532, 3, ENSP000003144584MINT-7012095 I2D: score=1 STRING: ENSP00000314458
    RAC1P630002, 3, ENSP000003484614MINT-7012081 I2D: score=1 STRING: ENSP00000348461
    About this table

    Gene Ontology (GO): 5/6 biological process terms (GO ID links to tree view) (see all 6):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000910cytokinesis IMP16950109
    GO:0006184GTP catabolic process TAS7811277
    GO:0007264small GTPase mediated signal transduction IEA--
    GO:0008104protein localization IMP16950109
    GO:0015031protein transport IEA--

    RAB35 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section
    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for RAB35
    Search CenterWatch for drugs/clinical trials and news about RAB35 

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, Sirion Biotech, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for RAB35 gene (2 alternative transcripts): 
    NM_001167606.1  NM_006861.6  

    Unigene Cluster for RAB35:

    RAB35, member RAS oncogene family
    Hs.524788  [show with all ESTs]
    Unigene Representative Sequence: NM_006861
    7 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000229340(uc001txm.2 uc010szh.2 uc009zww.2) ENST00000544304
    ENST00000534951 ENST00000538903 ENST00000543364 ENST00000540803 ENST00000432953


    miRNA
    Products:
         
    OriGene 3'-UTR Clone: RAB35
    Browse OriGene MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat RAB35
    8/45 QIAGEN miScript miRNA Assays for microRNAs that regulate RAB35 (see all 45):
    hsa-miR-579 hsa-miR-4328 hsa-let-7a-2* hsa-miR-219-5p hsa-miR-508-3p hsa-miR-1184 hsa-miR-23a hsa-miR-761
    SwitchGear 3'UTR luciferase reporter plasmidRAB35 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for RAB35 (see all 7)
    OriGene shRNA RFP: RAB35
    OriGene siRNA: RAB35
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat RAB35
    Sirion Biotech Custom design and validation of potent shRNA sequences against RAB35 
    Clone
    Products:
         
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for RAB35 (see all 4)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for RAB35 (see all 2)
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector (see all 2): RAB35 (NM_006861)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for RAB35
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat RAB35 
    Primer
    Products:
        
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for RAB35
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat RAB35
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat RAB35
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat RAB35

    Additional cDNA sequence: 

    AF498960.1 AK001309.2 AK125543.1 AK298391.1 AK300127.1 AK304620.1 AK312538.1 BC015931.2 
    BC017753.1 BT020024.1 CR536486.1 CR541683.1 X79781.1 

    13 DOTS entries:

    DT.309459  DT.91960376  DT.75159901  DT.100782112  DT.100027022  DT.100711889  DT.100757062  DT.100782110 
    DT.121137122  DT.121137165  DT.91751452  DT.95278290  DT.97774884 

    11 AceView cDNA sequences:

    CR536486 AF498960 BC017753 NM_006861 AK001309 CR623183 CR622981 CR541683 
    AK125543 BC015931 X79781 

    GeneLoc Exon Structure

    5 Alternative Splicing Database (ASD) splice patterns (SP) for RAB35    About this scheme

    ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5 ^ 6a · 6b ^ 7 ^ 8a · 8b · 8c
    SP1:                          -           -                           
    SP2:        -                 -           -                           
    SP3:        -                 -           -     -                     
    SP4:                                      -                           
    SP5:        -                 -                                       


    ECgene alternative splicing isoforms for RAB35

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    RAB35 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS
    CGAP TAG: AATGGGGGTT
    RAB35 Expression
    About this image
    See RAB35 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for RAB35

    SOURCE GeneReport for Unigene cluster: Hs.524788
        SABiosciences Custom PCR Arrays for RAB35

    Primer
    Products:
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for RAB35
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat RAB35
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat RAB35
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat RAB35
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for RAB35

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of animals.

    Orthologs for RAB35 gene from 6/23 species (see all 23)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    chicken
    (Gallus gallus)
    Aves RAB351 RAB35, member RAS oncogene family 84.74(n)
    98.51(a)
      416983  NM_001030669.1  NP_001025840.1 
    lizard
    (Anolis carolinensis)
    Reptilia RAB356
    --
    --
    99(a)
    72(a)
    1 ↔ 1
    possible ortholog
    GL343338.1(398161-411121)
    GL343516.1(458081-464117)
    African clawed frog
    (Xenopus laevis)
    Amphibia Xl.162362 Xenopus laevis, Similar to RAB35, member RAS oncogene more 78.41(n)    BC041759.1 
    zebrafish
    (Danio rerio)
    Actinopterygii BQ450111.12   -- 83.12(n)    BQ450111.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta CG95753
    Rab351
    RAB small monomeric GTPase3
    CG9575-PA1
    66(a)
    (best of 2)3
    68.52(n)1
    73.74(a)1
      19B33
    330141  NM_001201749.11  NP_001188678.11 
    worm
    (Caenorhabditis elegans)
    Secernentea 4R79.23
    rab-351
    Ras family3
    Protein RAB-351
    39(a)3
    61.45(n)1
    70.71(a)1
      IV(17480552-17483486)3
    1765601  NM_067053.21  NP_499454.11 


    ENSEMBL Gene Tree for RAB35 (if available)
    TreeFam Gene Tree for RAB35 (if available) 

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for RAB35 gene
    RAB102  RAB192  RAB432  RAB182  RAB262  RAB8A2  RAB372  RAB8B2  
    RAB1B2  RAB122  RAB302  RAB1A2  RAB132  
    18/105 SIMAP similar genes for RAB35 using alignment to 4 protein entries:     RAB35_HUMAN (see all proteins) (see all similar genes):
    RAB8B    RAB43    RAB8A    RAB10    RAB3D    DKFZp686J07132
    RAB36    RAB3A    RAB6A'    RAB15    RAB3B    RAB13
    RAB19    RAB5B    RAB30    RAB2B    RAB27B    RAB6A

    RAB35 for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/460 NCBI SNPs in RAB35 are shown (see all 460    About this table
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 12 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs2021977231,2
    --120532436(+) GCTGG-/TACT  
            
    TACTT
    3 -- ds5001 int10--------
    rs1130068181,2
    C--120532460(+) ATTTG-/GCCAGGAAGGGCAT
    CCTCCCCTGCCCCTCCC
    GCCTG
    3 -- ds5001 int11Minor allele frequency- GCCAGGAAGGGCATCCTCCCCTGCCCCTCCC:0.50CSA 2
    rs1840693831,2
    --120532463(+) TGGCCA/TGGAAG 3 -- ds5001 int10--------
    rs1426364071,2
    --120532513(+) GCCAGG/TGCTGC 3 -- int1 ds50010--------
    rs116100181,2
    H--120532515(+) CAGTGC/GTGCAG 3 -- int1 ds50010--------
    rs1890409071,2
    --120532531(+) CATCCA/GCAAGG 3 -- int1 ds50010--------
    rs1915904391,2
    --120532550(+) CCAACA/GCTGCT 3 -- ds5001 int10--------
    rs1424188131,2
    --120532613(+) ACCACA/GCCAGG 3 -- ds5001 int10--------
    rs764234951,2
    F--120532664(+) AACACG/AGAGCT 3 -- ds5001 int11Minor allele frequency- A:0.02WA 118
    rs1834920071,2
    --120532739(+) TGTTCA/GTGGAG 3 -- ds5001 int10--------

    HapMap Linkage Disequilibrium report for RAB35 (120532899 - 120555306 bp)
    Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
          Database of Genomic Variants (DGV) variations for RAB35: --

    SABiosciences Cancer Mutation PCR Assays
    QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing RAB35
    DNA2.0 Custom Variant and Variant Library Synthesis for RAB35

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    RAB35 for disorders           About GeneDecksing

    OMIM gene information: 604199    OMIM disorders: --

    1 disease for RAB35:    About MalaCards
    malaria

    Human Genome Epidemiology (HuGE) Navigator: RAB35 (2 documents)

    Export disorders for RAB35 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for RAB35 gene, integrated from 9 sources (see all 32):
    (articles sorted by number of sources associating them with RAB35)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Insights regarding guanine nucleotide exchange from t he structure of a DENN-domain protein complexed with its Rab GTPase substrate. (PubMed id 22065758)1, 2 Wu X....Reinisch K.M. (2011)
    2. Rab35 regulates an endocytic recycling pathway essential for the terminal steps of cytokinesis. (PubMed id 16950109)1, 2 Kouranti I....Echard A. (2006)
    3. Proteomic and bioinformatic characterization of the biogenesis and function of melanosomes. (PubMed id 17081065)1, 2 Chi A....Hunt D.F. (2006)
    4. The finished DNA sequence of human chromosome 12. (PubMed id 16541075)1, 2 Scherer S.E.... Gibbs R.A. (2006)
    5. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S....Malek J. (2004)
    6. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)1, 2 Ota T.... Sugano S. (2004)
    7. Molecular cloning of two small GTP-binding proteins from human skeletal muscle. (PubMed id 7811277)1, 2 Zhu A.X.... Flier J.S. (1994)
    8. A Small Ras-like protein Ray/Rab1c modulates the p53-regulating activity of PRPK. (PubMed id 16600182)1, 9 Abe Y....Kito K. (2006)
    9. Reversible phosphocholination of Rab proteins by Legionella pneumophila effector proteins. (PubMed id 22307087)2 Goody P.R....Goody R.S. (2012)
    10. Shotgun proteomics and network analysis of ubiquitin-r elated proteins from human breast carcinoma epithelial cells. (PubMed id 21853274)1 Zhou J....Liang S. (2012)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 11021 HGNC: 9774 AceView: RAB35 Ensembl:ENSG00000111737 euGenes: HUgn11021
    ECgene: RAB35 H-InvDB: RAB35

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for RAB35 Pharmacogenomics, SNPs, Pathways
    ATLAS Chromosomes in Cancer entry for RAB35 Genetics and Cytogenetics in Oncology and Haematology

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for RAB35 gene:
    Search GeneIP for patents involving RAB35

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript, LifeMap BioReagents, and Sirion Biotech, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory)
    About This Section

     Browse Small Molecules at EMD Millipore
     Browse Purified and Recombinant Proteins at EMD Millipore
     Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
     Browse for Gene Knock-down Tools from EMD Millipore
     Browse Kits and Assays available from EMD Millipore
     EMD Millipore Mono- and Polyclonal Antibodies for the study of RAB35
     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Phosphatase Activity Assays/Reagents   Browse Recombinant/Natural Proteins  
     Browse OriGene Antibodies   OriGene shRNA RFP for RAB35  
     OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for RAB35   OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for RAB35  
     OriGene Protein Over-expression Lysate for RAB35   Browse OriGene Fluorogenic Cell Assay Kits  
     OriGene siRNA for RAB35   OriGene 3'-UTR Clone for RAB35  
     OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for RAB35   OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for RAB35  
     Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
     Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
     OriGene Purified Protein for RAB35   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for RAB35   OriGene Custom Protein Services for RAB35  
     OriGene Custom Immunoassay Development  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat RAB35
     QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing RAB35
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat RAB35
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat RAB35
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat RAB35
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat RAB35
     GenScript Custom Purified and Recombinant Proteins Services for RAB35 GenScript cDNA clones with any tag delivered in your preferred vector for RAB35
     GenScript Custom Assay Services for RAB35 GenScript Custom Superior Antibodies Services for RAB35
     GenScript Custom overexpressing Cell Line Services for RAB35 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Antibodies & Assays for RAB35 

     Regulatory tfbs in RAB35 promoter
     Search Chromatin IP Primers for RAB35
     RT2 qPCR Primer Assay in human, mouse, rat RAB35
     Search GNC Networks for RAB35
     SABiosciences Custom PCR Arrays for RAB35
     Search Tocris compounds for RAB35
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological cDNA Clones
     Antibodies/Proteins Production Services
     Rabbit Monoclonal Antibody Platform
     Bulk Purchasing
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     RAB35 antibodies
     RAB35 proteins
     RAB35 lysates
     Antibodies for RAB35
     See all of Abcam's Antibodies, Kits and Proteins for RAB35
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Recombinant Protein for RAB35




     RAB35 Proteins, Antibodies, CLIAs, and ELISAs
     Search LifeMap BioReagents cell lines for RAB35
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for RAB35
     SwitchGear 3'UTR luciferase reporter plasmids for RAB35
     SwitchGear Promoter luciferase reporter plasmids for RAB35
     Search ThermoFisher Antibodies for RAB35
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat RAB35
     inGenious Targeting Laboratory - Customizable classic, inducible, and humanized mouse model solutions for RAB35
    Sirion Biotech Customized:
     stable knockdown cell line services for RAB35
     inducible knockdown cell line services for RAB35
     design and validation of potent shRNA sequences against RAB35
     adenovirus for potent knockdown of RAB35
     adenovirus for overexpression of RAB35
     stable overexpressing cell line services for RAB35
     inducible overexpressing cell line services for RAB35
           
    GeneCards Homepage - Last full update: 19 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013 , 13 May 2013

    View Random Gene

    Category
    VWF
    (GIFTS: 73)
    von Willebrand factor
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      RAB35 gene at Home site.
    hostname: 356977-web1.xennexinc.com index build: 106 solr: 1.4