Free for academic non-profit institutions. Other users need a Commercial license

Aliases for PXDN Gene

Aliases for PXDN Gene

  • Peroxidasin 2 3 5
  • Melanoma-Associated Antigen MG50 3 4
  • P53-Responsive Gene 2 Protein 3 4
  • Vascular Peroxidase 1 3 4
  • EC 4 61
  • PRG2 3 4
  • MG50 3 4
  • VPO 3 4
  • Peroxidasin Homolog (Drosophila) 2
  • Peroxidasin Homolog 3
  • EC 1.11.1 61
  • KIAA0230 4
  • D2S448E 3
  • D2S448 3
  • COPOA 3
  • VPO1 4
  • PXN 3

External Ids for PXDN Gene

Previous GeneCards Identifiers for PXDN Gene

  • GC02M001606

Summaries for PXDN Gene

Entrez Gene Summary for PXDN Gene

  • This gene encodes a heme-containing peroxidase that is secreted into the extracellular matrix. It is involved in extracellular matrix formation, and may function in the physiological and pathological fibrogenic response in fibrotic kidney. Mutations in this gene cause corneal opacification and other ocular anomalies, and also microphthalmia and anterior segment dysgenesis. [provided by RefSeq, Aug 2014]

GeneCards Summary for PXDN Gene

PXDN (Peroxidasin) is a Protein Coding gene. Diseases associated with PXDN include Corneal Opacification And Other Ocular Anomalies and Sclerocornea. Among its related pathways are EGFR1 Signaling Pathway. GO annotations related to this gene include heme binding and peroxidase activity. An important paralog of this gene is PXDNL.

UniProtKB/Swiss-Prot for PXDN Gene

  • Displays low peroxidase activity and is likely to participate in H(2)O(2) metabolism and peroxidative reactions in the cardiovascular system. Plays a role in extracellular matrix formation.

Gene Wiki entry for PXDN Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for PXDN Gene

Genomics for PXDN Gene

Regulatory Elements for PXDN Gene

Enhancers for PXDN Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH02F001713 0.6 Ensembl ENCODE 21.9 +29.3 29272 5.1 CTCF SP2 REST RAD21 NR2F2 JUND RAD51 ZNF366 SMARCA4 HMBOX1 PXDN LOC105373363 ENSG00000232057 GC02P001702
GH02F001720 1.4 FANTOM5 Ensembl ENCODE 21.2 +22.5 22512 3.9 CTCF ZNF263 KLF1 RFX1 JUN SP2 ZIC2 ZNF121 GATA3 JUND PXDN LOC105373363 ENSG00000232057 GC02P001702
GH02F002613 0.5 Ensembl ENCODE 17.1 -868.8 -868849 1.4 ATF1 ARNT CREB3L1 MLX ZNF48 ETS1 YY1 CBX5 ELK1 ZNF143 PXDN RPS7 ENSG00000242282 RNASEH1 ENSG00000234929 GC02P002549
GH02F001726 1.5 FANTOM5 Ensembl ENCODE 14.6 +14.9 14919 6.6 KLF1 SIN3A CEBPG ZIC2 RAD21 ZNF121 POLR2A FOS MAFK ZNF263 PXDN ENSG00000232057 GC02P001702
GH02F001735 1.1 FANTOM5 Ensembl ENCODE 11.6 +4.2 4202 10.1 GTF2F1 CTCF SIN3A MAX ZIC2 RAD21 ZNF335 E2F1 GLIS2 POLR2A PXDN ENSG00000232057 GC02P001702
- Elite enhancer/Elite enhancer-gene association Download Table
Download GeneHancer data dump

Enhancers around PXDN on UCSC Golden Path with GeneCards custom track

Promoters for PXDN Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000584169 952 2601 CTCF ZIC2 RAD21 E2F1 GLIS2 POLR2A SMC3 MAZ BHLHE40 NRF1

Genomic Location for PXDN Gene

1,631,887 bp from pter
1,744,852 bp from pter
112,966 bases
Minus strand

Genomic View for PXDN Gene

Genes around PXDN on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
PXDN Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for PXDN Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for PXDN Gene

Proteins for PXDN Gene

  • Protein details for PXDN Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Peroxidasin homolog
    Protein Accession:
    Secondary Accessions:
    • A8QM65
    • D6W4Y0
    • Q4KMG2

    Protein attributes for PXDN Gene

    1479 amino acids
    Molecular mass:
    165275 Da
    Name=Ca(2+); Xref=ChEBI:CHEBI:29108;
    Name=heme b; Xref=ChEBI:CHEBI:60344;
    Quaternary structure:
    No Data Available
    • Sequence=AAF06354.1; Type=Erroneous initiation; Evidence={ECO:0000305}; Sequence=BAA13219.1; Type=Erroneous initiation; Evidence={ECO:0000305};

    Alternative splice isoforms for PXDN Gene


neXtProt entry for PXDN Gene

Post-translational modifications for PXDN Gene

  • Glycosylation at Asn 640, Asn 699, Asn 719, Asn 731, Asn 865, Asn 1178, Asn 1280, Asn 1368, and Asn 1425
  • Modification sites at PhosphoSitePlus

Antibody Products

  • Santa Cruz Biotechnology (SCBT) Antibodies for PXDN

Domains & Families for PXDN Gene

Gene Families for PXDN Gene

Suggested Antigen Peptide Sequences for PXDN Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Contains 4 Ig-like C2-type (immunoglobulin-like) domains.
  • Belongs to the peroxidase family. XPO subfamily.
  • Contains 4 LRR (leucine-rich) repeats.
  • Contains 4 Ig-like C2-type (immunoglobulin-like) domains.
  • Contains 1 LRRCT domain.
  • Contains 1 LRRNT domain.
  • Contains 1 VWFC domain.
  • Belongs to the peroxidase family. XPO subfamily.
  • Contains 4 LRR (leucine-rich) repeats.
genes like me logo Genes that share domains with PXDN: view

Function for PXDN Gene

Molecular function for PXDN Gene

UniProtKB/Swiss-Prot BiophysicochemicalProperties:
Kinetic parameters: KM=0.15 mM for H(2)O(2) {ECO:0000269 PubMed:18929642};
UniProtKB/Swiss-Prot CatalyticActivity:
2 phenolic donor + H(2)O(2) = 2 phenoxyl radical of the donor + 2 H(2)O.
UniProtKB/Swiss-Prot Function:
Displays low peroxidase activity and is likely to participate in H(2)O(2) metabolism and peroxidative reactions in the cardiovascular system. Plays a role in extracellular matrix formation.
UniProtKB/Swiss-Prot Induction:
By TGFB1 in fibroblasts and up-regulated in apoptotic cells.

Enzyme Numbers (IUBMB) for PXDN Gene

Gene Ontology (GO) - Molecular Function for PXDN Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004601 peroxidase activity IDA 18929642
GO:0005152 interleukin-1 receptor antagonist activity NAS 11103812
GO:0005201 extracellular matrix structural constituent IDA 19590037
GO:0016491 oxidoreductase activity IEA --
GO:0020037 heme binding IDA 18929642
genes like me logo Genes that share ontologies with PXDN: view
genes like me logo Genes that share phenotypes with PXDN: view

Human Phenotype Ontology for PXDN Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

  • Taconic Biosciences Mouse Models for PXDN

Inhibitory RNA Products

Flow Cytometry Products

No data available for Animal Models , Transcription Factor Targets and HOMER Transcription for PXDN Gene

Localization for PXDN Gene

Subcellular locations from UniProtKB/Swiss-Prot for PXDN Gene

Secreted, extracellular space, extracellular matrix. Note=Enriched in the peritubular space of fibrotic kidneys.

Subcellular locations from

Jensen Localization Image for PXDN Gene COMPARTMENTS Subcellular localization image for PXDN gene
Compartment Confidence
endoplasmic reticulum 5
extracellular 5
plasma membrane 3
golgi apparatus 1
lysosome 1
nucleus 1
peroxisome 1
vacuole 1

Gene Ontology (GO) - Cellular Components for PXDN Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005576 extracellular region IEA --
GO:0005578 proteinaceous extracellular matrix IEA --
GO:0005615 extracellular space IDA 18929642
GO:0005783 endoplasmic reticulum IDA 19590037
GO:0031012 extracellular matrix IDA 19590037
genes like me logo Genes that share ontologies with PXDN: view

Pathways & Interactions for PXDN Gene

SuperPathways for PXDN Gene

SuperPathway Contained pathways
1 EGFR1 Signaling Pathway
genes like me logo Genes that share pathways with PXDN: view

Pathways by source for PXDN Gene

1 BioSystems pathway for PXDN Gene

Interacting Proteins for PXDN Gene

Gene Ontology (GO) - Biological Process for PXDN Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001960 negative regulation of cytokine-mediated signaling pathway IEA --
GO:0006955 immune response NAS 11103812
GO:0006979 response to oxidative stress IEA --
GO:0030198 extracellular matrix organization IDA 19590037
GO:0042744 hydrogen peroxide catabolic process IEA,IDA 18929642
genes like me logo Genes that share ontologies with PXDN: view

No data available for SIGNOR curated interactions for PXDN Gene

Drugs & Compounds for PXDN Gene

(4) Drugs for PXDN Gene - From: HMDB

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Water Approved Pharma 0
heme Pharma Agonist 0
Hydrogen peroxide Pharma 55
calcium Nutra 0

(1) Additional Compounds for PXDN Gene - From: HMDB

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
  • Armco iron
  • Carbonyl iron
  • FE
  • Ferrovac e
  • Hematite
genes like me logo Genes that share compounds with PXDN: view

Transcripts for PXDN Gene

Unigene Clusters for PXDN Gene

Peroxidasin homolog (Drosophila):
Representative Sequences:

Inhibitory RNA Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for PXDN Gene

ExUns: 1a · 1b · 1c ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7 ^ 8 ^ 9 ^ 10a · 10b ^ 11 ^ 12 ^ 13 ^ 14a · 14b ^ 15a · 15b · 15c ^ 16 ^ 17 ^ 18 ^ 19 ^ 20a ·
SP1: - - - - - -
SP2: - - - - - -
SP3: - -
SP4: - - - - -
SP5: - -
SP7: - -
SP9: -

ExUns: 20b ^ 21a · 21b ^ 22a · 22b · 22c ^ 23 ^ 24 ^ 25a · 25b · 25c ^ 26 ^ 27 ^ 28a · 28b ^ 29a · 29b · 29c
SP1: - - - -
SP2: -
SP3: - - - - - - -
SP6: - -
SP10: -
SP12: -

Relevant External Links for PXDN Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for PXDN Gene

mRNA expression in normal human tissues for PXDN Gene

Protein differential expression in normal tissues from HIPED for PXDN Gene

This gene is overexpressed in Amniocyte (49.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for PXDN Gene

Protein tissue co-expression partners for PXDN Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of PXDN Gene:


SOURCE GeneReport for Unigene cluster for PXDN Gene:


mRNA Expression by UniProt/SwissProt for PXDN Gene:

Tissue specificity: Expressed at higher levels in heart, lung, ovary, spleen, intestine and placenta, and at lower levels in liver, colon, pancreas, kidney, thymus, skeletal muscle and prostate. Expressed in tumors such as melanoma, breast cancer, ovarian cancer and glioblastoma. A shorter form probably lacking the signal sequence is found in testis and in EB1 cells undergoing p53/TP53-dependent apoptosis.
genes like me logo Genes that share expression patterns with PXDN: view

Primer Products

No data available for mRNA differential expression in normal tissues for PXDN Gene

Orthologs for PXDN Gene

This gene was present in the common ancestor of animals.

Orthologs for PXDN Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia PXDN 34 35
  • 99.54 (n)
(Monodelphis domestica)
Mammalia PXDN 35
  • 90 (a)
(Mus musculus)
Mammalia Pxdn 34 16 35
  • 84.36 (n)
(Rattus norvegicus)
Mammalia Pxdn 34
  • 84.36 (n)
(Canis familiaris)
Mammalia PXDN 34 35
  • 83.93 (n)
(Bos Taurus)
Mammalia PXDN 34
  • 83.61 (n)
(Ornithorhynchus anatinus)
Mammalia PXDN 35
  • 69 (a)
(Gallus gallus)
Aves PXDN 34 35
  • 74.16 (n)
(Anolis carolinensis)
Reptilia PXDN 35
  • 85 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia pxdn 34
  • 70.1 (n)
fruit fly
(Drosophila melanogaster)
Insecta Pxn 34 35
  • 53.43 (n)
African malaria mosquito
(Anopheles gambiae)
Insecta HPX4 34
  • 52.29 (n)
(Caenorhabditis elegans)
Secernentea pxn-1 34 35
  • 49.51 (n)
pxn-2 35
  • 37 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 35
  • 46 (a)
Species where no ortholog for PXDN was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • zebrafish (Danio rerio)

Evolution for PXDN Gene

Gene Tree for PXDN (if available)
Gene Tree for PXDN (if available)

Paralogs for PXDN Gene

Paralogs for PXDN Gene

genes like me logo Genes that share paralogs with PXDN: view

Variants for PXDN Gene

Sequence variations from dbSNP and Humsavar for PXDN Gene

SNP ID Clin Chr 02 pos Sequence Context AA Info Type
rs587777572 Corneal opacification with other ocular anomalies (COPOA) [MIM:269400], Pathogenic 1,649,142(+) GGAGC(A/G)CACGA reference, missense
rs369535598 Pathogenic 1,666,484(+) GGGTC(A/G)AGCTG reference, stop-gained
rs587777571 Pathogenic 1,649,212(+) AAGCA(-/G)GGGGG reference, frameshift-variant
rs587777573 Pathogenic 1,649,383(+) GTGGT(-/GGACACCAGGCGCGGCATGGGAA)GGGCG reference, frameshift-variant
rs202132697 Likely benign 1,648,590(+) GAAGG(C/T)GTTGA reference, missense

Structural Variations from Database of Genomic Variants (DGV) for PXDN Gene

Variant ID Type Subtype PubMed ID
dgv1839n106 CNV deletion 24896259
dgv571e201 CNV deletion 23290073
dgv572e201 CNV deletion 23290073
dgv573e201 CNV deletion 23290073
dgv606n67 CNV gain 20364138
dgv6652n54 CNV gain 21841781
dgv6653n54 CNV gain 21841781
dgv6654n54 CNV loss 21841781
esv1002606 CNV deletion 20482838
esv1009579 CNV deletion 20482838
esv1243391 CNV insertion 17803354
esv1273929 CNV deletion 17803354
esv1278021 CNV insertion 17803354
esv1343489 CNV deletion 17803354
esv1407173 CNV insertion 17803354
esv1443452 CNV deletion 17803354
esv1629001 CNV insertion 17803354
esv1653800 CNV deletion 17803354
esv2045423 CNV deletion 18987734
esv2270555 CNV deletion 18987734
esv23941 CNV loss 19812545
esv2544823 CNV deletion 19546169
esv26558 CNV loss 19812545
esv2665854 CNV deletion 23128226
esv2668630 CNV deletion 23128226
esv2668758 CNV deletion 23128226
esv2670619 CNV deletion 23128226
esv2678591 CNV deletion 23128226
esv2719343 CNV deletion 23290073
esv2719344 CNV deletion 23290073
esv2719345 CNV deletion 23290073
esv2719346 CNV deletion 23290073
esv2719347 CNV deletion 23290073
esv2719348 CNV deletion 23290073
esv2719349 CNV deletion 23290073
esv2719351 CNV deletion 23290073
esv2719352 CNV deletion 23290073
esv2719353 CNV deletion 23290073
esv2719354 CNV deletion 23290073
esv2719357 CNV deletion 23290073
esv2719358 CNV deletion 23290073
esv2719359 CNV deletion 23290073
esv2719360 CNV deletion 23290073
esv2719363 CNV deletion 23290073
esv2719364 CNV deletion 23290073
esv2719365 CNV deletion 23290073
esv2719366 CNV deletion 23290073
esv2719367 CNV deletion 23290073
esv2719369 CNV deletion 23290073
esv2719371 CNV deletion 23290073
esv2743353 CNV deletion 23290073
esv28170 CNV gain+loss 19812545
esv3388155 CNV duplication 20981092
esv3418459 CNV duplication 20981092
esv3551145 CNV deletion 23714750
esv3589634 CNV loss 21293372
esv3891470 CNV gain 25118596
esv989069 CNV insertion 20482838
nsv1005443 CNV gain 25217958
nsv1007175 CNV gain 25217958
nsv1007958 CNV gain 25217958
nsv1071561 CNV deletion 25765185
nsv1072377 CNV deletion 25765185
nsv1072378 CNV deletion 25765185
nsv1072379 CNV deletion 25765185
nsv1078915 CNV insertion 25765185
nsv1109227 CNV deletion 24896259
nsv1112324 CNV deletion 24896259
nsv1114043 CNV deletion 24896259
nsv1120367 CNV tandem duplication 24896259
nsv1121559 CNV deletion 24896259
nsv1123285 CNV deletion 24896259
nsv1125210 CNV insertion 24896259
nsv1125606 CNV deletion 24896259
nsv1126525 CNV deletion 24896259
nsv1129629 CNV tandem duplication 24896259
nsv1130743 CNV deletion 24896259
nsv1134824 CNV deletion 24896259
nsv1142866 CNV deletion 24896259
nsv1148521 CNV deletion 26484159
nsv215054 CNV deletion 16902084
nsv472360 CNV novel sequence insertion 20440878
nsv472876 CNV novel sequence insertion 20440878
nsv473666 CNV novel sequence insertion 20440878
nsv473856 CNV novel sequence insertion 20440878
nsv473887 CNV novel sequence insertion 20440878
nsv473940 CNV novel sequence insertion 20440878
nsv478975 CNV novel sequence insertion 20440878
nsv479035 CNV novel sequence insertion 20440878
nsv479276 CNV novel sequence insertion 20440878
nsv479612 CNV novel sequence insertion 20440878
nsv480803 CNV novel sequence insertion 20440878
nsv481164 CNV novel sequence insertion 20440878
nsv481476 CNV novel sequence insertion 20440878
nsv521199 CNV loss 19592680
nsv580758 CNV gain+loss 21841781
nsv580764 CNV loss 21841781
nsv821306 CNV deletion 20802225
nsv828064 CNV gain 20364138
nsv828075 CNV gain 20364138
nsv828086 CNV gain 20364138
nsv828097 CNV gain 20364138
nsv953375 CNV deletion 24416366
nsv999928 CNV gain 25217958

Variation tolerance for PXDN Gene

Residual Variation Intolerance Score: 4.58% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 4.70; 66.09% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for PXDN Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for PXDN Gene

Disorders for PXDN Gene

MalaCards: The human disease database

(3) MalaCards diseases for PXDN Gene - From: OMIM, ClinVar, GeneTests, Orphanet, Swiss-Prot, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
corneal opacification and other ocular anomalies
  • corneal opacification with other ocular anomalies
  • isolated congenital sclerocornea
  • microphthalmos
- elite association - COSMIC cancer census association via MalaCards
Search PXDN in MalaCards View complete list of genes associated with diseases


  • Corneal opacification with other ocular anomalies (COPOA) [MIM:269400]: An ocular disease characterized by sclerocornea associated with other ocular anomalies, such as cataract, microcornea, microphthalmia, and anterior segment dysgenesis. Sclerocornea is a primary anomaly in which scleralization of a peripheral part of the cornea, or the entire corneal tissue, occurs. In the peripheral type of sclerocornea, the affected area is vascularized with regular arcades of superficial scleral vessels. In total sclerocornea, the entire cornea is opaque and vascularized. {ECO:0000269 PubMed:21907015}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Relevant External Links for PXDN

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with PXDN: view

No data available for Genatlas for PXDN Gene

Publications for PXDN Gene

  1. Isolation of differentially expressed cDNAs from p53-dependent apoptotic cells: activation of the human homologue of the Drosophila peroxidasin gene. (PMID: 10441517) Horikoshi N. … Shenk T. (Biochem. Biophys. Res. Commun. 1999) 2 3 4 64
  2. Prediction of the coding sequences of unidentified human genes. VI. The coding sequences of 80 new genes (KIAA0201-KIAA0280) deduced by analysis of cDNA clones from cell line KG-1 and brain. (PMID: 9039502) Nagase T. … Nomura N. (DNA Res. 1996) 2 3 4 64
  3. Peroxidasin forms sulfilimine chemical bonds using hypohalous acids in tissue genesis. (PMID: 22842973) Bhave G. … Hudson B.G. (Nat. Chem. Biol. 2012) 2 3 64
  4. Homozygous mutations in PXDN cause congenital cataract, corneal opacity, and developmental glaucoma. (PMID: 21907015) Khan K. … Ali M. (Am. J. Hum. Genet. 2011) 3 4 64
  5. Assessment of a polymorphism of SDK1 with hypertension in Japanese Individuals. (PMID: 19851296) Oguri M. … Yamada Y. (Am. J. Hypertens. 2010) 3 46 64

Products for PXDN Gene

Sources for PXDN Gene

Loading form....