Free for academic non-profit institutions. Other users need a Commercial license

Aliases for PTPRD Gene

Aliases for PTPRD Gene

  • Protein Tyrosine Phosphatase, Receptor Type D 2 3 5
  • R-PTP-Delta 3 4
  • EC 3.1.3.48 4 61
  • Protein Tyrosine Phosphatase, Receptor Type, Delta Polypeptide 3
  • Receptor-Type Tyrosine-Protein Phosphatase Delta 3
  • Protein-Tyrosine Phosphatase Delta 4
  • HPTPDELTA 3
  • RPTPDELTA 3
  • HPTPD 3
  • HPTP 3
  • PTPD 3

External Ids for PTPRD Gene

Previous GeneCards Identifiers for PTPRD Gene

  • GC09M008470
  • GC09M008298

Summaries for PTPRD Gene

Entrez Gene Summary for PTPRD Gene

  • The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular region, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this protein is composed of three Ig-like and eight fibronectin type III-like domains. Studies of the similar genes in chicken and fly suggest the role of this PTP is in promoting neurite growth, and regulating neurons axon guidance. Multiple alternatively spliced transcript variants of this gene have been reported. A related pseudogene has been identified on chromosome 5. [provided by RefSeq, Jan 2010]

GeneCards Summary for PTPRD Gene

PTPRD (Protein Tyrosine Phosphatase, Receptor Type D) is a Protein Coding gene. Diseases associated with PTPRD include Restless Legs Syndrome and Central Nervous System Mesenchymal Non-Meningothelial Tumor. Among its related pathways are Transmission across Chemical Synapses and Protein-protein interactions at synapses. GO annotations related to this gene include receptor binding and protein tyrosine phosphatase activity. An important paralog of this gene is PTPRS.

Gene Wiki entry for PTPRD Gene

No data available for UniProtKB/Swiss-Prot , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for PTPRD Gene

Genomics for PTPRD Gene

Regulatory Elements for PTPRD Gene

Enhancers for PTPRD Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH09F010554 0.7 FANTOM5 13.6 +58.2 58234 0.4 PTPRD ENSG00000234360 GC09M010599 GC09M010600
GH09F010613 0.2 ENCODE 11.8 -0.3 -313 0.3 ZNF263 CTCF MAZ CBX2 ZFP69B ZNF692 CTBP2 KDM1A ZBTB26 PTPRD PTPRD-AS2
GH09F010563 0.3 FANTOM5 9.5 +48.7 48685 0.3 PTPRD ENSG00000234360 GC09M010599 GC09M010600
GH09F010446 0.5 FANTOM5 7.3 +166.5 166464 0.4 PTPRD ENSG00000234360 GC09M010263
GH09F010509 1.1 FANTOM5 5 +102.8 102767 0.2 PTPRD ENSG00000234360 GC09M010263
- Elite enhancer/Elite enhancer-gene association Download Table
Download GeneHancer data dump

Enhancers around PTPRD on UCSC Golden Path with GeneCards custom track

Promoters for PTPRD Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00001300039 -178 1000 ZNF263 CTCF MAZ HLF CBX2 ZFP69B ZNF335 ZNF692 CTBP2 KDM1A

Genomic Location for PTPRD Gene

Chromosome:
9
Start:
8,314,246 bp from pter
End:
10,612,723 bp from pter
Size:
2,298,478 bases
Orientation:
Minus strand

Genomic View for PTPRD Gene

Genes around PTPRD on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
PTPRD Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for PTPRD Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for PTPRD Gene

Proteins for PTPRD Gene

  • Protein details for PTPRD Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P23468-PTPRD_HUMAN
    Recommended name:
    Receptor-type tyrosine-protein phosphatase delta
    Protein Accession:
    P23468
    Secondary Accessions:
    • B1ALA0
    • F5GWT7
    • Q3KPJ0
    • Q3KPJ1
    • Q3KPJ2

    Protein attributes for PTPRD Gene

    Size:
    1912 amino acids
    Molecular mass:
    214760 Da
    Quaternary structure:
    • Interacts with IL1RAPL1 (via extracellular region); interaction is required for IL1RAPL1-mediated synapse formation (By similarity). Interacts with PPFIA1, PPFIA2 and PPFIA3.

    Three dimensional structures from OCA and Proteopedia for PTPRD Gene

    Alternative splice isoforms for PTPRD Gene

neXtProt entry for PTPRD Gene

Post-translational modifications for PTPRD Gene

  • A cleavage occurs, separating the extracellular domain from the transmembrane segment. This process called ectodomain shedding is thought to be involved in receptor desensitization, signal transduction and/or membrane localization.
  • Glycosylation at Asn 254, Asn 299, Asn 724, and Asn 832
  • Modification sites at PhosphoSitePlus

Domains & Families for PTPRD Gene

Graphical View of Domain Structure for InterPro Entry

P23468

UniProtKB/Swiss-Prot:

PTPRD_HUMAN :
  • Contains 8 fibronectin type-III domains.
  • Belongs to the protein-tyrosine phosphatase family. Receptor class 2A subfamily.
Domain:
  • Contains 8 fibronectin type-III domains.
  • Contains 3 Ig-like C2-type (immunoglobulin-like) domains.
  • Contains 2 tyrosine-protein phosphatase domains.
Family:
  • Belongs to the protein-tyrosine phosphatase family. Receptor class 2A subfamily.
genes like me logo Genes that share domains with PTPRD: view

Function for PTPRD Gene

Molecular function for PTPRD Gene

GENATLAS Biochemistry:
protein tyrosine phosphatase,receptor-type II,delta polypeptide
UniProtKB/Swiss-Prot CatalyticActivity:
Protein tyrosine phosphate + H(2)O = protein tyrosine + phosphate.

Enzyme Numbers (IUBMB) for PTPRD Gene

Gene Ontology (GO) - Molecular Function for PTPRD Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004725 protein tyrosine phosphatase activity IEA --
GO:0005001 transmembrane receptor protein tyrosine phosphatase activity TAS 7896816
GO:0005102 receptor binding ISS --
GO:0005515 protein binding IPI 12570871
GO:0016787 hydrolase activity IEA --
genes like me logo Genes that share ontologies with PTPRD: view
genes like me logo Genes that share phenotypes with PTPRD: view

Animal Model Products

Clone Products

  • Addgene plasmids for PTPRD

Flow Cytometry Products

No data available for Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for PTPRD Gene

Localization for PTPRD Gene

Subcellular locations from UniProtKB/Swiss-Prot for PTPRD Gene

Membrane; Single-pass type I membrane protein.

Subcellular locations from

COMPARTMENTS
Jensen Localization Image for PTPRD Gene COMPARTMENTS Subcellular localization image for PTPRD gene
Compartment Confidence
extracellular 5
plasma membrane 5
endoplasmic reticulum 1
golgi apparatus 1
mitochondrion 1

Gene Ontology (GO) - Cellular Components for PTPRD Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005886 plasma membrane TAS --
GO:0005887 integral component of plasma membrane TAS 7896816
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IEA --
GO:0070062 extracellular exosome IDA 23533145
genes like me logo Genes that share ontologies with PTPRD: view

Pathways & Interactions for PTPRD Gene

genes like me logo Genes that share pathways with PTPRD: view

Pathways by source for PTPRD Gene

SIGNOR curated interactions for PTPRD Gene

Inactivates:

Gene Ontology (GO) - Biological Process for PTPRD Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006470 protein dephosphorylation IEA,TAS 7896816
GO:0006796 phosphate-containing compound metabolic process NAS 7896816
GO:0007157 heterophilic cell-cell adhesion via plasma membrane cell adhesion molecules ISS --
GO:0007185 transmembrane receptor protein tyrosine phosphatase signaling pathway TAS 7896816
GO:0007268 chemical synaptic transmission TAS --
genes like me logo Genes that share ontologies with PTPRD: view

Drugs & Compounds for PTPRD Gene

(5) Drugs for PTPRD Gene - From: PharmGKB, HMDB, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Trandolapril Approved Pharma 21
Verapamil Approved Pharma Channel blocker 125
Phosphoric acid Approved Pharma 0
Water Approved Pharma 0

(1) Additional Compounds for PTPRD Gene - From: HMDB

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
Phosphate
  • NFB Orthophosphate
  • O-Phosphoric acid
  • Ortho-phosphate
  • Orthophosphate (PO43-)
  • Orthophosphate(3-)
14265-44-2
genes like me logo Genes that share compounds with PTPRD: view

Transcripts for PTPRD Gene

mRNA/cDNA for PTPRD Gene

(56) REFSEQ mRNAs :
(13) Additional mRNA sequences :
(2) Selected AceView cDNA sequences:
(15) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for PTPRD Gene

Protein tyrosine phosphatase, receptor type, D:
Representative Sequences:

Clone Products

  • Addgene plasmids for PTPRD

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for PTPRD Gene

ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7a · 7b ^ 8 ^ 9 ^ 10 ^ 11 ^ 12 ^ 13 ^ 14 ^ 15a · 15b ^ 16a · 16b ^ 17 ^ 18 ^ 19 ^ 20 ^ 21 ^ 22 ^ 23 ^
SP1: - - - - - -
SP2: - -
SP3:

ExUns: 24 ^ 25 ^ 26 ^ 27 ^ 28 ^ 29 ^ 30 ^ 31 ^ 32 ^ 33a · 33b
SP1:
SP2:
SP3:

Relevant External Links for PTPRD Gene

GeneLoc Exon Structure for
PTPRD
ECgene alternative splicing isoforms for
PTPRD

Expression for PTPRD Gene

mRNA expression in normal human tissues for PTPRD Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for PTPRD Gene

This gene is overexpressed in Brain - Cerebellum (x4.9), Brain - Cerebellar Hemisphere (x4.9), and Brain - Spinal cord (cervical c-1) (x4.8).

Protein differential expression in normal tissues from HIPED for PTPRD Gene

This gene is overexpressed in Cerebrospinal fluid (30.9), Fetal Brain (11.6), Brain (7.4), and Frontal cortex (6.4).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for PTPRD Gene



Protein tissue co-expression partners for PTPRD Gene

NURSA nuclear receptor signaling pathways regulating expression of PTPRD Gene:

PTPRD

SOURCE GeneReport for Unigene cluster for PTPRD Gene:

Hs.446083
genes like me logo Genes that share expression patterns with PTPRD: view

Primer Products

No data available for mRNA Expression by UniProt/SwissProt for PTPRD Gene

Orthologs for PTPRD Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for PTPRD Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia PTPRD 34 35
  • 99.56 (n)
mouse
(Mus musculus)
Mammalia Ptprd 35
  • 98 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia PTPRD 35
  • 97 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia PTPRD 35
  • 97 (a)
OneToOne
dog
(Canis familiaris)
Mammalia PTPRD 34 35
  • 94.18 (n)
cow
(Bos Taurus)
Mammalia PTPRD 34 35
  • 93.53 (n)
rat
(Rattus norvegicus)
Mammalia Ptprd 34
  • 91.9 (n)
chicken
(Gallus gallus)
Aves PTPRD 34 35
  • 85.11 (n)
lizard
(Anolis carolinensis)
Reptilia PTPRD 35
  • 90 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia Str.2212 34
African clawed frog
(Xenopus laevis)
Amphibia Xl.21031 34
zebrafish
(Danio rerio)
Actinopterygii ptprdb 34 35
  • 64.64 (n)
fruit fly
(Drosophila melanogaster)
Insecta Lar 36 34 35
  • 53.04 (n)
Ptp69D 36
  • 35 (a)
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP010090 34
  • 31.74 (n)
worm
(Caenorhabditis elegans)
Secernentea ptp-3 34
  • 59.52 (n)
F25H5.7 36
  • 35 (a)
Y48G9A.9 36
  • 34 (a)
K04D7.4 36
  • 33 (a)
wheat
(Triticum aestivum)
Liliopsida Ta.1188 34
sea squirt
(Ciona savignyi)
Ascidiacea CSA.1998 35
  • 46 (a)
OneToMany
Species where no ortholog for PTPRD was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)

Evolution for PTPRD Gene

ENSEMBL:
Gene Tree for PTPRD (if available)
TreeFam:
Gene Tree for PTPRD (if available)

Paralogs for PTPRD Gene

Variants for PTPRD Gene

Sequence variations from dbSNP and Humsavar for PTPRD Gene

SNP ID Clin Chr 09 pos Sequence Context AA Info Type
VAR_035645 A colorectal cancer sample
VAR_035646 A colorectal cancer sample
VAR_035647 A colorectal cancer sample
rs146237556 Uncertain significance 8,331,574(+) ATGGA(-/AACTTACCATTCCTGAACTGT/AACTTACCATTCTTGAACTGT/AACTTACCATTCTTGAACTGTAACT/AACTTACCCTTCTTGAACTGTAACT/AACTTACGATTCCTGAACTGT/AACTTACTTACCATTCCTGAACTGT/AACTTACTTACCATTCTTGAACTGT)AACTT intron-variant
rs150063446 Uncertain significance 8,317,921(+) GGCAC(A/G)ATAGG reference, missense

Structural Variations from Database of Genomic Variants (DGV) for PTPRD Gene

Variant ID Type Subtype PubMed ID
dgv1210n67 CNV loss 20364138
dgv1211n67 CNV loss 20364138
dgv12499n54 CNV loss 21841781
dgv12500n54 CNV loss 21841781
dgv12501n54 CNV loss 21841781
dgv12502n54 CNV loss 21841781
dgv12503n54 CNV loss 21841781
dgv12504n54 CNV loss 21841781
dgv12505n54 CNV loss 21841781
dgv12506n54 CNV loss 21841781
dgv12507n54 CNV loss 21841781
dgv12508n54 CNV loss 21841781
dgv12509n54 CNV loss 21841781
dgv12510n54 CNV loss 21841781
dgv12511n54 CNV loss 21841781
dgv12512n54 CNV loss 21841781
dgv12513n54 CNV loss 21841781
dgv12514n54 CNV loss 21841781
dgv12515n54 CNV loss 21841781
dgv12516n54 CNV loss 21841781
dgv12517n54 CNV loss 21841781
dgv12518n54 CNV loss 21841781
dgv1437e214 CNV loss 21293372
dgv1438e214 CNV loss 21293372
dgv1439e214 CNV loss 21293372
dgv1440e214 CNV loss 21293372
dgv2130e212 CNV gain 25503493
dgv217n73 CNV deletion 24416366
dgv3952n106 CNV deletion 24896259
dgv3953n106 CNV deletion 24896259
dgv3954n106 CNV deletion 24896259
dgv477n21 CNV loss 19592680
dgv478n21 CNV loss 19592680
dgv479n21 CNV loss 19592680
dgv7396n100 CNV loss 25217958
dgv7397n100 CNV gain 25217958
dgv7398n100 CNV loss 25217958
dgv7399n100 CNV loss 25217958
dgv7400n100 CNV loss 25217958
dgv7401n100 CNV loss 25217958
dgv7402n100 CNV loss 25217958
dgv7403n100 CNV gain 25217958
dgv7404n100 CNV gain 25217958
dgv7405n100 CNV loss 25217958
dgv915n27 CNV loss 19166990
dgv916n27 CNV loss 19166990
esv1001856 CNV deletion 20482838
esv1005977 CNV insertion 20482838
esv1010369 CNV deletion 20482838
esv1043147 CNV deletion 17803354
esv1082326 CNV insertion 17803354
esv1163845 CNV insertion 17803354
esv1229085 CNV deletion 17803354
esv1314470 CNV insertion 17803354
esv1535970 CNV insertion 17803354
esv1538552 CNV deletion 17803354
esv1585677 CNV deletion 17803354
esv1627386 CNV insertion 17803354
esv1766329 CNV deletion 17803354
esv1932426 CNV deletion 18987734
esv2114231 CNV deletion 18987734
esv2185581 CNV deletion 18987734
esv2223141 CNV deletion 18987734
esv2311235 CNV deletion 18987734
esv23663 CNV gain 19812545
esv2409256 CNV deletion 18987734
esv24167 CNV loss 19812545
esv2422381 CNV deletion 17116639
esv2427201 CNV deletion 19546169
esv2435626 CNV insertion 19546169
esv2445912 CNV deletion 19546169
esv2494179 CNV deletion 19546169
esv25218 CNV gain 19812545
esv2531598 CNV deletion 19546169
esv2556521 CNV deletion 19546169
esv2640344 CNV deletion 19546169
esv2657840 CNV deletion 23128226
esv2660314 CNV deletion 23128226
esv2660872 CNV deletion 23128226
esv2661178 CNV deletion 23128226
esv2661630 CNV deletion 23128226
esv2663067 CNV deletion 23128226
esv2663894 CNV deletion 23128226
esv2665825 CNV deletion 23128226
esv2666810 CNV deletion 23128226
esv2667270 CNV deletion 23128226
esv2667480 CNV deletion 23128226
esv2667750 CNV deletion 23128226
esv26678 CNV gain 19812545
esv2669282 CNV deletion 23128226
esv2671017 CNV deletion 23128226
esv2671051 CNV deletion 23128226
esv2671660 CNV deletion 23128226
esv2672296 CNV deletion 23128226
esv2675531 CNV deletion 23128226
esv2677386 CNV deletion 23128226
esv2677798 CNV deletion 23128226
esv26819 CNV loss 19812545
esv27358 CNV loss 19812545
esv2738182 CNV deletion 23290073
esv2738183 CNV deletion 23290073
esv2738185 CNV deletion 23290073
esv2738186 CNV deletion 23290073
esv2738187 CNV deletion 23290073
esv2738188 CNV deletion 23290073
esv2738189 CNV deletion 23290073
esv2738190 CNV deletion 23290073
esv2738191 CNV deletion 23290073
esv2738192 CNV deletion 23290073
esv2738193 CNV deletion 23290073
esv2738194 CNV deletion 23290073
esv2738196 CNV deletion 23290073
esv2738197 CNV deletion 23290073
esv2738198 CNV deletion 23290073
esv2738199 CNV deletion 23290073
esv2738200 CNV deletion 23290073
esv2752311 CNV loss 17911159
esv2759664 CNV loss 17122850
esv2759665 CNV loss 17122850
esv2759666 CNV loss 17122850
esv2759667 CNV loss 17122850
esv2761247 CNV loss 21179565
esv2761273 CNV loss 21179565
esv2761491 CNV gain 21179565
esv2761492 CNV loss 21179565
esv2762789 CNV loss 21179565
esv2762790 CNV loss 21179565
esv2762791 CNV loss 21179565
esv2764134 CNV gain 21179565
esv2764154 CNV loss 21179565
esv27909 CNV loss 19812545
esv28382 CNV loss 19812545
esv29008 CNV loss 19812545
esv3052 CNV loss 18987735
esv3122854 CNV deletion 24192839
esv3226 CNV loss 18987735
esv3268717 CNV deletion 24192839
esv3268828 CNV deletion 24192839
esv3303895 CNV mobile element insertion 20981092
esv3306199 CNV mobile element insertion 20981092
esv3308858 CNV mobile element insertion 20981092
esv3309543 CNV mobile element insertion 20981092
esv3309939 CNV mobile element insertion 20981092
esv3325269 CNV insertion 20981092
esv3344099 CNV insertion 20981092
esv3350357 CNV insertion 20981092
esv3364160 CNV insertion 20981092
esv3400582 CNV insertion 20981092
esv3404126 CNV insertion 20981092
esv3405909 CNV insertion 20981092
esv3429438 OTHER inversion 20981092
esv3433309 CNV insertion 20981092
esv34558 CNV loss 17911159
esv34992 CNV loss 17911159
esv3544498 CNV deletion 23714750
esv3544502 CNV deletion 23714750
esv3544505 CNV deletion 23714750
esv3544514 CNV deletion 23714750
esv3544515 CNV deletion 23714750
esv3544517 CNV deletion 23714750
esv3544521 CNV deletion 23714750
esv3544524 CNV deletion 23714750
esv3544525 CNV deletion 23714750
esv3573112 CNV loss 25503493
esv3573113 CNV loss 25503493
esv3573114 CNV loss 25503493
esv3573115 CNV loss 25503493
esv3573116 CNV loss 25503493
esv3573117 CNV loss 25503493
esv3573118 CNV loss 25503493
esv3573121 CNV loss 25503493
esv3573122 CNV loss 25503493
esv3573123 CNV loss 25503493
esv3576623 CNV gain 25503493
esv3576624 CNV gain 25503493
esv3576625 CNV gain 25503493
esv3576630 CNV gain 25503493
esv3619485 CNV loss 21293372
esv3619486 CNV loss 21293372
esv3619488 CNV loss 21293372
esv3619489 CNV loss 21293372
esv3619491 CNV loss 21293372
esv3619492 CNV loss 21293372
esv3619493 CNV loss 21293372
esv3619494 CNV loss 21293372
esv3619495 CNV loss 21293372
esv3619498 CNV gain 21293372
esv3619500 CNV loss 21293372
esv3619501 CNV loss 21293372
esv3619503 CNV loss 21293372
esv3619504 CNV loss 21293372
esv3619506 CNV loss 21293372
esv3619507 CNV loss 21293372
esv3619509 CNV loss 21293372
esv3619513 CNV loss 21293372
esv3619514 CNV loss 21293372
esv3619518 CNV loss 21293372
esv3619520 CNV loss 21293372
esv3619521 CNV loss 21293372
esv3619524 CNV loss 21293372
esv3619528 CNV loss 21293372
esv3619530 CNV loss 21293372
esv3619531 CNV loss 21293372
esv3619535 CNV loss 21293372
esv3619536 CNV loss 21293372
esv3619537 CNV loss 21293372
esv3619538 CNV loss 21293372
esv3619540 CNV loss 21293372
esv3619542 CNV loss 21293372
esv3619543 CNV loss 21293372
esv3619544 CNV gain 21293372
esv3619545 CNV loss 21293372
esv3619547 CNV loss 21293372
esv3619548 CNV loss 21293372
esv3619549 CNV loss 21293372
esv3619552 CNV loss 21293372
esv3619553 CNV loss 21293372
esv3619554 CNV loss 21293372
esv3619555 CNV loss 21293372
esv3619556 CNV loss 21293372
esv3619557 CNV loss 21293372
esv3619558 CNV loss 21293372
esv3619559 CNV loss 21293372
esv3891555 CNV loss 25118596
esv3891556 CNV loss 25118596
esv3891557 CNV loss 25118596
esv3891560 CNV loss 25118596
esv3891561 CNV loss 25118596
esv3891562 CNV loss 25118596
esv3891564 CNV gain 25118596
esv3891565 CNV gain 25118596
esv3891566 CNV loss 25118596
esv3891567 CNV loss 25118596
esv3933 CNV loss 18987735
esv4443 CNV loss 18987735
esv4583 CNV loss 18987735
esv6560 CNV loss 19470904
esv6672 CNV loss 19470904
esv7107 CNV gain 19470904
esv7310 CNV loss 19470904
esv9310 CNV loss 19470904
esv996283 CNV insertion 20482838
esv999794 CNV insertion 20482838
nsv1015187 CNV loss 25217958
nsv1015203 CNV gain 25217958
nsv1015898 CNV gain 25217958
nsv1016118 CNV loss 25217958
nsv1016235 CNV gain 25217958
nsv1018493 CNV gain 25217958
nsv1018814 CNV loss 25217958
nsv1019549 CNV loss 25217958
nsv1020369 CNV loss 25217958
nsv1020932 CNV loss 25217958
nsv1021440 CNV gain 25217958
nsv1021508 CNV loss 25217958
nsv1021769 CNV loss 25217958
nsv1022741 CNV gain 25217958
nsv1023524 CNV loss 25217958
nsv1023820 CNV loss 25217958
nsv1024452 CNV loss 25217958
nsv1025234 CNV loss 25217958
nsv1025791 CNV loss 25217958
nsv1026208 CNV loss 25217958
nsv1026525 CNV loss 25217958
nsv1026647 CNV gain 25217958
nsv1027042 CNV loss 25217958
nsv1028772 CNV loss 25217958
nsv1029136 CNV loss 25217958
nsv1029346 CNV gain 25217958
nsv1029813 CNV loss 25217958
nsv1030657 CNV gain 25217958
nsv1030899 CNV loss 25217958
nsv1031033 CNV loss 25217958
nsv1032936 CNV gain 25217958
nsv1033020 CNV gain 25217958
nsv1033178 CNV loss 25217958
nsv1033188 CNV loss 25217958
nsv1033299 CNV loss 25217958
nsv1033404 CNV gain 25217958
nsv1033808 CNV gain 25217958
nsv1034040 CNV gain 25217958
nsv1034236 CNV loss 25217958
nsv1034257 CNV loss 25217958
nsv1034584 CNV gain 25217958
nsv1034731 CNV loss 25217958
nsv1073877 CNV deletion 25765185
nsv1074290 CNV deletion 25765185
nsv1074294 CNV deletion 25765185
nsv1074299 CNV deletion 25765185
nsv1075189 CNV deletion 25765185
nsv1076135 CNV deletion 25765185
nsv1076136 CNV deletion 25765185
nsv1115155 CNV deletion 24896259
nsv1117862 CNV deletion 24896259
nsv1117863 CNV deletion 24896259
nsv1117864 CNV deletion 24896259
nsv1124399 CNV deletion 24896259
nsv1124400 CNV deletion 24896259
nsv1132185 CNV deletion 24896259
nsv1134920 CNV tandem duplication 24896259
nsv1137422 CNV deletion 24896259
nsv1137423 CNV deletion 24896259
nsv1140954 CNV deletion 24896259
nsv1149172 CNV deletion 26484159
nsv1152927 CNV insertion 26484159
nsv1161830 CNV deletion 26073780
nsv1161831 CNV deletion 26073780
nsv1161832 CNV deletion 26073780
nsv415375 CNV deletion 16902084
nsv415727 CNV deletion 16902084
nsv415985 CNV deletion 16902084
nsv416572 CNV deletion 16902084
nsv416854 CNV deletion 16902084
nsv416942 CNV deletion 16902084
nsv437081 CNV loss 16327808
nsv437082 CNV loss 16327808
nsv437083 CNV loss 16327808
nsv437084 CNV loss 16327808
nsv438091 CNV loss 16468122
nsv438092 CNV loss 16468122
nsv442133 CNV loss 18776908
nsv442134 CNV loss 18776908
nsv466124 CNV loss 19166990
nsv466128 CNV loss 19166990
nsv466129 CNV loss 19166990
nsv466130 CNV loss 19166990
nsv466131 CNV loss 19166990
nsv466144 CNV loss 19166990
nsv466145 CNV loss 19166990
nsv466147 CNV loss 19166990
nsv466148 CNV loss 19166990
nsv466150 CNV loss 19166990
nsv466153 CNV loss 19166990
nsv466155 CNV gain 19166990
nsv466156 CNV loss 19166990
nsv466157 CNV loss 19166990
nsv466158 CNV gain 19166990
nsv466159 CNV loss 19166990
nsv466161 CNV loss 19166990
nsv466162 CNV loss 19166990
nsv466163 CNV gain 19166990
nsv466164 CNV loss 19166990
nsv466167 CNV loss 19166990
nsv471275 CNV loss 18288195
nsv471276 CNV loss 18288195
nsv471277 CNV loss 18288195
nsv471278 CNV loss 18288195
nsv471279 CNV loss 18288195
nsv471280 CNV gain 18288195
nsv473030 CNV novel sequence insertion 20440878
nsv473040 CNV novel sequence insertion 20440878
nsv474429 CNV novel sequence insertion 20440878
nsv474777 CNV novel sequence insertion 20440878
nsv475354 CNV novel sequence insertion 20440878
nsv475638 CNV novel sequence insertion 20440878
nsv476619 CNV novel sequence insertion 20440878
nsv477624 CNV novel sequence insertion 20440878
nsv477770 CNV novel sequence insertion 20440878
nsv478408 CNV novel sequence insertion 20440878
nsv480094 CNV novel sequence insertion 20440878
nsv481250 CNV novel sequence insertion 20440878
nsv507503 OTHER sequence alteration 20534489
nsv507504 OTHER sequence alteration 20534489
nsv509295 CNV insertion 20534489
nsv510180 OTHER sequence alteration 20534489
nsv511420 CNV loss 21212237
nsv512088 CNV loss 21212237
nsv512089 CNV loss 21212237
nsv516073 CNV gain+loss 19592680
nsv517639 CNV loss 19592680
nsv518679 CNV loss 19592680
nsv518851 CNV loss 19592680
nsv519001 CNV loss 19592680
nsv519026 CNV loss 19592680
nsv519716 CNV loss 19592680
nsv520273 CNV loss 19592680
nsv520832 CNV loss 19592680
nsv521326 CNV loss 19592680
nsv522121 CNV loss 19592680
nsv523768 CNV loss 19592680
nsv524721 CNV loss 19592680
nsv524896 CNV gain 19592680
nsv524955 CNV loss 19592680
nsv524993 CNV gain 19592680
nsv525293 CNV loss 19592680
nsv526471 CNV loss 19592680
nsv526611 CNV gain 19592680
nsv526971 CNV loss 19592680
nsv527205 CNV loss 19592680
nsv527763 CNV loss 19592680
nsv528345 CNV loss 19592680
nsv528425 CNV loss 19592680
nsv528774 CNV loss 19592680
nsv528854 CNV loss 19592680
nsv528895 CNV loss 19592680
nsv613287 CNV gain 21841781
nsv613288 CNV loss 21841781
nsv613289 CNV loss 21841781
nsv613290 CNV loss 21841781
nsv613291 CNV loss 21841781
nsv613297 CNV loss 21841781
nsv613298 CNV loss 21841781
nsv613299 CNV loss 21841781
nsv613300 CNV loss 21841781
nsv613303 CNV loss 21841781
nsv613304 CNV loss 21841781
nsv613305 CNV loss 21841781
nsv613306 CNV loss 21841781
nsv613307 CNV loss 21841781
nsv613308 CNV gain 21841781
nsv613319 CNV loss 21841781
nsv613320 CNV loss 21841781
nsv613321 CNV loss 21841781
nsv613322 CNV loss 21841781
nsv613335 CNV gain 21841781
nsv613340 CNV gain 21841781
nsv613354 CNV loss 21841781
nsv613355 CNV loss 21841781
nsv613356 CNV loss 21841781
nsv613359 CNV loss 21841781
nsv613362 CNV gain 21841781
nsv613363 CNV loss 21841781
nsv613368 CNV loss 21841781
nsv613369 CNV loss 21841781
nsv613370 CNV gain 21841781
nsv613373 CNV loss 21841781
nsv613374 CNV loss 21841781
nsv613375 CNV gain 21841781
nsv613378 CNV loss 21841781
nsv613379 CNV loss 21841781
nsv613380 CNV loss 21841781
nsv613381 CNV loss 21841781
nsv613382 CNV loss 21841781
nsv613383 CNV loss 21841781
nsv613384 CNV loss 21841781
nsv613385 CNV loss 21841781
nsv613386 CNV loss 21841781
nsv613387 CNV loss 21841781
nsv613388 CNV gain 21841781
nsv613389 CNV loss 21841781
nsv613390 CNV gain 21841781
nsv613393 CNV loss 21841781
nsv6474 CNV deletion 18451855
nsv6475 CNV insertion 18451855
nsv6477 CNV insertion 18451855
nsv6478 CNV deletion 18451855
nsv818683 CNV gain 17921354
nsv818684 CNV loss 17921354
nsv819452 CNV gain 19587683
nsv820396 CNV deletion 20802225
nsv821534 CNV deletion 20802225
nsv824846 CNV loss 20364138
nsv824847 CNV loss 20364138
nsv824848 CNV loss 20364138
nsv824849 CNV loss 20364138
nsv824850 CNV loss 20364138
nsv831504 CNV loss 17160897
nsv831505 CNV gain 17160897
nsv831506 CNV gain 17160897
nsv831507 CNV loss 17160897
nsv831508 CNV gain 17160897
nsv8414 CNV loss 18304495
nsv957696 CNV deletion 24416366
nsv957703 CNV deletion 24416366
nsv968595 CNV duplication 23825009
nsv972648 CNV duplication 23825009
nsv973466 CNV deletion 23825009

Variation tolerance for PTPRD Gene

Residual Variation Intolerance Score: 0.47% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 7.32; 81.47% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for PTPRD Gene

Human Gene Mutation Database (HGMD)
PTPRD
SNPedia medical, phenotypic, and genealogical associations of SNPs for
PTPRD

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for PTPRD Gene

Disorders for PTPRD Gene

MalaCards: The human disease database

(2) MalaCards diseases for PTPRD Gene - From: DISEASES and GeneCards

Disorder Aliases PubMed IDs
restless legs syndrome
  • wed
central nervous system mesenchymal non-meningothelial tumor
  • non-meningothelial mesenchymal tumor
- elite association - COSMIC cancer census association via MalaCards
Search PTPRD in MalaCards View complete list of genes associated with diseases

Relevant External Links for PTPRD

Genetic Association Database (GAD)
PTPRD
Human Genome Epidemiology (HuGE) Navigator
PTPRD
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
PTPRD
genes like me logo Genes that share disorders with PTPRD: view

No data available for UniProtKB/Swiss-Prot and Genatlas for PTPRD Gene

Publications for PTPRD Gene

  1. Molecular characterization of the human transmembrane protein- tyrosine phosphatase delta. Evidence for tissue-specific expression of alternative human transmembrane protein-tyrosine phosphatase delta isoforms. (PMID: 7896816) Pulido R. … Streuli M. (J. Biol. Chem. 1995) 2 3 4 22 64
  2. A genome-wide association study identifies susceptibility variants for type 2 diabetes in Han Chinese. (PMID: 20174558) Tsai F.J. … Wu J.Y. (PLoS Genet. 2010) 3 22 46 64
  3. The tyrosine phosphatase PTPRD is a tumor suppressor that is frequently inactivated and mutated in glioblastoma and other human cancers. (PMID: 19478061) Veeriah S. … Chan T.A. (Proc. Natl. Acad. Sci. U.S.A. 2009) 3 22 46 64
  4. The polymorphisms of protein-tyrosine phosphatase receptor-type delta gene and its association with pediatric asthma in the Taiwanese population. (PMID: 18414509) Shyur S.D. … Wu L.S. (Eur. J. Hum. Genet. 2008) 3 22 46 64
  5. PTPRD (protein tyrosine phosphatase receptor type delta) is associated with restless legs syndrome. (PMID: 18660810) Schormair B. … Winkelmann J. (Nat. Genet. 2008) 3 22 46 64

Products for PTPRD Gene

Sources for PTPRD Gene

Content
Loading form....