Free for academic non-profit institutions. Other users need a Commercial license

Aliases for PSMC6 Gene

Aliases for PSMC6 Gene

  • Proteasome 26S Subunit, ATPase 6 2 3 5
  • Proteasome (Prosome, Macropain) 26S Subunit, ATPase, 6 2 3
  • 26S Proteasome AAA-ATPase Subunit RPT4 3 4
  • Proteasome 26S Subunit ATPase 6 3 4
  • Proteasome Subunit P42 3 4
  • SUG2 3 4
  • 26S Protease Regulatory Subunit S10B 3
  • Conserved ATPase Domain Protein 44 3
  • Epididymis Secretory Protein Li 73 3
  • HEL-S-73 3
  • CADP44 3
  • P42 3
  • P44 3

External Ids for PSMC6 Gene

Previous GeneCards Identifiers for PSMC6 Gene

  • GC14P050496
  • GC14P046969
  • GC14P051163
  • GC14P052243
  • GC14P053173
  • GC14P033334

Summaries for PSMC6 Gene

Entrez Gene Summary for PSMC6 Gene

  • The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. Pseudogenes have been identified on chromosomes 8 and 12. [provided by RefSeq, Jul 2008]

GeneCards Summary for PSMC6 Gene

PSMC6 (Proteasome 26S Subunit, ATPase 6) is a Protein Coding gene. Diseases associated with PSMC6 include phaeochromocytoma. Among its related pathways are Gene Expression and Signaling by GPCR. GO annotations related to this gene include hydrolase activity and protein binding, bridging.

UniProtKB/Swiss-Prot for PSMC6 Gene

  • The 26S protease is involved in the ATP-dependent degradation of ubiquitinated proteins. The regulatory (or ATPase) complex confers ATP dependency and substrate specificity to the 26S complex.

Gene Wiki entry for PSMC6 Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for PSMC6 Gene

Genomics for PSMC6 Gene

Regulatory Elements for PSMC6 Gene

Promoters for PSMC6 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

ENSRs around PSMC6 on UCSC Golden Path with GeneCards custom track

Genomic Location for PSMC6 Gene

52,707,163 bp from pter
52,728,587 bp from pter
21,425 bases
Plus strand

Genomic View for PSMC6 Gene

Genes around PSMC6 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
PSMC6 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for PSMC6 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for PSMC6 Gene

Proteins for PSMC6 Gene

  • Protein details for PSMC6 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    26S protease regulatory subunit 10B
    Protein Accession:
    Secondary Accessions:
    • B2R975
    • P49719
    • Q6IBU3
    • Q92524

    Protein attributes for PSMC6 Gene

    389 amino acids
    Molecular mass:
    44173 Da
    Quaternary structure:
    • Found in the multi-protein complexes: the 26S proteasome (formed from the 20S proteasome and PA700), and the modulator. PA700 consists of 28 subunits arranged to form a cylinder-shaped complex by four stacked rings, each containing seven subunits. Interacts with PAAF1.

neXtProt entry for PSMC6 Gene

Proteomics data for PSMC6 Gene at MOPED

Post-translational modifications for PSMC6 Gene

  • Ubiquitination at Lys 7, Lys 20, Lys 48, Lys 168, Lys 180, Lys 197, Lys 274, Lys 298, Lys 314, Lys 322, Lys 333, and Lys 369
  • Modification sites at PhosphoSitePlus

Antibody Products

  • Cloud-Clone Corp. Antibodies for PSMC6

No data available for DME Specific Peptides for PSMC6 Gene

Domains & Families for PSMC6 Gene

Gene Families for PSMC6 Gene

Protein Domains for PSMC6 Gene

Suggested Antigen Peptide Sequences for PSMC6 Gene

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the AAA ATPase family.
  • Belongs to the AAA ATPase family.
genes like me logo Genes that share domains with PSMC6: view

Function for PSMC6 Gene

Molecular function for PSMC6 Gene

GENATLAS Biochemistry:
multicatalytic proteinase complex (prosome,macropain,26kDa) 19/22S regulator of proteasome p42,ATPase subunit,44kDa
UniProtKB/Swiss-Prot Function:
The 26S protease is involved in the ATP-dependent degradation of ubiquitinated proteins. The regulatory (or ATPase) complex confers ATP dependency and substrate specificity to the 26S complex.

Gene Ontology (GO) - Molecular Function for PSMC6 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0016787 hydrolase activity IEA --
GO:0030674 protein binding, bridging NAS 11590019
genes like me logo Genes that share ontologies with PSMC6: view
genes like me logo Genes that share phenotypes with PSMC6: view

Animal Model Products

miRNA for PSMC6 Gene

miRTarBase miRNAs that target PSMC6

Inhibitory RNA Products

In Situ Assay Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for PSMC6 Gene

Localization for PSMC6 Gene

Subcellular locations from UniProtKB/Swiss-Prot for PSMC6 Gene

Cytoplasm. Nucleus.

Subcellular locations from

Jensen Localization Image for PSMC6 Gene COMPARTMENTS Subcellular localization image for PSMC6 gene
Compartment Confidence
cytosol 5
extracellular 5
nucleus 5
plasma membrane 3
cytoskeleton 2
peroxisome 2

Gene Ontology (GO) - Cellular Components for PSMC6 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005737 cytoplasm IEA --
GO:0005829 cytosol TAS --
GO:0008540 proteasome regulatory particle, base subcomplex IBA --
GO:0031595 nuclear proteasome complex IBA --
GO:0070062 extracellular exosome IDA 19056867
genes like me logo Genes that share ontologies with PSMC6: view

Pathways & Interactions for PSMC6 Gene

SuperPathways for PSMC6 Gene

Superpath Contained pathways
1 CDK-mediated phosphorylation and removal of Cdc6
2 Interleukin-3, 5 and GM-CSF signaling
3 Chks in Checkpoint Regulation
4 Infectious disease
5 Immune System
genes like me logo Genes that share pathways with PSMC6: view

Gene Ontology (GO) - Biological Process for PSMC6 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000165 MAPK cascade TAS --
GO:0000186 activation of MAPKK activity TAS --
GO:0000209 protein polyubiquitination TAS --
GO:0002223 stimulatory C-type lectin receptor signaling pathway TAS --
GO:0002474 antigen processing and presentation of peptide antigen via MHC class I TAS --
genes like me logo Genes that share ontologies with PSMC6: view

No data available for SIGNOR curated interactions for PSMC6 Gene

Drugs & Compounds for PSMC6 Gene

(19) Drugs for PSMC6 Gene - From: Novoseek and DGIdb

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Bortezomib Approved, Experimental, Investigational Pharma inhibitor, other Proteosome and NF-kappaB inhibitor, Other, Proteasome inhibitors 769
carfilzomib Approved Pharma other, Inhibitor Other, 20S Proteasome Inhibitor 0

(11) Additional Compounds for PSMC6 Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with PSMC6: view

Transcripts for PSMC6 Gene

Unigene Clusters for PSMC6 Gene

Proteasome (prosome, macropain) 26S subunit, ATPase, 6:
Representative Sequences:

Inhibitory RNA Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for PSMC6 Gene

No ASD Table

Relevant External Links for PSMC6 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for PSMC6 Gene

mRNA expression in normal human tissues for PSMC6 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for PSMC6 Gene

This gene is overexpressed in Peripheral blood mononuclear cells (7.5).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MOPED, and MaxQB for PSMC6 Gene

SOURCE GeneReport for Unigene cluster for PSMC6 Gene Hs.156171

genes like me logo Genes that share expression patterns with PSMC6: view

Protein tissue co-expression partners for PSMC6 Gene

- Elite partner

Primer Products

In Situ Assay Products

No data available for mRNA differential expression in normal tissues and mRNA Expression by UniProt/SwissProt for PSMC6 Gene

Orthologs for PSMC6 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for PSMC6 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia PSMC6 36
  • 100 (a)
PSMC6 35
  • 100 (n)
  • 100 (a)
(Bos Taurus)
Mammalia PSMC6 36
  • 100 (a)
PSMC6 35
  • 95.46 (n)
  • 99.74 (a)
(Canis familiaris)
Mammalia PSMC6 35
  • 96.44 (n)
  • 100 (a)
PSMC6 36
  • 100 (a)
(Mus musculus)
Mammalia Psmc6 16
Psmc6 36
  • 100 (a)
Psmc6 35
  • 93.14 (n)
  • 100 (a)
(Monodelphis domestica)
Mammalia PSMC6 36
  • 100 (a)
(Ornithorhynchus anatinus)
Mammalia PSMC6 36
  • 94 (a)
(Rattus norvegicus)
Mammalia Psmc6 35
  • 92.89 (n)
  • 99.75 (a)
(Gallus gallus)
Aves PSMC6 35
  • 85.09 (n)
  • 99.74 (a)
PSMC6 36
  • 91 (a)
(Anolis carolinensis)
Reptilia PSMC6 36
  • 99 (a)
African clawed frog
(Xenopus laevis)
Amphibia Xl.3381 35
tropical clawed frog
(Silurana tropicalis)
Amphibia MGC76159 35
psmc6 35
  • 83.2 (n)
  • 98.97 (a)
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.8441 35
(Danio rerio)
Actinopterygii psmc6 36
  • 97 (a)
Dr.29047 35
psmc6 35
  • 78.75 (n)
  • 97.17 (a)
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP001407 35
  • 69.44 (n)
  • 89.87 (a)
fruit fly
(Drosophila melanogaster)
Insecta Rpt4 35
  • 70.22 (n)
  • 89.35 (a)
Rpt4 36
  • 87 (a)
Rpt4R 36
  • 80 (a)
CG7257 37
  • 81 (a)
Rpt4 37
  • 88 (a)
(Caenorhabditis elegans)
Secernentea rpt-4 35
  • 67.86 (n)
  • 81.79 (a)
rpt-4 36
  • 79 (a)
A. gosspyii yeast
(Ashbya gossypii)
Saccharomycetes AGOS_AAL113W 35
  • 61.9 (n)
  • 69.61 (a)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes RPT4 36
  • 60 (a)
RPT4 35
  • 64.4 (n)
  • 68.59 (a)
K. lactis yeast
(Kluyveromyces lactis)
Saccharomycetes KLLA0C09592g 35
  • 62.23 (n)
  • 69.19 (a)
Alicante grape
(Vitis vinifera)
eudicotyledons Vvi.5748 35
thale cress
(Arabidopsis thaliana)
eudicotyledons RPT4A 35
  • 69.55 (n)
  • 77.23 (a)
(Hordeum vulgare)
Liliopsida Hv.5889 35
(Zea mays)
Liliopsida Zm.3972 35
(Oryza sativa)
Liliopsida Os.292 35
Os02g0199900 35
  • 68.74 (n)
  • 77.46 (a)
(Triticum aestivum)
Liliopsida Ta.14349 35
bread mold
(Neurospora crassa)
Ascomycetes NCU07367 35
  • 61.84 (n)
  • 74.94 (a)
fission yeast
(Schizosaccharomyces pombe)
Schizosaccharomycetes rpt4 35
  • 63.79 (n)
  • 73.89 (a)
sea squirt
(Ciona intestinalis)
Ascidiacea Cin.11771 35
sea squirt
(Ciona savignyi)
Ascidiacea CSA.3434 36
  • 90 (a)
Species with no ortholog for PSMC6:
  • Actinobacteria (Mycobacterium tuberculosis)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)

Evolution for PSMC6 Gene

Gene Tree for PSMC6 (if available)
Gene Tree for PSMC6 (if available)

Paralogs for PSMC6 Gene Pseudogenes for PSMC6 Gene

genes like me logo Genes that share paralogs with PSMC6: view

No data available for Paralogs for PSMC6 Gene

Variants for PSMC6 Gene

Sequence variations from dbSNP and Humsavar for PSMC6 Gene

SNP ID Clin Chr 14 pos Sequence Context AA Info Type
rs3732 -- 52,727,759(-) TTGAA(C/T)TACTA nc-transcript-variant, utr-variant-3-prime
rs6696 -- 52,727,701(+) ATTGG(C/T)AATGA nc-transcript-variant, utr-variant-3-prime
rs767669 -- 52,715,641(+) taagg(G/T)gttac intron-variant
rs1803069 -- 52,711,481(+) TTATT(C/T)TGAGA nc-transcript-variant, reference, missense
rs3830983 -- 52,711,018(+) AGTGT(-/TTGGCTTCTAAATATTAAACTCTCGTTAGAGTGT)TATTC intron-variant

Structural Variations from Database of Genomic Variants (DGV) for PSMC6 Gene

Variant ID Type Subtype PubMed ID
nsv832796 CNV Loss 17160897
esv2090227 CNV Deletion 18987734

Variation tolerance for PSMC6 Gene

Residual Variation Intolerance Score: 25% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.38; 8.34% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for PSMC6 Gene

HapMap Linkage Disequilibrium report

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for PSMC6 Gene

Disorders for PSMC6 Gene

MalaCards: The human disease database

(1) MalaCards diseases for PSMC6 Gene - From: DISEASES and GeneCards

Disorder Aliases PubMed IDs
  • pheochromocytoma
- elite association - COSMIC cancer census association via MalaCards
Search PSMC6 in MalaCards View complete list of genes associated with diseases

Relevant External Links for PSMC6

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with PSMC6: view

No data available for UniProtKB/Swiss-Prot and Genatlas for PSMC6 Gene

Publications for PSMC6 Gene

  1. cDNA cloning of p42, a shared subunit of two proteasome regulatory proteins, reveals a novel member of the AAA protein family. (PMID: 8674546) Fujiwara T. … Demartino G.N. (FEBS Lett. 1996) 2 3 4 67
  2. Chromosomal localization and immunological analysis of a family of human 26S proteasomal ATPases. (PMID: 9473509) Tanahashi N. … Tanaka K. (Biochem. Biophys. Res. Commun. 1998) 2 3 23
  3. Selective chemical inactivation of AAA proteins reveals distinct functions of proteasomal ATPases. (PMID: 11590019) Russell S.J. … Johnston S.A. (Chem. Biol. 2001) 3 23
  4. Activator complexes containing the proteasomal regulatory ATPases S10b (SUG2) and S6 (TBP1) in different tissues and organisms. (PMID: 10363644) Hastings R. … Mayer R.J. (Mol. Biol. Rep. 1999) 3 23
  5. Advanced oxidation protein products decrease the expression of calcium transport channels in small intestinal epithelium via the p44/42 MAPK signaling pathway. (PMID: 25801217) Wu P. … Bai L. (Eur. J. Cell Biol. 2015) 3

Products for PSMC6 Gene

Sources for PSMC6 Gene

Back to Top
