Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



PRTN3 Gene

protein-coding   GIFtS: 62
GCID: GC19P000840

Proteinase 3

  See related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Aliases
Proteinase 31 2     C-ANCA Antigen2 3
AGP72 3 5     neutrophil1
myeloblastin1 2     Serine Proteinase1
Wegener Granulomatosis Autoantigen1 2     ACPA2
Leukocyte Proteinase 32 3     C-ANCA2
Neutrophil Proteinase 42 3     CANCA2
Wegener Autoantigen2 3     MBT2
MBN2 3     NP42
NP-42 3     Azurophil Granule Protein 72
P292 3     Serine Proteinase, Neutrophil2
PR-32 3     EC 3.4.21.763
PR32 3     EC 3.4.218

External Ids:    HGNC: 94951   Entrez Gene: 56572   Ensembl: ENSG000001964157   OMIM: 1770205   UniProtKB: P241583   

Export aliases for PRTN3 gene to outside databases

Previous GC identifers: GC19P000922 GC19P000910 GC19P000780 GC19P000793 GC19P000498 GC19P000794 GC19P000610


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

GeneCards Summary for PRTN3 Gene:
PRTN3 (proteinase 3) is a protein-coding gene. Diseases associated with PRTN3 include subacute bacterial endocarditis, and wegener's granulomatosis. GO annotations related to this gene include serine-type peptidase activity and enzyme binding. An important paralog of this gene is GZMH.

UniProtKB/Swiss-Prot: PRTN3_HUMAN, P24158
Function: Polymorphonuclear leukocyte serine protease that degrades elastin, fibronectin, laminin, vitronectin,
and collagen types I, III, and IV (in vitro) and causes emphysema when administered by tracheal insufflation to
hamsters

Gene Wiki entry for PRTN3 (Proteinase 3) Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence:
NC_000019.10  NC_018930.2  NT_011295.12  NT_187622.1  
Regulatory elements:
   Regulatory transcription factor binding sites in the PRTN3 gene promoter:
         AML1a   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidPRTN3 promoter sequence
   Search Chromatin IP Primers for PRTN3

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat PRTN3


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 19p13.3   Ensembl cytogenetic band:  19p13.3   HGNC cytogenetic band: 19p13.3

PRTN3 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
PRTN3 gene location

GeneLoc information about chromosome 19         GeneLoc Exon Structure

GeneLoc location for GC19P000840:  view genomic region     (about GC identifiers)

Start:
840,963 bp from pter      End:
848,175 bp from pter
Size:
7,213 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, Cloud-Clone Corp, and/or others.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: PRTN3_HUMAN, P24158 (See protein sequence)
Recommended Name: Myeloblastin precursor  
Size: 256 amino acids; 27807 Da
Sequence caution: Sequence=AAA36342.1; Type=Frameshift; Positions=34, 39; Sequence=CAA39598.1; Type=Erroneous
initiation;
1 PDB 3D structure from and Proteopedia for PRTN3:
1FUJ (3D)    
Secondary accessions: P15637 P18078 Q4VB08 Q4VB09 Q6LBM7 Q6LBN2 Q9UD25 Q9UQD8

Explore the universe of human proteins at neXtProt for PRTN3: NX_P24158

Explore proteomics data for PRTN3 at MOPED

Post-translational modifications: 

  • Glycosylation2 at Asn129, Asn174
  • Selected DME Specific Peptides for PRTN3 (P24158) (see all 5)
     GDSGGPL  SGGPLIC  VLTAAHC  PHSRPYMA 


    See PRTN3 Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins: NP_002768.3  
    ENSEMBL proteins: 
     ENSP00000234347   ENSP00000475174  

    PRTN3 Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Enzo Life Sciences proteins for PRTN3
    OriGene Purified Proteins for PRTN3
    OriGene Protein Over-expression Lysate for PRTN3
    OriGene MassSpec for PRTN3
    OriGene Custom Protein Services for PRTN3
    GenScript Custom Purified and Recombinant Proteins Services for PRTN3
    Novus Biologicals PRTN3 Proteins
    Novus Biologicals PRTN3 Lysates
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    ProSpec Recombinant Protein for PRTN3
    Browse Proteins at Cloud-Clone Corp.

    PRTN3 Antibody Products:

    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    R&D Systems Antibodies for PRTN3 (Proteinase 3/Myeloblastin/PRTN3)
    OriGene Antibodies for PRTN3
    OriGene Custom Antibody Services for PRTN3
    Novus Biologicals PRTN3 Antibodies
    Abcam antibodies for PRTN3
    Browse Antibodies at Cloud-Clone Corp.
    ThermoFisher Antibody for PRTN3
    LSBio Antibodies in human, mouse, rat for PRTN3

    PRTN3 Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for PRTN3
    R&D Systems ELISAs for PRTN3 (Proteinase 3/Myeloblastin/PRTN3)         (see all)
    GenScript Custom Assay Services for PRTN3
    Browse Enzo Life Sciences for kits & assays
    Browse ELISAs at Cloud-Clone Corp.
    Browse CLIAs at Cloud-Clone Corp.


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    4 InterPro protein domains:
     IPR001314 Peptidase_S1A
     IPR001254 Peptidase_S1
     IPR018114 Peptidase_S1_AS
     IPR009003 Trypsin-like_Pept_dom

    Graphical View of Domain Structure for InterPro Entry P24158

    ProtoNet protein and cluster: P24158

    2 Blocks protein domains:
    IPB001254 Serine protease
    IPB001314 Chymotrypsin serine protease family (S1) signature


    UniProtKB/Swiss-Prot: PRTN3_HUMAN, P24158
    Similarity: Belongs to the peptidase S1 family. Elastase subfamily
    Similarity: Contains 1 peptidase S1 domain


    PRTN3 for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: PRTN3_HUMAN, P24158
    Function: Polymorphonuclear leukocyte serine protease that degrades elastin, fibronectin, laminin, vitronectin,
    and collagen types I, III, and IV (in vitro) and causes emphysema when administered by tracheal insufflation to
    hamsters
    Catalytic activity: Hydrolysis of proteins, including elastin, by preferential cleavage: -Ala- -Xaa- > -Val- -Xaa-

         Genatlas biochemistry entry for PRTN3:
    proteinase 3,myeloblastin,Wegener autoantigen,responsive to CSF3,stimulated by SPI1,MYB,inducing factor
    independent growth of hematopoietic cells

         Enzyme Numbers (IUBMB): EC 3.4.212 EC 3.4.21.761

         Gene Ontology (GO): 4 molecular function terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0003824catalytic activity ----
    GO:0004252serine-type endopeptidase activity IEA--
    GO:0008236serine-type peptidase activity TAS2679910
    GO:0019899enzyme binding IPI17712045
         
    PRTN3 for ontologies           About GeneDecksing


    Phenotypes:
         2 GenomeRNAi human phenotypes for PRTN3:
     Decreased viability  Synthetic lethal with Ras 

         2 MGI mutant phenotypes (inferred from 1 allele(MGI details for Prtn3):
     hematopoietic system  immune system 

    PRTN3 for phenotypes           About GeneDecksing

    Animal Models:
         MGI mouse knock-out Elane/Prtn3Elane/tm1Deje for PRTN3

       inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for PRTN3
       inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for PRTN3

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for PRTN3
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for PRTN3

    miRNA
    Products:
        
    Block miRNA regulation of human, mouse, rat PRTN3 using miScript Target Protectors
    Search for qRT-PCR Assays for microRNAs that regulate PRTN3
    SwitchGear 3'UTR luciferase reporter plasmidPRTN3 3' UTR sequence
    Inhib. RNA
    Products:
        
    OriGene RNAi products in human, mouse, rat for PRTN3
    Predesigned siRNA for gene silencing in human, mouse, rat PRTN3

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for PRTN3

    Clone
    Products:
         
    OriGene clones in human, mouse for PRTN3 (see all 6)
    OriGene ORF clones in mouse, rat for PRTN3
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: PRTN3 (NM_002777)
    Sino Biological Human cDNA Clone for PRTN3
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for PRTN3
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat PRTN3

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for PRTN3
    Browse ESI BIO Cell Lines and PureStem Progenitors for PRTN3 
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for PRTN3


    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from COMPARTMENTS: 

    CompartmentConfidence
    cytosol5
    plasma membrane5
    extracellular3
    lysosome3
    vacuole3
    nucleus2
    cytoskeleton1

    Gene Ontology (GO): 4 cellular component terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005829cytosol IDA17712045
    GO:0005886plasma membrane IDA17712045
    GO:0031012colocalizes with extracellular matrix IDA--
    GO:0070062extracellular vesicular exosome IDA19056867

    PRTN3 for ontologies           About GeneDecksing


    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus

    SuperPaths for PRTN3 About    
    See pathways by source

    SuperPathContained pathways About
    1C-MYB transcription factor network
    C-MYB transcription factor network


    1 BioSystems Pathway for PRTN3
        C-MYB transcription factor network



        Pathway & Disease-focused RT2 Profiler PCR Array including PRTN3: 
              Antibacterial Response in human mouse rat

    Interactions:

        GeneGlobe Interaction Network for PRTN3

    STRING Interaction Network Preview (showing 5 interactants - click image to see 19)

    Selected Interacting proteins for PRTN3 (P241582, 3 ENSP000002343474) via UniProtKB, MINT, STRING, and/or I2D (see all 58)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    TNFP013753, ENSP000003986984I2D: score=1 STRING: ENSP00000398698
    ENSG00000204490P013753I2D: score=1 
    ENSG00000206439P013753I2D: score=1 
    ENSG00000223952P013753I2D: score=1 
    ENSG00000228321P013753I2D: score=1 
    About this table

    Gene Ontology (GO): 5 biological process terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006508proteolysis ----
    GO:0008284positive regulation of cell proliferation TAS2598267
    GO:0030574collagen catabolic process IEA--
    GO:0050765negative regulation of phagocytosis IDA17712045
    GO:0097029mature dendritic cell differentiation IDA16478888

    PRTN3 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Enzo Life Sciences drugs & compounds for PRTN3
      Browse compounds at ApexBio 

    Browse Tocris compounds for PRTN3

    Selected Novoseek inferred chemical compound relationships for PRTN3 gene (see all 44)    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    serine 75.5 224 2033050 (4), 1400430 (3), 11272267 (3), 1681549 (3) (see all 99)
    propylthiouracil 63.2 5 10025935 (1), 8103148 (1), 17350787 (1), 17161817 (1)
    acpa 58.3 5 1316247 (1), 2240162 (1), 1656761 (1), 1688612 (1)
    sulf 55.6 3 7586784 (1), 7612152 (1)
    aebsf 53.6 1 12354776 (1)
    3,4-dichloroisocoumarin 50.6 4 14525961 (1), 9067256 (1), 1551417 (1)
    pmsf 40.3 5 12960243 (1), 8033421 (1), 9500517 (1)
    fmlp 32.9 1 10498622 (1)
    phthalimide 32.6 4 7796053 (2), 8806743 (2)
    n-formylmethionyl-leucylphenylalanine 29.6 1 10614782 (1)



    PRTN3 for compounds           About GeneDecksing



    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, and/or QIAGEN )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for PRTN3 gene: 
    NM_002777.3  

    Unigene Cluster for PRTN3:

    Proteinase 3
    Hs.928  [show with all ESTs]
    Unigene Representative Sequence: FN647680
    2 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000234347(uc002lqa.1) ENST00000544537(uc021umb.1)
    miRNA
    Products:
         
    Block miRNA regulation of human, mouse, rat PRTN3 using miScript Target Protectors
    Search for qRT-PCR Assays for microRNAs that regulate PRTN3
    SwitchGear 3'UTR luciferase reporter plasmidPRTN3 3' UTR sequence
    Inhib. RNA
    Products:
         
    OriGene RNAi products in human, mouse, rat for PRTN3
    Predesigned siRNA for gene silencing in human, mouse, rat PRTN3
    Clone
    Products:
         
    OriGene clones in human, mouse for PRTN3 (see all 6)
    OriGene ORF clones in mouse, rat for PRTN3
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: PRTN3 (NM_002777)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for PRTN3
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat PRTN3
    Primer
    Products:
        
    OriGene qPCR primer pairs and template standards for PRTN3
    OriGene qSTAR qPCR primer pairs in human, mouse for PRTN3
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat PRTN3
      QuantiTect SYBR Green Assays in human, mouse, rat PRTN3
      QuantiFast Probe-based Assays in human, mouse, rat PRTN3

    Additional mRNA sequence: 

    BC096183.1 BC096184.3 BC096185.3 BC096186.3 FN647680.1 M29142.1 M75154.1 X55668.1 
    X56132.1 X56606.1 

    1 DOTS entry:

    DT.310571 

    Selected AceView cDNA sequences (see all 27):

    BV185512 BV199984 BV199995 X56606 BP428518 BI029018 BP429701 BI029214 
    BV199994 X56132 BP428468 BF893078 NM_002777 X55668 M75154 M29142 
    BE831590 AI273534 BF898648 BQ335282 BI026807 AW966814 BI028421 D19823 

    GeneLoc Exon Structure


    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    PRTN3 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: --
    PRTN3 Expression
    About this image


    PRTN3 expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database
     selected tissues (see all 4) fully expand
     
     Blood (Hematopoietic System)    fully expand to see all 8 entries
             Hematopoietic Stem Cells Hematopoietic Bone Marrow
             Bone marrow-derived hematopoietic stem cells (family)
             Bone Marrow CD34+ Cells   
             bone marrow mononuclear cells   
     
     Bone (Muscoskeletal System)    fully expand to see all 2 entries
             Bone Marrow
             bone marrow   
     
     Liver (Hepatobiliary System)
             Fetal Liver CD34+ Cells   
     
     Skeletal Muscle (Muscoskeletal System)    fully expand to see all 2 entries
             Mononuclear Myocytes Hyoid Arch Muscles
    PRTN3 Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    PRTN3 Protein Expression

    SOURCE GeneReport for Unigene cluster: Hs.928
        Pathway & Disease-focused RT2 Profiler PCR Array including PRTN3: 
              Antibacterial Response in human mouse rat

    Primer
    Products:
    OriGene qPCR primer pairs and template standards for PRTN3
    OriGene qSTAR qPCR primer pairs in human, mouse for PRTN3
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat PRTN3
    QuantiTect SYBR Green Assays in human, mouse, rat PRTN3
    QuantiFast Probe-based Assays in human, mouse, rat PRTN3
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for PRTN3

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of animals.

    Orthologs for PRTN3 gene from Selected species (see all 7)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Prtn31 , 5 proteinase 31, 5 73.19(n)1
    68(a)1
      10 (39.72 cM)5
    191521  NM_011178.21  NP_035308.21 
     798744765 
    tropical clawed frog
    (Xenopus tropicalis)
    Amphibia prtn31 proteinase 3 55.61(n)
    52.8(a)
      448597  NM_001006846.1  NP_001006847.1 
    mosquito
    (Anopheles gambiae)
    Insecta AgaP_AGAP0071421 AgaP_AGAP007142 47.76(n)
    38.94(a)
      1269964  XM_308619.3  XP_308619.3 


    ENSEMBL Gene Tree for PRTN3 (if available)
    TreeFam Gene Tree for PRTN3 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section

    TryGeneCards Plus
    Paralogs for PRTN3 gene
    GZMH2  GZMK2  PRSS572  CTSG2  CFD2  ELANE2  CMA12  AZU12  
    GZMM2  GZMA2  GZMB2  
    Selected SIMAP similar genes for PRTN3 using alignment to 3 protein entries:     PRTN3_HUMAN (see all proteins) (see all similar genes):
    ELANE    ELA2    AZU1    PRSS1    CTSG    CMA1
    PRSS2    TRY8    PRSS3    CTRL    GZMK    LPA
    KLK4    DF    KLK6    APS    CFD    CELA3A

    PRTN3 for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for PRTN3 (see all 334)    About this table    
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 19 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs1492124241,2
    --839030(+) ATGGGC/TTTCGA 1 -- us2k10--------
    rs1432557671,2
    --839070(+) CGCCCA/GGGACT 1 -- us2k10--------
    rs739198631,2
    C,F--839097(+) GAGGCC/AACCCA 1 -- us2k13Minor allele frequency- A:0.07WA CSA 122
    rs1482964801,2
    C--839147(+) CAGCTC/GTCCTC 1 -- us2k10--------
    rs120521081,2
    C,F,A,H--839158(+) AATGGC/TCCCAA 1 -- us2k122Minor allele frequency- T:0.18NS EA NA WA CSA 2347
    rs1405230041,2
    --839189(+) GACTGA/CGCCCG 1 -- us2k10--------
    rs793612211,2
    F--839193(+) GCGCCC/GGCTGG 1 -- us2k10--------
    rs1380321111,2
    --839269(+) ATACTC/TAGGGG 1 -- us2k10--------
    rs104108261,2
    C,F--839272(+) CTCAGG/TGGGCT 1 -- us2k14Minor allele frequency- T:0.23NA WA CSA 124
    rs621322941,2
    C,F--839298(+) ATTTGG/CAATCA 1 -- us2k13Minor allele frequency- C:0.18NA EA 242
    rs104054461,2
    C,F--839302(+) GGAATC/AAACTT 1 -- us2k15Minor allele frequency- A:0.20NA WA CSA 126
    rs734925251,2
    C,F--839440(+) GTAAGC/TGTGAA 1 -- us2k13Minor allele frequency- T:0.12WA 122
    rs37296421,2
    C,F--839562(-) GAGGAC/TAAAAT 1 -- us2k13Minor allele frequency- T:0.33NA CSA 6
    rs713353161,2
    C--839562(+) TTTTATCCT    
       CTG
    /-
    TCCTC
    1 -- us2k11Minor allele frequency- -:0.50NA 2
    rs1840395351,2
    --839575(+) TCCTCG/TGCTTT 1 -- us2k10--------
    rs1884345061,2
    --839592(+) TTTCCC/GGCACT 1 -- us2k10--------
    rs37869911,2
    C,F--839642(-) AGTGCT/CCAGGA 1 -- us2k18Minor allele frequency- C:0.45WA NA CSA EA 368
    rs757972711,2
    C,F--839701(+) CTCCAG/CGCCTC 1 -- us2k13Minor allele frequency- C:0.11WA NA EA 358
    rs734925271,2
    C--839763(+) ACCCCA/GAGAGA 1 -- us2k14Minor allele frequency- G:0.14WA NA EA 360
    rs1425266461,2
    --839781(+) TCCCAC/TGATCC 1 -- us2k10--------
    rs38269471,2
    C,F--839876(-) GGGGAC/TCCCAG 1 -- us2k16Minor allele frequency- T:0.12NA CSA WA EA 364
    rs40199621,2
    C,F,A,H--839897(+) CCGTAC/TGCCCC 1 -- us2k19Minor allele frequency- T:0.44NA WA CSA EA 369
    rs116691121,2
    C,F,H--839921(+) TCTGGT/CGTCCG 1 -- us2k13Minor allele frequency- C:0.09WA NA EA 358
    rs1391950971,2
    C--839947(+) GACTG-/CA    
       TTTTT
    GATTT
    1 -- us2k10--------
    rs72518041,2
    C,F,A,H--839948(+) GACTGC/GATTTT 1 -- us2k15Minor allele frequency- G:0.33NA WA CSA 9
    rs2012698591,2
    --839963(+) TTTTA-/TTTTTT 1 -- us2k10--------
    rs1844778051,2
    --839967(+) TATTTG/TTATTT 1 -- us2k10--------
    rs3511091,2
    C,A,H--840090(+) CCTCCT/CGAGTA 1 -- us2k12Minor allele frequency- C:0.25NA WA 4
    rs72503041,2
    C,A,H--840127(+) CGCGCA/GGCTAA 1 -- us2k10--------
    rs1444653691,2
    C--840137(+) ATTTTC/TGTATT 1 -- us2k10--------
    rs347723191,2
    C--840266(+) TTTTT-/TCCCCA 1 -- us2k10--------
    rs1419037811,2
    C--840303(+) CCCCT-/GGGGCC 1 -- us2k10--------
    rs778249851,2
    C,F--840316(+) GTGGAC/TATCGG 1 -- us2k13Minor allele frequency- T:0.06WA CSA 122
    rs48079291,2
    C,F--840319(+) GACATC/TGGGGC 1 -- us2k11Minor allele frequency- T:0.18EA 120
    rs3681946941,2
    C--840342(+) GGGGC-/CCTGTGGACATCG/CCTGTGGAC
    ATCGGGGCTGGATCCTTCTCTGGGGC
    AGGCC
    1 -- us2k10--------
    rs1496838611,2
    --840343(+) GGGGC-/AGG   
       CCCGT
    CCTGG
    1 -- us2k10--------
    rs621322951,2
    C--840448(+) ACCTCG/ACCCAG 1 -- us2k13Minor allele frequency- A:0.18NA EA 242
    rs48079301,2
    C,F,A,H--840477(+) TCACCC/TCTTGA 1 -- us2k123Minor allele frequency- T:0.21NS EA NA WA CSA 2346
    rs1899785321,2
    --840505(+) AAAGGC/GGGAAG 1 -- us2k10--------
    rs1142936341,2
    C,F--840575(+) GGGCAC/TTCGTG 1 -- us2k11Minor allele frequency- T:0.04WA 118
    rs116663731,2
    C,F,A,H--840599(+) TTCCCG/CAGCTC 1 -- us2k17Minor allele frequency- C:0.44WA NA CSA EA 365
    rs1825034901,2
    --840661(+) ACCCAC/TGGGAC 1 -- us2k10--------
    rs1451361211,2
    --840676(+) CTGCCA/GCGGCC 1 -- us2k10--------
    rs120521211,2
    C,F--840689(+) CTTTGC/TTGGGG 1 -- us2k12Minor allele frequency- T:0.09WA EA 238
    rs1871390361,2
    --840696(+) GGGGCC/TACAGG 1 -- us2k10--------
    rs1895260121,2
    --840700(+) CCACAG/TGGACC 1 -- us2k10--------
    rs774639351,2
    C,F--840708(+) ACCTCG/TTCAGG 1 -- us2k11Minor allele frequency- T:0.08WA 118
    rs1807701321,2
    --840746(+) GGCATA/GTGTTG 1 -- us2k10--------
    rs22403051,2
    C,F,H--840776(+) GTTGCC/TCACCT 1 -- us2k18Minor allele frequency- T:0.08EA NS WA NA 2270
    rs20746381,2
    C,F,A,H--840839(+) AAGGTC/TGGGAC 1 -- us2k111Minor allele frequency- T:0.39NA WA CSA EA 375
    rs1471569781,2
    C--840953(+) AACGGA/CCTCTG 1 -- us2k10--------
    rs20746391,2
    C,F,H--840984(+) CTTGAC/TCGTGG 1 -- us2k124Minor allele frequency- T:0.21EA NS NA CSA WA EU 4349
    rs1401042421,2
    C,F--841019(+) TCACCG/AGCCCC 2 /Q /R mis11Minor allele frequency- A:0.00NA 4252
    rs2019703201,2
    --841022(+) CCGGCC/TCCCCA 2 P L mis10--------
    rs2005955641,2
    C--841045(+) CGTCCA/GTGCTG 2 M V mis10--------
    rs2020275271,2
    C--841068(+) CTGAGC/TGGTGA 2 S syn10--------
    rs2014721351,2
    C--841082(+) AGCCAC/TGTGCC 1 -- int11Minor allele frequency- T:0.00EU 681
    rs2004892781,2
    --841095(+) TCCATC/TCAGCC 1 -- int10--------
    rs621322961,2
    C--841100(+) CCAGCC/TTCCAG 1 -- int15Minor allele frequency- T:0.14NA CSA WA EA 362
    rs1995409111,2
    --841111(+) GCCCCA/GGTGGA 1 -- int10--------
    rs1175265421,2
    F--841211(+) CTGCTC/TGGGAC 1 -- int11Minor allele frequency- T:0.01NA 120
    rs1857237811,2
    C--841305(+) ACCCAG/TCCCTT 1 -- int10--------
    rs20669831,2
    C,F,A,H--841398(+) AATATG/ACATGA 1 -- int122Minor allele frequency- A:0.43NS EA NA WA CSA 2346
    rs1900944871,2
    --841447(+) GAGTGA/TACAAA 1 -- int10--------
    rs1455821521,2
    --841449(+) GTGAAC/TAAATG 1 -- int10--------
    rs1510848911,2
    --841450(+) TGAACA/GAATGA 1 -- int10--------
    rs1400298721,2
    --841454(+) CAAATC/GAATGA 1 -- int10--------
    rs802101151,2
    C--841456(+) AATGAA/GTGAGT 1 -- int12Minor allele frequency- G:0.10WA 120
    rs1116029401,2
    C,F--841506(+) TGAATT/GAGTGA 1 -- int11Minor allele frequency- G:0.00CSA 1
    rs43109921,2
    C,F--841514(+) TGAACG/AAATGA 1 -- int12Minor allele frequency- A:0.50WA NA 4
    rs1482448421,2
    --841590(+) TGAATG/TAGTGA 1 -- int10--------
    rs1826297251,2
    --841597(+) GTGAAC/TGAATG 1 -- int10--------
    rs679078071,2
    C,F--841618(+) TGAATG/CAATGA 1 -- int16Minor allele frequency- C:0.43WA NA CSA EA 364
    rs1871522771,2
    --841642(+) AGGGTC/TGAGGA 1 -- int10--------
    rs129794661,2
    C,F,A--841761(+) ctcgcC/Tctgtc 1 -- int12Minor allele frequency- T:0.50WA NA 4
    rs129858571,2
    C,F,A--841767(+) ctgtcG/Acccag 1 -- int11Minor allele frequency- A:0.50NA 2
    rs129794771,2
    C,F,A--841774(+) ccaggC/Ttggag 1 -- int12Minor allele frequency- T:0.50WA NA 4
    rs129858701,2
    C,F--841781(+) ggagtG/Acagtg 1 -- int12Minor allele frequency- A:0.50WA NA 4
    rs129764291,2
    A--841813(+) agctcA/Cgcctc 1 -- int10--------
    rs129840381,2
    C,F--841832(+) acgccT/Attctc 1 -- int1 trp32Minor allele frequency- A:0.50WA NA 4
    rs129764531,2
    C,F--841854(+) tcccgC/Agtagc 1 -- int12Minor allele frequency- A:0.50WA NA 4
    rs1886347011,2
    --841867(+) GGACTA/CCAGGC 1 -- int10--------
    rs129764671,2
    C,F,A--841877(+) cgcccG/Accacc 1 -- int12Minor allele frequency- A:0.50WA NA 4
    rs1404333121,2
    C--841891(+) CCTGGA/CTAATT 1 -- int10--------
    rs621322971,2
    C--841917(+) AGAGAC/GGGGGT 1 -- int13Minor allele frequency- G:0.19NA CSA 124
    rs21076351,2
    C,F,A--841927(+) TTTCAC/AGGTGT 1 -- int14Minor allele frequency- A:0.50NA WA CSA 8
    rs1927573541,2
    --841949(+) GTCTCA/GATCTC 1 -- int10--------
    rs1820524631,2
    --841963(+) ACTTCA/GTGATC 1 -- int10--------
    rs354702301,2
    C--842025(+) CCTGG-/CCCTTT 1 -- int10--------
    rs2015089431,2
    --842027(+) TGGCC-/CTTTTTT 1 -- int10--------
    rs1870457081,2
    --842068(+) TCGCCA/CAGGCT 1 -- int10--------
    rs1443623041,2
    C--842161(+) GCTGGG/TATTAC 1 -- int10--------
    rs1918709081,2
    C--842254(+) CTCCTG/TACCTG 1 -- int10--------
    rs1168968571,2
    F--842281(+) CCTCAG/CTTTGT 1 -- int11Minor allele frequency- C:0.03NA 120
    rs1123503461,2
    C--842319(+) GCTGA-/T/TTT 
            
    TTTTT
    1 -- int11CSA 2
    rs72479921,2
    C,A--842482(+) tggtgC/Tgatct 1 -- int11Minor allele frequency- T:0.50NA 2
    rs1839029281,2
    --842498(+) CACTGC/TAACCT 1 -- int10--------
    rs1138952191,2
    C--842920(+) TTTTTT/AAATTT 1 -- int11Minor allele frequency- A:0.50CSA 2
    rs1513168521,2
    C--843134(+) TGGTCC/TTGAAC 1 -- int10--------
    rs1395399431,2
    --843139(+) TTGAAC/TTCCTG 1 -- int10--------
    rs104217861,2
    C,F--843204(+) agccaG/Ctgcac 1 -- int11Minor allele frequency- C:0.50WA 2
    rs675205781,2
    C,F--843221(+) ACCTGG/TTCTGC 1 -- int17Minor allele frequency- T:0.45WA NA CSA EA 365
    rs72576991,2
    C,A--843454(+) CCCCCC/ACTGCA 1 -- int1 trp32Minor allele frequency- A:0.36WA 120
    rs1453581141,2
    C,F--843597(+) TTCGTG/TCTGAC 2 V syn11Minor allele frequency- T:0.00NA 2484
    rs23018781,2
    C,F--843687(+) TGGCCC/GGGCCA 1 -- int12Minor allele frequency- G:0.19CSA EA 121
    rs23018791,2
    C,F--843692(+) CGGCCA/GCTGTC 1 -- int12Minor allele frequency- G:0.13NA EA 240
    rs126111851,2
    H--843720(+) CCCAGC/TTAAGC 1 -- int10--------
    rs1169853401,2
    C,F--843822(+) GCGGCC/TTCGGG 1 -- int12Minor allele frequency- T:0.12NA EA 240
    rs1465426421,2
    C--843872(+) GAGGAA/GTGACC 1 -- int10--------
    rs3760695501,2
    C--843876(+) AGTGAC/TCACCC 1 -- int10--------
    rs3511111,2,,4
    C,F,O,H--844020(+) ACGACG/ATTCTC 2 /I /V mis121Minor allele frequency- A:0.46MN NS EA NA CSA WA EU 7091
    rs734925371,2
    C,F--844042(+) GGGCGG/AGCAGG 1 -- int15Minor allele frequency- A:0.23CSA WA NA EA EU 724
    rs3511121,2
    C,F--844077(+) GCCAGC/AGGGCT 1 -- int18Minor allele frequency- A:0.28MN NA WA CSA EA 550
    rs756055791,2
    C,F--844098(+) CATTCC/TTGCAG 1 -- int11Minor allele frequency- T:0.09WA 118
    rs1502190731,2
    --844147(+) ACCGAC/GGCCGC 1 -- int10--------
    rs1455680481,2
    --844167(+) GGTCCA/GGTGGC 1 -- int10--------
    rs1928375511,2
    --844175(+) GGCACG/TGGCCG 1 -- int10--------
    rs1488664271,2
    --844190(+) AGACCA/GCTCCT 1 -- int10--------
    rs1857810141,2
    --844315(+) TCCCCC/TGCCCG 1 -- int10--------
    rs1902078181,2
    --844370(+) CTGCAC/TGCCTC 1 -- int10--------
    rs1436136281,2
    C--844726(+) CTCCCC/TAGGGC 1 -- int10--------
    rs756285821,2
    F--844754(+) GTTGTT/CCGTTA 1 -- int11Minor allele frequency- C:0.09WA 118
    rs1809189581,2
    C--844801(+) AGGTGA/GTGCTC 1 -- int10--------
    rs621322981,2
    C--844822(+) TGGGGC/TTGGGC 1 -- int112Minor allele frequency- T:0.00NA WA CSA EA 374
    rs1999708431,2
    C--844976(+) AGAGT-/CTCA  
            
    CTCAG
    1 -- int10--------
    rs1382205041,2
    C--845043(+) TCCAGA/GTTCAA 1 -- int10--------
    rs734925391,2
    C,F--845278(+) CCGGGC/TATGGT 1 -- int12Minor allele frequency- T:0.32WA 120
    rs1437119931,2
    --845291(+) CACACA/GCCAAG 1 -- int10--------
    rs1458071541,2
    C--845380(+) CTCCAC/GCCTCG 1 -- int10--------
    rs1854606871,2
    --845385(+) GCCTCA/GGCGAC 1 -- int10--------
    rs65109821,2
    C,F,H--845535(+) tatggG/Caaacc 1 -- int111Minor allele frequency- C:0.20NA WA CSA EA 372
    rs354295971,2
    C--845715(+) ATCTC-/AAAAAA 1 -- int12Minor allele frequency- A:0.25NA CSA 4
    rs1882646761,2
    C--845765(+) ATGGCC/TGGGCA 1 -- int10--------
    rs1386568651,2
    --845767(+) GGCCGC/GGCACT 1 -- int10--------
    rs1813594661,2
    --845771(+) GGGCAC/TTATGG 1 -- int10--------
    rs1862807201,2
    --845878(+) TGGCTC/GCGGGA 1 -- int10--------
    rs1427531781,2
    --845905(+) GATCAC/TGCCAC 1 -- int10--------
    rs1507340971,2
    --845965(+) AGAAGA/GAAAGA 1 -- int10--------
    rs780093681,2
    C,F--845987(+) TACAAC/TAGTGA 1 -- int12Minor allele frequency- T:0.50WA CSA 4
    rs1178336581,2
    C,F--846018(+) GTGGGG/TCCCAG 1 -- int11Minor allele frequency- T:0.04EA 120
    rs1919337421,2
    --846026(+) CAGGCA/GGAGGG 1 -- int10--------
    rs6296311,2
    C,F,H--846041(+) GCATCC/TGCGGC 1 -- int18Minor allele frequency- T:0.36NS EA CSA WA NA 780
    rs1133225131,2
    C--846102(+) CCACCA/GTGACC 1 -- int11Minor allele frequency- G:0.00CSA 1
    rs2005798311,2
    C--846145(+) GCCCCA/CGCTGA 1 -- spa10--------
    rs1447751051,2
    C--846150(+) AGCTGA/GGCAGC 2 S G mis10--------
    rs1132841221,2
    C--846169(+) CCTCAA/GTGCCT 2 N S mis10--------
    rs1502787231,2
    F--846222(+) CCCACG/AGCACC 2 /S /G mis11Minor allele frequency- A:0.00NA 2554
    rs1457946621,2
    C--846252(+) GGGGCC/TGCGTG 2 R C mis11Minor allele frequency- T:0.00NA 2802
    rs1452992791,2
    F--846254(+) GGCCGC/TGTGGG 2 R syn11Minor allele frequency- T:0.00NA 2844
    rs1397780461,2
    C,F--846331(+) GCCACA/TTAACA 2 H L mis11Minor allele frequency- T:0.00NA 3990
    rs1430241781,2
    C,F--846347(+) ACTTTC/TGTCCC 2 F syn11Minor allele frequency- T:0.00NA 3566
    rs2001982051,2
    --846366(+) AGGCCC/GGCATC 2 R G mis10--------
    rs1874048601,2
    C--846517(+) CCCAAC/TACCCA 1 -- int10--------
    rs773762071,2
    C,F--846533(+) CAGGCT/CCAGCG 1 -- int14Minor allele frequency- C:0.22CSA WA 122
    rs600246231,2
    C,F--846538(+) TCAGCG/AGGGTG 1 -- int12Minor allele frequency- A:0.50WA CSA 4
    rs1500667601,2
    C--846542(+) GGGGT-/GGGGGG 1 -- int10--------
    rs6318221,2
    C,F,A,H--846548(+) GGGGGT/CGCTCA 1 -- int18Minor allele frequency- C:0.35WA NA CSA EA 368
    rs48079311,2
    C,F,A,H--846716(+) TCCTAC/TGAAAG 1 -- int118Minor allele frequency- T:0.30NS EA NA WA 2342
    rs1491791291,2
    C--846747(+) CACTT-/TTTG  
            
    TTTGT
    1 -- int10--------
    rs676724431,2
    C--846748(+) ACTTT-/TTTG  
            
    TTGTT
    1 -- int10--------
    rs598558741,2
    C--846750(+) TGTTT-/GTTT  
            
    TTGAG
    1 -- int10--------
    rs1141274421,2
    C,F--846766(+) GAGACG/AGAGTG 1 -- int11Minor allele frequency- A:0.05WA 118
    rs1832268131,2
    C--846768(+) GACGGA/TGTGTC 1 -- int10--------
    rs562498221,2
    C,F--846774(+) GTGTCA/GCTCTG 1 -- int11Minor allele frequency- G:0.00CSA 1
    rs1867538591,2
    --846779(+) GCTCTA/GTTGTC 1 -- int10--------
    rs1912231391,2
    --846794(+) CTGGAA/GTGCAG 1 -- int10--------
    rs6939901,2
    C,H--846829(-) GGAGGC/TGGAGG 1 -- int16Minor allele frequency- T:0.00NA WA CSA 10
    rs1878766871,2
    --846894(+) CCTGCC/TACCGT 1 -- int10--------
    rs1460770131,2
    --846975(+) TCCTGG/TCATCA 1 -- int10--------
    rs1400017571,2
    --847060(+) CAGCAC/TTTTGG 1 -- int10--------
    rs1931596851,2
    --847076(+) CAAAGC/TGGAAG 1 -- int10--------
    rs1850208961,2
    --847151(+) TAATTC/TAAATA 1 -- int10--------
    rs1886351041,2
    --847201(+) CTCAGC/GAGGCT 1 -- int10--------
    rs772004231,2
    C--847337(+) GAGGCC/TGAGGC 1 -- int10--------
    rs1926760991,2
    --847338(+) AGGCCA/GAGGCA 1 -- int10--------
    rs118816981,2
    C,F,A,H--847352(+) GAATCG/ACTTGA 1 -- int15Minor allele frequency- A:0.25NA WA CSA 8
    rs1848147801,2
    C--847385(+) TGAGCC/TGAGAT 1 -- int10--------
    rs1512657741,2
    --847429(+) GAGACG/TCTGTC 1 -- int10--------
    rs2019848701,2
    --847525(+) AAGAG-/AGAA  
            
    AGAAA
    1 -- int10--------
    rs2019760381,2
    C--847551(+) AGAAAA/GAGAAA 1 -- int10--------
    rs2005871171,2
    C--847553(+) AAAAAA/GAAAGA 1 -- int10--------
    rs1456296571,2
    C--847556(+) AAGAA-/AGAGAGA 1 -- int10--------
    rs559217061,2
    C--847557(+) AAAGAAA/-GAGAG 1 -- int11Minor allele frequency- -:0.50CSA 2
    rs129760411,2
    C,F,A--847559(+) AAAGAG/AAGAGA 1 -- int1 trp32Minor allele frequency- A:0.50NA 4
    rs1884118381,2
    --847612(+) GGAAGC/TATTTT 1 -- int10--------
    rs713352731,2
    C,F--847674(+) AGCCCG/AGGTGA 1 -- int17Minor allele frequency- A:0.36NA CSA WA EA 367
    rs1404859691,2
    --847735(+) TGGCCA/GTCCCC 1 -- int10--------
    rs1807237061,2
    C--847767(+) GGCCCC/G/TTGATG 1 -- int10--------
    rs1113372391,2
    C--847798(+) CTCCAC/GGGAGA 1 -- spa11Minor allele frequency- G:0.00CSA 1
    rs1508026781,2
    C,F--847944(+) GCGCCG/ATGTGG 2 /H /R mis12Minor allele frequency- A:0.01NA EU 4053
    rs1418505961,2
    --847959(+) AAGGG-/CCCGCC 2 R P fra10--------
    rs129859701,2
    C,F--847993(+) CTGGCC/TGGGAC 1 -- ut31 ese33Minor allele frequency- T:0.33NA 6
    rs2020827251,2
    --848002(+) ACCCCA/GAGCCT 1 -- ut310--------
    rs1132080301,2
    C,F--848072(+) CGTCCG/AGGACG 1 -- ut312Minor allele frequency- A:0.05CSA WA 119
    rs1143243881,2
    C,F--848084(+) CCCCAC/TCCGTC 1 -- ut311Minor allele frequency- T:0.07WA 118
    rs1893817131,2
    --848172(+) TGAAAC/GTCCCC 1 -- ut310--------
    rs1499396481,2
    --848201(+) TCCCAG/TATAGG 1 -- ds50010--------
    rs1171748091,2
    C,F--848285(+) ATATAG/AGGAGG 1 -- ds50011Minor allele frequency- A:0.03NA 120
    rs1476117921,2
    --848303(+) GGAGAA/GGTCCC 1 -- ds50010--------
    rs1820080231,2
    --848329(+) CGAGCC/TCCAAA 1 -- ds50010--------
    rs1163984931,2
    C,F--848345(+) GATGGC/G/TGGGAG 1 -- ds50011WA 118
    rs1869399511,2
    --848352(+) GGAGTC/TGGAGC 1 -- ds50010--------
    rs73511101,2
    C--848467(+) ctccgC/Tgcctc 1 -- ds50010--------
    rs1423123131,2
    --848654(+) GCCAGG/TCAGGG 1 -- ds50010--------
    rs3777111361,2
    ----847690(+) TGTCCC/TATCCT 1 -- int10--------
    rs10422821,2,,4
    ----846183(+) TCGCCA/TCAGTC 2 T S mis1 ese31Minor allele frequency- T:0.00NA 2
    rs3743787961,2
    ----848179(+) TCCCC-/TGGCTC 1 -- ds50010--------
    rs48071171,2
    ----841548(+) agtgaA/Gtgaat 1 -- int10--------
    rs129860701,2
    ----841814(+) gctcaA/Gcctcc 1 -- int10--------
    rs1482005391,2
    ----846355(+) CCCTCG/ACCGCA 2 /H /R mis11Minor allele frequency- A:0.00NA 3206
    rs3707657351,2
    ----847561(+) AGAGAA/GAGAGA 1 -- int10--------
    rs2002282731,2
    ----847563(+) AGAGAA/GAGAGA 1 -- int10--------
    rs3732256451,2
    ----847278(+) CTCCAC/GCTGGA 1 -- int10--------
    rs3758698321,2
    ----840961(+) CTGGCA/TTTGGG 1 -- us2k10--------
    rs3695269311,2
    ----844210(+) GGCCAC/GTCCTC 1 -- int10--------
    rs3677872001,2
    ----846298(+) GCTCAA/GTGTCA 2 N S mis10--------
    rs3768051651,2
    ----842336(+) TTTTT-/GCTTC 
            
    TTTTT
    1 -- int10--------
    rs1134402231,2
    ----839783(+) CCATGG/ATCCTC 1 -- us2k11Minor allele frequency- A:0.00CSA 1
    rs40199611,2
    ----839574(+) TCCTC-/CTGTCC
    T
    /TGTCCTC
    GGCTT
    1 -- us2k10--------
    rs3714052411,2
    ----847973(+) GAACCA/GCCCCT 1 -- ut310--------
    rs3678443651,2
    ----848021(+) ACCCTC/TAGGCG 1 -- ut310--------
    rs3752496721,2
    ----847789(+) GTCCCC/TGTCCT 1 -- int10--------
    rs3760643251,2
    ----847983(+) TCCCAC/TAGCGC 1 -- ut310--------
    rs1122693121,2
    ----846365(+) AAGGCC/TGGCAT 2 A syn11Minor allele frequency- T:0.50CSA 2
    rs3678549951,2
    ----843609(+) GCCGCG/TCACTG 2 A syn10--------
    rs3730068661,2
    ----844041(+) TGGGCA/GGGCAG 1 -- int10--------
    rs3752471001,2
    ----847784(+) TGGCCA/GTCCCT 1 -- int10--------
    rs3716696141,2
    ----842144(+) CCTCCA/GCTCTT 1 -- int10--------
    rs120521511,2
    ----839190(+) ACTGCC/GCCCGC 1 -- us2k10--------
    rs3761645781,2
    ----847936(+) TCCACA/GCTGCG 2 T syn10--------
    rs58267091,2
    ----839570(+) TCTGT-/CC    
       TCTGT
    CCTCG
    1 -- us2k10--------
    rs3679188491,2
    ----839560(+) TAATTC/TTATCC 1 -- us2k10--------
    rs3734983021,2
    ----844554(+) TGTGCC/TGTTCC 1 -- int10--------
    rs3720921751,2
    ----841083(+) GCCACA/GTGCCC 1 -- int10--------
    rs3744419581,2
    ----847754(+) GGGAGA/GCTCAG 1 -- int10--------
    rs3757943201,2
    ----847182(+) GAGCCC/TTAGGC 1 -- int10--------
    rs718224651,2
    ----839571(+) CTGTC-/CC    
       TCTGT
    CTCGG
    1 -- us2k10--------
    rs1118165481,2
    ----847583(+) AGAGAG/AAGAAA 1 -- int11Minor allele frequency- A:0.50CSA 2
    rs347481381,2
    ----841738(+) TTTTT-/TTTTTT 1 -- int10--------
    rs3750714201,2
    ----847548(+) GAAAG-/AAAAAGA 1 -- int10--------
    rs1117662211,2
    ----841578(+) TGAGTC/GAATGA 1 -- int10--------
    rs3713846661,2
    ----847918(+) TACGTC/GACTGG 2 V syn10--------
    rs3511101,2
    ----840713(+) GTCAGG/CGAGGC 1 -- us2k15Minor allele frequency- C:0.00EA NA 58
    rs3768697971,2
    ----843490(+) TGGGCA/GGGCAC 2 R G mis10--------
    rs3746974621,2
    ----840176(+) GGCCAC/GGCTGG 1 -- us2k10--------

    HapMap Linkage Disequilibrium report for PRTN3 (840963 - 848175 bp)

    Structural Variations
         Database of Genomic Variants (DGV) Selected variations for PRTN3 (see all 21):    About this table    
    Variant IDTypeSubtypePubMed ID
    esv2717797CNV Deletion23290073
    esv2717798CNV Deletion23290073
    nsv470101CNV Loss18288195
    dgv3550n71CNV Loss21882294
    nsv910292CNV Loss21882294
    nsv138320CNV Loss16902084
    dgv3558n71CNV Loss21882294
    dgv3555n71CNV Loss21882294
    dgv3552n71CNV Loss21882294
    dgv3554n71CNV Loss21882294

    Site Specific Mutation Identification with PCR Assays
    SeqTarget long-range PCR primers for resequencing PRTN3
    DNA2.0 Custom Variant and Variant Library Synthesis for PRTN3

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TryGeneCards Plus
    OMIM gene information: 177020    OMIM disorders: --

    Selected diseases for PRTN3 (see all 92):    
    About MalaCards
    subacute bacterial endocarditis    wegener's granulomatosis    mononeuritis multiplex    mononeuritis
    mononeuropathy    granulomatosis with polyangiitis    rapidly progressive glomerulonephritis    endocarditis
    scleritis    alpha 1-antitrypsin deficiency    vasculitis    relapsing polychondritis
    crescentic glomerulonephritis    mixed connective tissue disease    polyarteritis nodosa    churg-strauss syndrome
    microscopic polyangiitis    cholangitis    pyoderma gangrenosum    glomerulonephritis

    12 diseases from the University of Copenhagen DISEASES database for PRTN3:
    Vasculitis     Hypersensitivity reaction type II disease     Glomerulonephritis     Rheumatoid arthritis
    Polyarteritis nodosa     Scleritis     Sinusitis     Connective tissue disease
    Endocarditis     Ulcerative colitis     Lung disease     Mononeuropathy

    PRTN3 for disorders           About GeneDecksing

    Selected Novoseek inferred disease relationships for PRTN3 gene (see all 81)    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    wegeners granulomatosis 96.5 304 8157982 (3), 15498036 (3), 17005932 (3), 19881350 (3) (see all 99)
    vasculitis 92.8 228 12605707 (4), 16792675 (4), 15958084 (3), 8499060 (2) (see all 99)
    churg-strauss syndrome 85.5 15 12687504 (1), 17521322 (1), 10896971 (1), 8381764 (1) (see all 10)
    glomerulonephritis 81.1 20 10405206 (2), 10844589 (1), 11034396 (1), 11092351 (1) (see all 14)
    glomerulonephritis rapidly progressive 78.9 2 7847352 (1), 9306336 (1)
    vasculitis leukocytoclastic 71.9 8 7626983 (1), 7554378 (1), 11838849 (1), 11208991 (1) (see all 6)
    polyarteritis nodosa 64.4 6 7754755 (2), 7907475 (1)
    pulmonary hemorrhage 57.2 1 1351955 (1)
    inflammation 55.5 43 10101005 (2), 7829874 (1), 10471824 (1), 11272269 (1) (see all 28)
    autoimmune diseases 55.2 8 14736010 (1), 10720938 (1), 16026591 (1), 18953353 (1) (see all 7)

    Genetic Association Database (GAD): PRTN3
    Human Genome Epidemiology (HuGE) Navigator: PRTN3 (7 documents)

    Export disorders for PRTN3 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    TryGeneCards Plus

    PubMed articles for PRTN3 gene, integrated from 10 sources (see all 670):
    (articles sorted by number of sources associating them with PRTN3)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Cloning of cDNA for proteinase 3: a serine protease, antibiotic, and autoantigen from human neutrophils. (PubMed id 2258701)1, 2, 3, 9 Campanelli D....Gabay J.E. (J. Exp. Med. 1990)
    2. Characterization of proteinase-3 (PR-3), a neutrophil serine proteinase. Structural and functional properties. (PubMed id 2033050)1, 2, 9 Rao N.V....Hoidal J.R. (J. Biol. Chem. 1991)
    3. Structure, chromosomal assignment, and expression of the gene for proteinase-3. The Wegener's granulomatosis autoantigen. (PubMed id 1400430)1, 2, 9 Sturrock A.B.... Hoidal J.R. (J. Biol. Chem. 1992)
    4. Increased neutrophil membrane expression and plasma level of proteinase 3 in systemic vasculitis are not a consequence of the - 564 A/G promotor polymorphism. (PubMed id 16792675)1, 4, 9 Abdgawad M....Segelmark M. (Clin. Exp. Immunol. 2006)
    5. Proteinase 3 gene polymorphisms and Wegener's granulomatosis. (PubMed id 11115080)1, 4, 9 Gencik M....Fricke H. (Kidney Int. 2000)
    6. Wegener autoantigen and myeloblastin are encoded by a single mRNA. (PubMed id 1681549)1, 2, 9 Labbaye C.... Cayre Y.E. (Proc. Natl. Acad. Sci. U.S.A. 1991)
    7. Monoclonal antibodies specific for neutrophil proteinase 4. Production and use for isolation of the enzyme. (PubMed id 2121162)1, 2, 9 Ohlsson K.... Rosengren M. (Biol. Chem. Hoppe-Seyler 1990)
    8. The crystal structure of PR3, a neutrophil serine proteinase antigen of Wegener's granulomatosis antibodies. (PubMed id 8757293)1, 2, 9 Fujinaga M.... James M.N.G. (J. Mol. Biol. 1996)
    9. Three human elastase-like genes coordinately expressed in the myelomonocyte lineage are organized as a single genetic locus on 19pter. (PubMed id 1518849)1, 2, 9 Zimmer M....Jenne D.E. (Proc. Natl. Acad. Sci. U.S.A. 1992)
    10. Donor-recipient polymorphism of the proteinase 3 gene: a potential target for T-cell alloresponses to myeloid leukemia. (PubMed id 9924693)1, 2, 9 Clave E.... Barrett A.J. (J. Immunother. 1999)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

    TryGeneCards Plus
     ANDOR
    Aliases
    Disorders
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section

    TryGeneCards Plus
    Entrez Gene: 5657 HGNC: 9495 AceView: PRTN3 Ensembl:ENSG00000196415 euGenes: HUgn5657
    ECgene: PRTN3 H-InvDB: PRTN3

    (According to HUGE)
    About This Section

    TryGeneCards Plus
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section

    TryGeneCards Plus
    NameDescription
    PharmGKB entry for PRTN3 Pharmacogenomics, SNPs, Pathways
    Wikipedia http://en.wikipedia.org/wiki/Proteinase_3

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section

    TryGeneCards Plus
    Patent Information for PRTN3 gene:
    Search GeneIP for patents involving PRTN3

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript, and ESI BIO, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

    TryGeneCards Plus

     
     EMD Millipore genomic analysis products

      
     Antibodies for PRTN3 (Proteinase 3/Myeloblastin/PRTN3)   Browse Cell Culture Products  
     ELISAs for PRTN3 (Proteinase 3/Myeloblastin/PRTN3)   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
     Browse cDNA Clones   Proteome Profiler Antibody Arrays for PRTN3 (Proteinase 3/Myeloblastin/PRTN3)  
     OriGene Antibodies for PRTN3   OriGene RNAi products in human, mouse, rat for PRTN3  
     OriGene qPCR primer pairs and template standards for PRTN3   OriGene Protein Over-expression Lysate for PRTN3  
     OriGene MassSpec something-or-other for PRTN3   OriGene clones in human, mouse for PRTN3  
     OriGene qSTAR qPCR primer pairs in human, mouse for PRTN3   OriGene Purified Protein for PRTN3  
     OriGene ORF clones in mouse, rat for PRTN3   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for PRTN3   OriGene Custom Protein Services for PRTN3  

     
     
     Block miRNA regulation of human, mouse, rat PRTN3 using miScript Target Protectors SeqTarget long-range PCR primers for resequencing PRTN3
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat PRTN3 Predesigned siRNA for gene silencing in human, mouse, rat PRTN3
     QuantiFast Probe-based Assays in human, mouse, rat PRTN3 QuantiTect SYBR Green Assays in human, mouse, rat PRTN3
     PCR Arrays including human, mouse, rat PRTN3 Search Chromatin IP Primers for PRTN3
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat PRTN3  GeneGlobe Interaction Network for PRTN3
     Regulatory tfbs in PRTN3 promoter
     GenScript Custom Purified and Recombinant Proteins Services for PRTN3 GenScript cDNA clones with any tag delivered in your preferred vector for PRTN3
     GenScript Custom Assay Services for PRTN3 GenScript Custom overexpressing Cell Line Services for PRTN3
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Search for Antibodies & Assays

     Search Tocris compounds for PRTN3
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     cDNA Clones for PRTN3
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Drugs/Proteins for PRTN3
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     PRTN3 antibodies
     PRTN3 proteins
     PRTN3 lysates
     Antibodies for PRTN3
     See all of Abcam's Antibodies, Kits and Proteins for PRTN3
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Recombinant Protein for PRTN3
     Browse Proteins at Cloud-Clone Corp.
     Browse Antibodies at Cloud-Clone Corp.
     Browse ELISAs at Cloud-Clone Corp.
     Browse CLIAs at Cloud-Clone Corp.



     Browse ESI BIO Cell Lines and PureStem Progenitors for PRTN3
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for PRTN3
     SwitchGear 3'UTR luciferase reporter plasmids for PRTN3
     SwitchGear Promoter luciferase reporter plasmids for PRTN3
     ThermoFisher Antibody for PRTN3
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat PRTN3
     inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for PRTN3
     inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for PRTN3
     LSBio Antibodies in human, mouse, rat for PRTN3
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
     Browse compounds at ApexBio
           
    GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014

    View Random Gene

    Category
    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      PRTN3 gene at Home site.
    Version: 3.12.166 28 Aug 2014
    hostname: 356980-web2.xennexinc.com index build: 126 solr: 1.4