Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

PRMT2 Gene

protein-coding   GIFtS: 59
GCID: GC21P048055

Protein Arginine Methyltransferase 2

(Previous names: HMT1 (hnRNP methyltransferase, S. cerevisiae)-like 1, HMT1...)
(Previous symbol: HRMT1L1)
  See related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

Aliases
Protein Arginine Methyltransferase 21 2     PRMT2 Beta2
HRMT1L11 2 3 5     PRMT2 Gamma2
HMT1 (HnRNP Methyltransferase, S. Cerevisiae)-Like 11 2     Protein Arginine N-Methyltransferase 22
Histone-Arginine N-Methyltransferase PRMT22 3     EC 2.1.1.-3
HMT1 HnRNP Methyltransferase-Like 1 (S. Cerevisiae)1     EC 2.1.1.1253
HMT1 HnRNP Methyltransferase-Like 12     HMT13
PRMT2 Alpha2     

External Ids:    HGNC: 51861   Entrez Gene: 32752   Ensembl: ENSG000001603107   OMIM: 6019615   UniProtKB: P553453   

Export aliases for PRMT2 gene to outside databases

Previous GC identifers: GC21P046880 GC21P033435


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

GeneCards Summary for PRMT2 Gene: 
PRMT2 (protein arginine methyltransferase 2) is a protein-coding gene. Diseases associated with PRMT2 include spina bifida, and kaposi's sarcoma, and among its related super-pathways are Processing of Capped Intron-Containing Pre-mRNA. GO annotations related to this gene include transcription coactivator activity and protein homodimerization activity. An important paralog of this gene is PRMT6.

UniProtKB/Swiss-Prot: ANM2_HUMAN, P55345
Function: Arginine methyltransferase that methylates the guanidino nitrogens of arginyl residues in proteins such
as STAT3, FBL, histone H4. Acts as a coactivator (with NCOA2) of the androgen receptor (AR)-mediated
transactivation. Acts as a coactivator (with estrogen) of estrogen receptor (ER)-mediated transactivation.
Enhances PGR, PPARG, RARA-mediated transactivation. May inhibit NF-kappa-B transcription and promote apoptosis.
Represses E2F1 transcriptional activity (in a RB1-dependent manner). May be involved in growth regulation

Gene Wiki entry for PRMT2 Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 73), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000021.8  NT_011515.12  NC_018932.2  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the PRMT2 gene promoter:
         STAT1   AP-1   AP-2alpha isoform 3   ATF-2   AP-2alpha isoform 2   AP-2alpha isoform 4   c-Jun   NF-kappaB1   AP-2alpha   AP-2alphaA   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidPRMT2 promoter sequence
   Search SABiosciences Chromatin IP Primers for PRMT2

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat PRMT2


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 21q22.3   Ensembl cytogenetic band:  21q22.3   HGNC cytogenetic band: 21q22.3

PRMT2 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
PRMT2 gene location

GeneLoc information about chromosome 21         GeneLoc Exon Structure

GeneLoc location for GC21P048055:  view genomic region     (about GC identifiers)

Start:
48,055,079 bp from pter      End:
48,085,155 bp from pter
Size:
30,077 bases      Orientation:
plus strand

(According to UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MAXQB RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Ontologies according to Gene Ontology Consortium 01 Oct 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

UniProtKB/Swiss-Prot: ANM2_HUMAN, P55345 (See protein sequence)
Recommended Name: Protein arginine N-methyltransferase 2  
Size: 433 amino acids; 49042 Da
Subunit: Self-associates. Interacts with RB1 and E2F1 (By similarity). Interacts with NCOA6 coactivator. Interacts
(via SH3 domain) with PRMT8. Interacts with AR. Interacts with NFKBIA. Interacts with ESR1, ESR2, PGR, PPARG,
RARA, RXRA and THRB. Interacts with HNRNPUL1
Subcellular location: Cytoplasm. Nucleus. Note=Translocates from the cytoplasm to the nucleus, after hormone
exposure
1 PDB 3D structure from and Proteopedia for PRMT2:
1X2P (3D)    
Secondary accessions: P78350 Q498Y5 Q6FHF0 Q99781 Q9BW15 Q9UMC2
Alternative splicing: 3 isoforms:  P55345-1   P55345-2   P55345-3   (No experimental confirmation available)

Explore the universe of human proteins at neXtProt for PRMT2: NX_P55345

Explore proteomics data for PRMT2 at MOPED 

Post-translational modifications:

  • View modification sites using PhosphoSitePlus
  • View neXtProt modification sites for NX_P55345

  • PRMT2 Protein expression data from MOPED1, PaxDb2 and MAXQB3 :    About this image 

    PRMT2 Protein Expression
    REFSEQ proteins (5 alternative transcripts): 
    NP_001229793.1  NP_001229794.1  NP_001229795.1  NP_001526.2  NP_996845.1  

    ENSEMBL proteins: 
     ENSP00000347906   ENSP00000380760   ENSP00000380759   ENSP00000335490   ENSP00000380752  
     ENSP00000397266   ENSP00000406127   ENSP00000407463   ENSP00000411984   ENSP00000291705  

    Human Recombinant Protein Products for PRMT2: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Proteins for PRMT2
    OriGene Protein Over-expression Lysate for PRMT2
    OriGene MassSpec for PRMT2 
    OriGene Custom Protein Services for PRMT2
    GenScript Custom Purified and Recombinant Proteins Services for PRMT2
    Novus Biologicals PRMT2 Protein
    Novus Biologicals PRMT2 Lysates
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates 
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for PRMT2 

    Gene Ontology (GO): 4 cellular component terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005634nucleus IDA11513728
    GO:0005737cytoplasm IDA11513728
    GO:0005829cytosol IDA17587566
    GO:0035189colocalizes with Rb-E2F complex ISS--

    PRMT2 for ontologies           About GeneDecksing



    PRMT2 Antibody Products: 
    EMD Millipore Mono- and Polyclonal Antibodies for the study of PRMT2
    Browse R&D Systems for Antibodies
    OriGene Antibodies for PRMT2
    OriGene Custom Antibody Services for PRMT2
    GenScript Custom Superior Antibodies Services for PRMT2
    Novus Biologicals PRMT2 Antibodies
    Abcam antibodies for PRMT2
    Cloud-Clone Corp. Antibodies for PRMT2 
    ThermoFisher Antibody for PRMT2
    LSBio Antibodies in human, mouse, rat for PRMT2 

    Assay Products for PRMT2: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for PRMT2
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for PRMT2
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for PRMT2 
    Cloud-Clone Corp. CLIAs for PRMT2


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section
    HGNC Gene Families: 
    PRMT: Protein arginine methyltransferases

    IUPHAR Guide to PHARMACOLOGY protein family classification: PRMT2 
    Protein arginine N-methyltransferases

    3 InterPro protein domains:
     IPR025798 Arg_MeTrfase_PMTR2
     IPR001452 SH3_domain
     IPR025799 Arg_MeTrfase

    Graphical View of Domain Structure for InterPro Entry P55345

    ProtoNet protein and cluster: P55345

    1 Blocks protein domain: IPB001452 SH3 domain signature

    UniProtKB/Swiss-Prot: ANM2_HUMAN, P55345
    Similarity: Belongs to the protein arginine N-methyltransferase family
    Similarity: Contains 1 SH3 domain


    PRMT2 for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, Vector BioLabs, and Sirion Biotech, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene.)
    About This Section

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: ANM2_HUMAN, P55345
    Function: Arginine methyltransferase that methylates the guanidino nitrogens of arginyl residues in proteins such
    as STAT3, FBL, histone H4. Acts as a coactivator (with NCOA2) of the androgen receptor (AR)-mediated
    transactivation. Acts as a coactivator (with estrogen) of estrogen receptor (ER)-mediated transactivation.
    Enhances PGR, PPARG, RARA-mediated transactivation. May inhibit NF-kappa-B transcription and promote apoptosis.
    Represses E2F1 transcriptional activity (in a RB1-dependent manner). May be involved in growth regulation
    Catalytic activity: S-adenosyl-L-methionine + arginine-[histone] = S-adenosyl-L-homocysteine +
    N(omega)-methyl-arginine-[histone]
    Biophysicochemical properties: Kinetic parameters: KM=2.6 uM for AdoMet; KM=3.3 uM for H4; Vmax=1.4 nmol/min/mg
    enzyme toward AdoMet; Vmax=1.5 nmol/min/mg enzyme toward H4;

         Enzyme Numbers (IUBMB): EC 2.1.1.-1 EC 2.1.1.1251

         Gene Ontology (GO): 5/16 molecular function terms (GO ID links to tree view) (see all 16):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0003713transcription coactivator activity IDA12039952
    GO:0004871signal transducer activity TAS9545638
    GO:0005515protein binding IPI11513728
    GO:0008168methyltransferase activity ----
    GO:0008276protein methyltransferase activity ----
         
    PRMT2 for ontologies           About GeneDecksing


    Phenotypes:
         2 GenomeRNAi human phenotypes for PRMT2:
     Increased gamma-H2AX phosphory  Increased viability after born 

         5 MGI mutant phenotypes (inferred from 3 alleles(MGI details for Prmt2):
     cardiovascular system  cellular  homeostasis/metabolism  immune system  no phenotypic analysis 

    PRMT2 for phenotypes           About GeneDecksing

    Animal Models:
         MGI mouse knock-out Prmt2tm1Enbl for PRMT2

       inGenious Targeting Laboratory - Custom generated mouse model solutions for PRMT2 
       inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for PRMT2

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for PRMT2 
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for PRMT2 

    miRNA
    Products:
        
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat PRMT2
    8/13 QIAGEN miScript miRNA Assays for microRNAs that regulate PRMT2 (see all 13):
    hsa-miR-3678-3p hsa-miR-875-3p hsa-miR-24-1* hsa-miR-513a-5p hsa-miR-1285 hsa-miR-7 hsa-miR-24-2* hsa-miR-138-1*
    Browse SwitchGear 3'UTR luciferase reporter plasmids
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for PRMT2
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat PRMT2

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for PRMT2
    Sirion Biotech Customized adenovirus for overexpression of PRMT2

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene clones in human, mouse for PRMT2 (see all 14)
    OriGene ORF clones in mouse, rat for PRMT2
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): PRMT2 (NM_001535)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for PRMT2
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat PRMT2
    Sirion Biotech Customized lentivirus for stable overexpression of PRMT2 
                         Customized lentivirus expression plasmids for stable overexpression of PRMT2 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for PRMT2
    Search LifeMap BioReagents cell lines for PRMT2
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for PRMT2


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene).
    About This Section

    SuperPaths for PRMT2 About                                                                                                See pathways by source

    SuperPathContained pathways About
    1mRNA Splicing - Major Pathway
    mRNA processing0.46


    1 BioSystems Pathway for PRMT2
        mRNA processing


    Interactions:

        SABiosciences Gene Network CentralTM Interacting Genes and Proteins Network for PRMT2

    STRING Interaction Network Preview (showing 5 interactants - click image to see 23)

    5/28 Interacting proteins for PRMT2 (P553451, 2, 3 ENSP000003479064) via UniProtKB, MINT, STRING, and/or I2D (see all 28)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    ENSG00000225748P486342, 3, ENSP000003874774MINT-62625 MINT-62799 MINT-62723 I2D: score=5 STRING: ENSP00000387477
    ENSG00000231825P486342, 3, ENSP000004153634MINT-62625 MINT-62799 MINT-62723 I2D: score=5 STRING: ENSP00000415363
    PRRC2AP486342, 3, ENSP000003651754MINT-62625 MINT-62799 MINT-62723 I2D: score=5 STRING: ENSP00000365175
    ENSG00000206427P486342, 3MINT-62625 MINT-62799 MINT-62723 I2D: score=5 
    ENSG00000225164P486342, 3MINT-62625 MINT-62799 MINT-62723 I2D: score=5 
    About this table

    Gene Ontology (GO): 5/12 biological process terms (GO ID links to tree view) (see all 12):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006479protein methylation TAS9545638
    GO:0007165signal transduction TAS9545638
    GO:0016571histone methylation ISS--
    GO:0032088negative regulation of NF-kappaB transcription factor activity IDA16648481
    GO:0034969histone arginine methylation ISS--

    PRMT2 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section
    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for PRMT2 (ANM2)

    Search CenterWatch for drugs/clinical trials and news about PRMT2 / ANM2

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Sirion Biotech, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for PRMT2 gene (5 alternative transcripts): 
    NM_001242864.1  NM_001242865.1  NM_001242866.1  NM_001535.3  NM_206962.2  

    Unigene Cluster for PRMT2:

    Protein arginine methyltransferase 2
    Hs.154163  [show with all ESTs]
    Unigene Representative Sequence: NM_001242865
    15 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000355680(uc002zjx.3 uc002zjy.3 uc011agb.2) ENST00000397638
    ENST00000397637 ENST00000334494(uc021wkc.1) ENST00000397628 ENST00000440086(uc010gqm.3 uc011aga.2 uc011agc.2)
    ENST00000482508(uc002zjz.1) ENST00000481861(uc002zjw.3) ENST00000455177
    ENST00000491389 ENST00000498151 ENST00000486520 ENST00000458387 ENST00000451211
    ENST00000291705
    miRNA
    Products:
         
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat PRMT2
    8/13 QIAGEN miScript miRNA Assays for microRNAs that regulate PRMT2 (see all 13):
    hsa-miR-3678-3p hsa-miR-875-3p hsa-miR-24-1* hsa-miR-513a-5p hsa-miR-1285 hsa-miR-7 hsa-miR-24-2* hsa-miR-138-1*
    Browse SwitchGear 3'UTR luciferase reporter plasmids
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for PRMT2
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat PRMT2
    Clone
    Products:
         
    OriGene clones in human, mouse for PRMT2 (see all 14)
    OriGene ORF clones in mouse, rat for PRMT2
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): PRMT2 (NM_001535)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for PRMT2
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat PRMT2
    Sirion Biotech Customized lentivirus for stable overexpression of PRMT2 
                         Customized lentivirus expression plasmids for stable overexpression of PRMT2 
    Primer
    Products:
        
    OriGene qPCR primer pairs and template standards for PRMT2
    OriGene qSTAR qPCR primer pairs in human, mouse for PRMT2
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat PRMT2
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat PRMT2
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat PRMT2

    Additional mRNA sequence: 

    AF059319.1 AK055950.1 AK095641.1 AK123650.1 AK124494.1 AK223157.1 AK312573.1 AL109794.1 
    AL833586.1 AY786414.2 BC000727.2 BC038765.1 BC100026.1 CR541804.1 FJ436410.1 FJ436411.1 
    FJ436412.1 U79286.1 U80213.1 X99209.1 

    24/26 DOTS entries (see all 26):

    DT.100821853  DT.448865  DT.100821850  DT.100714254  DT.100821849  DT.116524  DT.101985213  DT.91980706 
    DT.91880534  DT.444221  DT.91953079  DT.95151287  DT.121129834  DT.100821852  DT.91715558  DT.107528 
    DT.121129805  DT.95170216  DT.97860283  DT.121129780  DT.40295406  DT.100692841  DT.100821851  DT.121129796 

    24/674 AceView cDNA sequences (see all 674):

    BM757405 BE464915 AI126899 CB046280 AA279777 AI955688 BQ066079 BI914673 
    BU185873 CA427786 CR601878 AI928367 BM998720 AW028750 AA463266 NM_001535 
    BG546385 AA909503 AI224524 BF592920 BQ021100 BM789366 F10920 AA705927 

    GeneLoc Exon Structure

    5/24 Alternative Splicing Database (ASD) splice patterns (SP) for PRMT2 (see all 24)    About this scheme

    ExUns: 1a · 1b · 1c · 1d · 1e · 1f · 1g · 1h ^ 2a · 2b ^ 3a · 3b ^ 4a · 4b · 4c ^ 5a · 5b · 5c · 5d ^ 6a · 6b ^ 7a · 7b ^ 8a · 8b · 8c ·
    SP1:                                            -                             -                                                                                 
    SP2:                                                                          -                                                                                 
    SP3:                                            -     -     -                 -                                                                                 
    SP4:                                            -     -     -                 -                                                                                 
    SP5:                                            -     -     -                 -                                                                                 

    ExUns: 8d · 8e ^ 9 ^ 10 ^ 11a · 11b · 11c ^ 12 ^ 13 ^ 14 ^ 15a · 15b ^ 16a · 16b · 16c · 16d
    SP1:  -     -     -     -                 -           -                                             
    SP2:  -     -     -     -                 -           -                                             
    SP3:  -     -     -     -                 -           -                                             
    SP4:  -     -     -     -     -     -     -     -     -                                             
    SP5:  -     -                                                                                       


    ECgene alternative splicing isoforms for PRMT2

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    PRMT2 expression in normal human tissues (normalized intensities)      PRMT2 embryonic expression: see
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: CTCAATAAAT
    PRMT2 Expression
    About this image


    PRMT2 expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database 
     5/17 selected tissues (see all 17) fully expand
     
     Brain (Nervous System)    fully expand to see all 21 entries
             Thalamus
             Septum   
     
     Spinal Cord (Nervous System)    fully expand to see all 3 entries
             Dorsal Horn   
     
     Neural Tube (Nervous System)    fully expand to see all 3 entries
             Telencephalon
     
     Nose (Sensory Organs)    fully expand to see all 2 entries
             sensory organ/nose   
     
     Blood (Hematopoietic System)    fully expand to see all 2 entries
             t cells   

    See PRMT2 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for PRMT2

    SOURCE GeneReport for Unigene cluster: Hs.154163

    UniProtKB/Swiss-Prot: ANM2_HUMAN, P55345
    Tissue specificity: Widely expressed. Highly expressed in androgen target organs such as heart, prostate, skeletal
    muscle, ovary and spinal cord

        SABiosciences Expression via Pathway-Focused PCR Array including PRMT2: 
              Epigenetic Chromatin Modification Enzymes in human mouse rat

    Primer
    Products:
    OriGene qPCR primer pairs and template standards for PRMT2
    OriGene qSTAR qPCR primer pairs in human, mouse for PRMT2
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat PRMT2
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat PRMT2
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat PRMT2
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for PRMT2

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of animals and fungi.

    Orthologs for PRMT2 gene from 5/10 species (see all 10)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Prmt21 , 5 protein arginine N-methyltransferase 21, 5 83.76(n)1
    88.22(a)1
      10 (38.74 cM)5
    154681  NM_001077638.11  NP_001071106.11 
     762072275 
    tropical clawed frog
    (Xenopus tropicalis)
    Amphibia 1377162692   -- 70.97(n)    137716269 
    zebrafish
    (Danio rerio)
    Actinopterygii prmt21 protein arginine methyltransferase 2 59.85(n)
    56.06(a)
      558841  NM_001080175.1  NP_001073644.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta Art86
    Arginine methyltransferase 8
    30(a)
    1 → many
    2L(11009821-11011085)
    baker's yeast
    (Saccharomyces cerevisiae)
    Saccharomycetes HMT16
    Nuclear SAM-dependent mono- and asymmetric arginin...
    32(a)
    1 → many
    II(304930-305976)


    ENSEMBL Gene Tree for PRMT2 (if available)
    TreeFam Gene Tree for PRMT2 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for PRMT2 gene
    PRMT62  PRMT32  CARM12  PRMT12  PRMT82  
    6 SIMAP similar genes for PRMT2 using alignment to 9 protein entries:     ANM2_HUMAN (see all proteins):
    PRMT1    CARM1    PRMT8    HRMT1L2    PRMT3    PRMT6

    PRMT2 for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/815 SNPs in PRMT2 are shown (see all 815)    About this table     
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 21 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs611103071,2
    C--33445104(+) AAAAA-/AA/TAGGAAAAATTCTATAAATCTATGAATGATACTACGTGAGCCATGATGG
    TGCTGTTGCACTTCAGCCTGGGCTACAGAGCGAGAGCCTGTCTCAAAAAAAAAAA
    TAGAA
    5 -- int11NA 2
    rs602834411,2
    C--48053599(+) TTTTT-/TCTTTT 5 -- us2k10--------
    rs99798621,2
    C--48053648(+) ccacaT/Ccacct 5 -- us2k12Minor allele frequency- C:0.00NA 4
    rs1459054951,2
    C--48053656(+) CCTTT-/TGTGTGT 5 -- us2k10--------
    rs568223801,2
    C--48053670(+) GTGTG-/T/TG  
            
    GTGGG
    5 -- us2k10--------
    rs1123495151,2
    F--48053700(+) CACTTC/TAGAGG 5 -- us2k11Minor allele frequency- T:0.50CSA 2
    rs99774921,2
    C,F--48053710(+) gcctcA/Gcttct 5 -- us2k19Minor allele frequency- G:0.45NA WA CSA EA 370
    rs1435976471,2
    C--48053742(+) GGTTTC/TGATCA 5 -- us2k10--------
    rs1878641441,2
    --48053795(+) GAACAA/GAAAAC 5 -- us2k10--------
    rs1931555071,2
    --48053820(+) AAAAAA/CCAGTT 5 -- us2k10--------

    HapMap Linkage Disequilibrium report for PRMT2 (48055079 - 48085155 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 7 variations for PRMT2:    About this table     
    Variant IDTypeSubtypePubMed ID
    esv2658047CNV Deletion23128226
    esv1540677CNV Insertion17803354
    nsv9864CNV Gain18304495
    esv34393CNV Gain17911159
    nsv470910CNV Gain18288195
    nsv9865CNV Gain18304495
    dgv1375e1CNV Complex17122850

    SABiosciences Cancer Mutation PCR Assays
    SeqTarget long-range PCR primers for resequencing PRMT2
    DNA2.0 Custom Variant and Variant Library Synthesis for PRMT2

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section
    OMIM gene information: 601961    OMIM disorders: --

    6 diseases for PRMT2:    About MalaCards
    spina bifida    kaposi's sarcoma    sarcoma    thyroiditis
    breast cancer    prostatitis


    PRMT2 for disorders           About GeneDecksing

    Genetic Association Database (GAD): PRMT2
    Human Genome Epidemiology (HuGE) Navigator: PRMT2 (1 document)

    Export disorders for PRMT2 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for PRMT2 gene, integrated from 9 sources (see all 28):
    (articles sorted by number of sources associating them with PRMT2)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Identification and characterization of two putative human arginine methyltransferases (HRMT1L1 and HRMT1L2). (PubMed id 9545638)1, 2, 3, 9 Scott H.S....Henry M.F. (1998)
    2. Kinetic analysis of human protein arginine N-methyltr ansferase 2: formation of monomethyl- and asymmetric dimethyl-arginine residues on histone H4. (PubMed id 19405910)1, 2, 9 Lakowski T.M. and Frankel A. (2009)
    3. Identification and mapping of a novel human gene, HRMT1L1, homologous to the rat protein arginine N-methyltransferase 1 (PRMT1) gene. (PubMed id 9196002)1, 2, 9 Katsanis N.... Fisher E.M.C. (1997)
    4. An association study of 45 folate-related genes in spina bifida: Involvement of cubilin (CUBN) and tRNA aspartic acid methyltransferase 1 (TRDMT1). (PubMed id 19161160)1, 4 Franke B....Blom H.J. (2009)
    5. PRMT2, a member of the protein arginine methyltransferase family, is a coactivator of the androgen receptor. (PubMed id 17587566)1, 2 Meyer R....Obendorf M. (2007)
    6. Protein methyltransferase 2 inhibits NF-kappaB function and promotes apoptosis. (PubMed id 16648481)1, 2 Ganesh L....Nabel G.J. (2006)
    7. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S....Malek J. (2004)
    8. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)1, 2 Ota T.... Sugano S. (2004)
    9. Identification of protein arginine methyltransferase 2 as a coactivator for estrogen receptor alpha. (PubMed id 12039952)1, 2 Qi C.... Zhu Y.-J. (2002)
    10. Heterogeneous nuclear ribonucleoprotein E1B-AP5 is methylated in its Arg-Gly-Gly (RGG) box and interacts with human arginine methyltransferase HRMT1L1. (PubMed id 11513728)1, 2 Kzhyshkowska J....Dobner T. (2001)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 3275 HGNC: 5186 AceView: HRMT1L1 Ensembl:ENSG00000160310 euGenes: HUgn3275
    ECgene: PRMT2 H-InvDB: PRMT2

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for PRMT2 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for PRMT2 gene:
    Search GeneIP for patents involving PRMT2

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Sirion Biotech, Cell lines from GenScript, and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

     Browse Small Molecules at EMD Millipore
     Browse Kits and Assays available from EMD Millipore
     Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
     Browse Purified and Recombinant Proteins at EMD Millipore
     EMD Millipore Mono- and Polyclonal Antibodies for the study of PRMT2
     Browse for Gene Knock-down Tools from EMD Millipore
     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Protease Activity Assays and Reagents   Browse Recombinant/Natural Proteins  
     Browse Stem Cell Products   Browse Tocris Biochemicals & Compounds  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     OriGene Antibodies for PRMT2   OriGene RNAi products in human, mouse, rat for PRMT2  
     OriGene qPCR primer pairs and template standards for PRMT2   OriGene Protein Over-expression Lysate for PRMT2  
     OriGene MassSpec something-or-other for PRMT2   OriGene clones in human, mouse for PRMT2  
     OriGene qSTAR qPCR primer pairs in human, mouse for PRMT2   OriGene Purified Protein for PRMT2  
     OriGene ORF clones in mouse, rat for PRMT2   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for PRMT2   OriGene Custom Protein Services for PRMT2  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat PRMT2
     QIAGEN SeqTarget long-range PCR primers for resequencing PRMT2
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat PRMT2
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat PRMT2
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat PRMT2
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat PRMT2
     GenScript Custom Purified and Recombinant Proteins Services for PRMT2 GenScript cDNA clones with any tag delivered in your preferred vector for PRMT2
     GenScript Custom Assay Services for PRMT2 GenScript Custom Superior Antibodies Services for PRMT2
     GenScript Custom overexpressing Cell Line Services for PRMT2 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in PRMT2 promoter
     Search Chromatin IP Primers for PRMT2
     RT2 qPCR Primer Assay in human, mouse, rat PRMT2
     GNC Network for PRMT2
     SABiosciences PCR Arrays including human, mouse, rat PRMT2
     Search Tocris compounds for PRMT2 (ANM2)
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     PRMT2 antibodies
     PRMT2 proteins
     PRMT2 lysates
     Antibodies for PRMT2
     See all of Abcam's Antibodies, Kits and Proteins for PRMT2
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     Proteins for PRMT2
     Antibodies for PRMT2
     ELISAs for PRMT2
     CLIAs for PRMT2
     Search LifeMap BioReagents cell lines for PRMT2
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for PRMT2
     Browse SwitchGear 3'UTR luciferase reporter plasmids for PRMT2
     SwitchGear Promoter luciferase reporter plasmids for PRMT2
     ThermoFisher Antibody for PRMT2
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat PRMT2
     inGenious Targeting Laboratory - Custom generated mouse model solutions for PRMT2
     inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for PRMT2
    Customized:
     lentivirus for stable overexpression of PRMT2
     lentivirus expression plasmids for stable overexpression of PRMT2
     adenovirus for overexpression of PRMT2
     LSBio Antibodies in human, mouse, rat for PRMT2
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
           
    GeneCards Homepage - Last full update: 23 Oct 2013 - Incrementals: 4 Nov 2013 , 7 Nov 2013 , 23 Jan 2014

    View Random Gene

    Category
    (GIFtS: 73)
    transforming growth factor, beta 1
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      PRMT2 gene at Home site.
    hostname: 356980-web2.xennexinc.com index build: 106 solr: 1.4