Free for academic non-profit institutions. Other users need a Commercial license

Aliases for PPP3R1 Gene

Aliases for PPP3R1 Gene

  • Protein Phosphatase 3 Regulatory Subunit B, Alpha 2 3 5
  • Protein Phosphatase 3 (Formerly 2B), Regulatory Subunit B (19kD), Alpha Isoform (Calcineurin B, Type I) 2 3
  • Protein Phosphatase 3 (Formerly 2B), Regulatory Subunit B, 19kDa, Alpha Isoform (Calcineurin B, Type I) 2 3
  • Protein Phosphatase 3 (Formerly 2B), Regulatory Subunit B, Alpha Isoform 2 3
  • Protein Phosphatase 2B Regulatory Subunit B Alpha 2 3
  • Protein Phosphatase 2B Regulatory Subunit 1 3 4
  • Calcineurin B, Type I (19kDa) 2 3
  • CNB 3 4
  • Protein Phosphatase 3 Regulatory Subunit B Alpha Isoform 1 4
  • Protein Phosphatase 3, Regulatory Subunit B, Alpha 2
  • Calcineurin Subunit B Type 1 3
  • CALNB1 3
  • CNA2 4
  • CNB1 3

External Ids for PPP3R1 Gene

Previous GeneCards Identifiers for PPP3R1 Gene

  • GC02M068539
  • GC02M068363
  • GC02M068324
  • GC02M068380
  • GC02M068261
  • GC02M068317
  • GC02M068259
  • GC02M068358
  • GC02M068405

Summaries for PPP3R1 Gene

GeneCards Summary for PPP3R1 Gene

PPP3R1 (Protein Phosphatase 3 Regulatory Subunit B, Alpha) is a Protein Coding gene. Diseases associated with PPP3R1 include Calcaneonavicular Coalition and Extracranial Neuroblastoma. Among its related pathways are Calcium signaling pathway and Long-term potentiation. GO annotations related to this gene include calcium ion binding and calmodulin binding. An important paralog of this gene is ENSG00000273398.

UniProtKB/Swiss-Prot for PPP3R1 Gene

  • Regulatory subunit of calcineurin, a calcium-dependent, calmodulin stimulated protein phosphatase. Confers calcium sensitivity.

Gene Wiki entry for PPP3R1 Gene

Additional gene information for PPP3R1 Gene

No data available for Entrez Gene Summary , CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for PPP3R1 Gene

Genomics for PPP3R1 Gene

Regulatory Elements for PPP3R1 Gene

Enhancers for PPP3R1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH02H068190 1.2 Ensembl ENCODE dbSUPER 31.1 +64.9 64875 1.7 ZNF362 FOXA2 JUN CEBPB CEBPG FOXA1 FOSL1 JUND FOS ZBTB33 PPP3R1 WDR92 PNO1 ENSG00000273275 LOC102724389
GH02H068192 1.8 VISTA Ensembl ENCODE dbSUPER 18.5 +62.4 62397 2.2 TAL1 JUN CEBPG FOSL1 TCF12 ZNF316 NCOR1 EGR1 FOS DPF2 WDR92 PPP3R1 PNO1 ENSG00000273275 LOC102724389
GH02H068248 1.4 ENCODE dbSUPER 20.9 +4.6 4633 5.9 HDGF PKNOX1 FOXA2 ARNT ARID4B SIN3A DMAP1 ZNF2 YY1 SLC30A9 PPP3R1 WDR92 PNO1 LOC102724389
GH02H068203 1.3 Ensembl ENCODE dbSUPER 19.8 +52.2 52163 1.8 PKNOX1 TBL1XR1 RBBP5 EBF1 BATF RELA ATF7 ETV6 RUNX3 IKZF2 PPP3R1 WDR92 PNO1 ENSG00000273275 LOC102724389
GH02H068214 0.8 dbSUPER 31.9 +38.3 38341 6.2 PKNOX1 ZNF7 ZNF316 ZSCAN5C NFE2 RUNX3 MAFK IKZF2 CREM NFE2L2 PPP3R1 WDR92 PNO1 LOC102724389 ENSG00000273275
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around PPP3R1 on UCSC Golden Path with GeneCards custom track

Genomic Locations for PPP3R1 Gene

Genomic Locations for PPP3R1 Gene
77,381 bases
Minus strand

Genomic View for PPP3R1 Gene

Genes around PPP3R1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
PPP3R1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for PPP3R1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for PPP3R1 Gene

Proteins for PPP3R1 Gene

  • Protein details for PPP3R1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Calcineurin subunit B type 1
    Protein Accession:
    Secondary Accessions:
    • B2RC10
    • B5MDU4
    • P06705
    • P15117
    • Q08044
    • Q53SL0

    Protein attributes for PPP3R1 Gene

    170 amino acids
    Molecular mass:
    19300 Da
    Quaternary structure:
    • Interacts with CIB1 (via C-terminal region); the interaction increases upon cardiomyocytes hypertrophy (By similarity). Composed of a catalytic subunit (A) and a regulatory subunit (B).
    • This protein has four functional calcium-binding sites.

    Three dimensional structures from OCA and Proteopedia for PPP3R1 Gene

neXtProt entry for PPP3R1 Gene

Post-translational modifications for PPP3R1 Gene

  • Ubiquitination at Lys125
  • Modification sites at PhosphoSitePlus

Other Protein References for PPP3R1 Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

  • R&D Systems Antibodies for PPP3R1 (Calcineurin B)
  • Cloud-Clone Corp. Antibodies for PPP3R1

No data available for DME Specific Peptides for PPP3R1 Gene

Domains & Families for PPP3R1 Gene

Gene Families for PPP3R1 Gene

Suggested Antigen Peptide Sequences for PPP3R1 Gene

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the calcineurin regulatory subunit family.
  • Belongs to the calcineurin regulatory subunit family.
genes like me logo Genes that share domains with PPP3R1: view

Function for PPP3R1 Gene

Molecular function for PPP3R1 Gene

GENATLAS Biochemistry:
calcineurin B,calmodulin dependent protein serine/threonine phosphatase 3,regulatory subunit
UniProtKB/Swiss-Prot Function:
Regulatory subunit of calcineurin, a calcium-dependent, calmodulin stimulated protein phosphatase. Confers calcium sensitivity.

Phenotypes From GWAS Catalog for PPP3R1 Gene

Gene Ontology (GO) - Molecular Function for PPP3R1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004723 calcium-dependent protein serine/threonine phosphatase activity NAS 2558868
GO:0005509 calcium ion binding IEA,NAS 2558868
GO:0005515 protein binding IPI 8524402
GO:0005516 calmodulin binding NAS 2558868
GO:0016018 cyclosporin A binding IDA 12357034
genes like me logo Genes that share ontologies with PPP3R1: view
genes like me logo Genes that share phenotypes with PPP3R1: view

Animal Models for PPP3R1 Gene

MGI Knock Outs for PPP3R1:

Animal Model Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for PPP3R1 Gene

Localization for PPP3R1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for PPP3R1 Gene

Cytoplasm, cytosol. Cell membrane. Cell membrane, sarcolemma. Membrane; Lipid-anchor. Note=Translocates from the cytosol to the sarcolemma in a CIB1-dependent manner during cardiomyocytes hypertrophy. {ECO:0000250}.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for PPP3R1 gene
Compartment Confidence
cytosol 5
plasma membrane 4
nucleus 4
mitochondrion 2
endoplasmic reticulum 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (2)
  • Plasma membrane (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for PPP3R1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005654 nucleoplasm TAS --
GO:0005737 cytoplasm IEA --
GO:0005739 mitochondrion IEA --
GO:0005829 cytosol TAS --
GO:0005886 plasma membrane IEA --
genes like me logo Genes that share ontologies with PPP3R1: view

Pathways & Interactions for PPP3R1 Gene

genes like me logo Genes that share pathways with PPP3R1: view

Pathways by source for PPP3R1 Gene

Gene Ontology (GO) - Biological Process for PPP3R1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006470 protein dephosphorylation IEA --
GO:0007223 Wnt signaling pathway, calcium modulating pathway TAS --
GO:0033173 calcineurin-NFAT signaling cascade IDA 22688515
GO:0038095 Fc-epsilon receptor signaling pathway TAS --
GO:0045944 positive regulation of transcription from RNA polymerase II promoter IDA 22688515
genes like me logo Genes that share ontologies with PPP3R1: view

No data available for SIGNOR curated interactions for PPP3R1 Gene

Drugs & Compounds for PPP3R1 Gene

(6) Drugs for PPP3R1 Gene - From: DrugBank, ApexBio, HMDB, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Cyclosporin A Approved, Investigational, Vet_approved Pharma Antagonist Immunosuppressant drug, Immunosuppressive agent 0
Pimecrolimus Approved, Investigational Pharma 63
Myristic acid Experimental Pharma Target 0
Voclosporin Investigational Pharma Target 0
calcium Nutra 0

(2) ApexBio Compounds for PPP3R1 Gene

Compound Action Cas Number
Cyclosporine Immunosuppressant drug 79217-60-0
Pimecrolimus 137071-32-0
genes like me logo Genes that share compounds with PPP3R1: view

Drug Products

Transcripts for PPP3R1 Gene

mRNA/cDNA for PPP3R1 Gene

Unigene Clusters for PPP3R1 Gene

Protein phosphatase 3, regulatory subunit B, alpha:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for PPP3R1 Gene

No ASD Table

Relevant External Links for PPP3R1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for PPP3R1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for PPP3R1 Gene

mRNA differential expression in normal tissues according to GTEx for PPP3R1 Gene

This gene is overexpressed in Brain - Frontal Cortex (BA9) (x4.5).

Protein differential expression in normal tissues from HIPED for PPP3R1 Gene

This gene is overexpressed in Brain (24.9) and Fetal Brain (8.5).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for PPP3R1 Gene

Protein tissue co-expression partners for PPP3R1 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of PPP3R1 Gene:


SOURCE GeneReport for Unigene cluster for PPP3R1 Gene:


Evidence on tissue expression from TISSUES for PPP3R1 Gene

  • Blood(4.3)
  • Nervous system(2.9)
  • Muscle(2.3)
  • Lung(2.2)
  • Spleen(2.1)
  • Heart(2)
genes like me logo Genes that share expression patterns with PPP3R1: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for PPP3R1 Gene

Orthologs for PPP3R1 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for PPP3R1 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia PPP3R1 33
  • 100 (n)
(Monodelphis domestica)
Mammalia -- 34
  • 98 (a)
(Bos Taurus)
Mammalia PPP3R1 33 34
  • 97.06 (n)
WDR92 34
  • 3 (a)
(Canis familiaris)
Mammalia PPP3R1 33
  • 95.46 (n)
-- 34
  • 22 (a)
(Mus musculus)
Mammalia Ppp3r1 33 16 34
  • 94.51 (n)
(Ornithorhynchus anatinus)
Mammalia -- 34
  • 94 (a)
-- 34
  • 3 (a)
(Rattus norvegicus)
Mammalia Ppp3r1 33
  • 92.35 (n)
(Gallus gallus)
Aves PPP3R1 33 34
  • 91.18 (n)
WDR92 34
  • 3 (a)
(Anolis carolinensis)
Reptilia -- 34
  • 23 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia ppp3r1 33
  • 86.08 (n)
MGC75600 33
(Danio rerio)
Actinopterygii ppp3r1a 33 34
  • 80.59 (n)
wdr92 34
  • 2 (a)
nrarpa 33
fruit fly
(Drosophila melanogaster)
Insecta CanB 35
  • 85 (a)
CanB2 35 33
  • 72.16 (n)
CG14353 34
  • 1 (a)
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP004298 33
  • 70.59 (n)
(Caenorhabditis elegans)
Secernentea cnb-1 33
  • 68.04 (n)
K. lactis yeast
(Kluyveromyces lactis)
Saccharomycetes KLLA0D02992g 33
  • 64.3 (n)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes CNB1 33
  • 58.76 (n)
A. gosspyii yeast
(Ashbya gossypii)
Saccharomycetes AGOS_AER096C 33
  • 58.13 (n)
thale cress
(Arabidopsis thaliana)
eudicotyledons AT3G18430 33
  • 46.1 (n)
(Oryza sativa)
Liliopsida Os08g0442300 33
  • 47.15 (n)
fission yeast
(Schizosaccharomyces pombe)
Schizosaccharomycetes SPCC830.06 33
  • 59.02 (n)
bread mold
(Neurospora crassa)
Ascomycetes NCU03833 33
  • 58.45 (n)
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 3 (a)
sea squirt
(Ciona intestinalis)
Ascidiacea Cin.14820 33
Species where no ortholog for PPP3R1 was found in the sources mined by GeneCards:
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for PPP3R1 Gene

Gene Tree for PPP3R1 (if available)
Gene Tree for PPP3R1 (if available)

Paralogs for PPP3R1 Gene

Paralogs for PPP3R1 Gene

genes like me logo Genes that share paralogs with PPP3R1: view

Variants for PPP3R1 Gene

Sequence variations from dbSNP and Humsavar for PPP3R1 Gene

SNP ID Clin Chr 02 pos Sequence Context AA Info Type
rs3039851 untested 68,218,182(+) TGCTA(-/TTAAT)TTAAG intron-variant
rs72174030 untested 68,252,586(+) GCGGG(-/GGCGGAGGCGGGGGCGCGCGCGGGCCGGC)GCGGG intron-variant, upstream-variant-2KB
rs1000039131 -- 68,219,085(+) ATTCA(A/G)TAGCT intron-variant
rs1000067912 -- 68,210,324(+) GCATG(C/T)AATTT intron-variant
rs1000104324 -- 68,191,306(+) TGTAC(A/G)GCATC intron-variant

Structural Variations from Database of Genomic Variants (DGV) for PPP3R1 Gene

Variant ID Type Subtype PubMed ID
nsv1072948 CNV deletion 25765185
nsv1126551 CNV deletion 24896259
nsv834251 CNV loss 17160897
nsv953138 CNV duplication 24416366

Variation tolerance for PPP3R1 Gene

Residual Variation Intolerance Score: 55.3% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for PPP3R1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for PPP3R1 Gene

Disorders for PPP3R1 Gene

MalaCards: The human disease database

(8) MalaCards diseases for PPP3R1 Gene - From: DISEASES

Disorder Aliases PubMed IDs
calcaneonavicular coalition
  • multiple synostosis syndrome
extracranial neuroblastoma
cervical neuroblastoma
  • ascariasis
breast abscess
  • abscess of breast
- elite association - COSMIC cancer census association via MalaCards

Relevant External Links for PPP3R1

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with PPP3R1: view

No data available for UniProtKB/Swiss-Prot and Genatlas for PPP3R1 Gene

Publications for PPP3R1 Gene

  1. Identification of a novel 5-base pair deletion in calcineurin B (PPP3R1) promoter region and its association with left ventricular hypertrophy. (PMID: 16209992) Tang W … Ferrell RE (American heart journal 2005) 3 22 45 60
  2. Isolation and sequence of a cDNA clone for human calcineurin B, the Ca2+-binding subunit of the Ca2+/calmodulin-stimulated protein phosphatase. (PMID: 2558868) Guerini D … Klee CB (DNA (Mary Ann Liebert, Inc.) 1989) 2 3 4 60
  3. Variation at the NFATC2 locus increases the risk of thiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipril and rosiglitazone Medication (DREAM) study. (PMID: 20628086) Bailey SD … DREAM investigators (Diabetes care 2010) 3 45 60
  4. SNPs associated with cerebrospinal fluid phospho-tau levels influence rate of decline in Alzheimer's disease. (PMID: 20862329) Cruchaga C … Goate AM (PLoS genetics 2010) 3 45 60
  5. Pharmacogenetics of antipsychotic response in the CATIE trial: a candidate gene analysis. (PMID: 19156168) Need AC … Goldstein DB (European journal of human genetics : EJHG 2009) 3 45 60

Products for PPP3R1 Gene

Sources for PPP3R1 Gene

Loading form....