Free for academic non-profit institutions. Other users need a Commercial license

Aliases for PPP3R1 Gene

Aliases for PPP3R1 Gene

  • Protein Phosphatase 3 Regulatory Subunit B, Alpha 2 3 5
  • Protein Phosphatase 3 (Formerly 2B), Regulatory Subunit B (19kD), Alpha Isoform (Calcineurin B, Type I) 2 3
  • Protein Phosphatase 3 (Formerly 2B), Regulatory Subunit B, 19kDa, Alpha Isoform (Calcineurin B, Type I) 2 3
  • Protein Phosphatase 3 (Formerly 2B), Regulatory Subunit B, Alpha Isoform 2 3
  • Protein Phosphatase 2B Regulatory Subunit B Alpha 2 3
  • Protein Phosphatase 2B Regulatory Subunit 1 3 4
  • Calcineurin B, Type I (19kDa) 2 3
  • CNB 3 4
  • Protein Phosphatase 3 Regulatory Subunit B Alpha Isoform 1 4
  • Protein Phosphatase 3, Regulatory Subunit B, Alpha 2
  • Calcineurin Subunit B Type 1 3
  • CALNB1 3
  • CNA2 4
  • CNB1 3

External Ids for PPP3R1 Gene

Previous GeneCards Identifiers for PPP3R1 Gene

  • GC02M068539
  • GC02M068363
  • GC02M068324
  • GC02M068380
  • GC02M068261
  • GC02M068317
  • GC02M068259
  • GC02M068358
  • GC02M068405

Summaries for PPP3R1 Gene

GeneCards Summary for PPP3R1 Gene

PPP3R1 (Protein Phosphatase 3 Regulatory Subunit B, Alpha) is a Protein Coding gene. Diseases associated with PPP3R1 include Calcaneonavicular Coalition and Extracranial Neuroblastoma. Among its related pathways are HTLV-I infection and Activation of cAMP-Dependent PKA. GO annotations related to this gene include calcium ion binding and calmodulin binding. An important paralog of this gene is ENSG00000273398.

UniProtKB/Swiss-Prot for PPP3R1 Gene

  • Regulatory subunit of calcineurin, a calcium-dependent, calmodulin stimulated protein phosphatase. Confers calcium sensitivity.

Gene Wiki entry for PPP3R1 Gene

No data available for Entrez Gene Summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for PPP3R1 Gene

Genomics for PPP3R1 Gene

Regulatory Elements for PPP3R1 Gene

Enhancers for PPP3R1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH02F068217 0.7 Ensembl 31.8 +37.6 37637 2.4 MAFG ZNF7 ZNF316 MAFF IKZF1 NFE2L1 IRF1 NFE2 EMSY MAFK PPP3R1 WDR92 PNO1 LOC102724389 ENSG00000273275
GH02F068189 1 Ensembl ENCODE 31.1 +65.3 65338 2.6 BRD4 PKNOX1 JUN EED PRDM10 FOS MAFK ZNF197 ZNF680 ZNF362 PPP3R1 WDR92 PNO1 ENSG00000273275 LOC102724389
GH02F068248 0.4 ENCODE 20.9 +4.6 4633 5.9 HDGF PKNOX1 WRNIP1 ARID4B SIN3A DMAP1 ZNF2 YY1 SLC30A9 ZNF143 PPP3R1 WDR92 ETAA1 PNO1 LOC102724389
GH02F068235 1.1 Ensembl ENCODE 20.5 +17.1 17137 6.6 HDGF PKNOX1 CREB3L1 ZFP64 ARID4B SIN3A ZNF2 YY1 SLC30A9 ZNF766 PPP3R1 WDR92 ETAA1 PNO1 APLF LOC102724389 ENSG00000273275
GH02F068228 0.5 Ensembl 20.3 +25.5 25537 4.6 PKNOX1 TAL1 GTF2E2 ZNF384 FOSL1 ZNF316 SCRT2 NFE2 ZSCAN29 TRIM24 PPP3R1 WDR92 LOC102724389 ENSG00000273275
- Elite enhancer/Elite enhancer-gene association Download Table
Download GeneHancer data dump

Enhancers around PPP3R1 on UCSC Golden Path with GeneCards custom track

Genomic Location for PPP3R1 Gene

Chromosome:
2
Start:
68,178,857 bp from pter
End:
68,256,237 bp from pter
Size:
77,381 bases
Orientation:
Minus strand

Genomic View for PPP3R1 Gene

Genes around PPP3R1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
PPP3R1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for PPP3R1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for PPP3R1 Gene

Proteins for PPP3R1 Gene

  • Protein details for PPP3R1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P63098-CANB1_HUMAN
    Recommended name:
    Calcineurin subunit B type 1
    Protein Accession:
    P63098
    Secondary Accessions:
    • B2RC10
    • B5MDU4
    • P06705
    • P15117
    • Q08044
    • Q53SL0

    Protein attributes for PPP3R1 Gene

    Size:
    170 amino acids
    Molecular mass:
    19300 Da
    Quaternary structure:
    • Interacts with CIB1 (via C-terminal region); the interaction increases upon cardiomyocytes hypertrophy (By similarity). Composed of a catalytic subunit (A) and a regulatory subunit (B).
    Miscellaneous:
    • This protein has four functional calcium-binding sites.

    Three dimensional structures from OCA and Proteopedia for PPP3R1 Gene

neXtProt entry for PPP3R1 Gene

Post-translational modifications for PPP3R1 Gene

  • Ubiquitination at Lys 125
  • Modification sites at PhosphoSitePlus

Other Protein References for PPP3R1 Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

  • R&D Systems Antibodies for PPP3R1 (Calcineurin B)
  • Cloud-Clone Corp. Antibodies for PPP3R1

No data available for DME Specific Peptides for PPP3R1 Gene

Domains & Families for PPP3R1 Gene

Suggested Antigen Peptide Sequences for PPP3R1 Gene

Graphical View of Domain Structure for InterPro Entry

P63098

UniProtKB/Swiss-Prot:

CANB1_HUMAN :
  • Contains 4 EF-hand domains.
  • Belongs to the calcineurin regulatory subunit family.
Domain:
  • Contains 4 EF-hand domains.
Family:
  • Belongs to the calcineurin regulatory subunit family.
genes like me logo Genes that share domains with PPP3R1: view

Function for PPP3R1 Gene

Molecular function for PPP3R1 Gene

GENATLAS Biochemistry:
calcineurin B,calmodulin dependent protein serine/threonine phosphatase 3,regulatory subunit
UniProtKB/Swiss-Prot Function:
Regulatory subunit of calcineurin, a calcium-dependent, calmodulin stimulated protein phosphatase. Confers calcium sensitivity.

Gene Ontology (GO) - Molecular Function for PPP3R1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004723 calcium-dependent protein serine/threonine phosphatase activity NAS 2558868
GO:0005509 calcium ion binding IEA,NAS 2558868
GO:0005515 protein binding IPI 8524402
GO:0005516 calmodulin binding NAS 2558868
GO:0019904 protein domain specific binding IPI 20639889
genes like me logo Genes that share ontologies with PPP3R1: view
genes like me logo Genes that share phenotypes with PPP3R1: view

Animal Models for PPP3R1 Gene

MGI Knock Outs for PPP3R1:

Animal Model Products

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for PPP3R1 Gene

Localization for PPP3R1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for PPP3R1 Gene

Cytoplasm, cytosol. Cell membrane. Cell membrane, sarcolemma. Membrane; Lipid-anchor. Note=Translocates from the cytosol to the sarcolemma in a CIB1-dependent manner during cardiomyocytes hypertrophy. {ECO:0000250}.

Subcellular locations from

COMPARTMENTS
Jensen Localization Image for PPP3R1 Gene COMPARTMENTS Subcellular localization image for PPP3R1 gene
Compartment Confidence
cytosol 5
plasma membrane 5
mitochondrion 4
nucleus 4
endoplasmic reticulum 1
vacuole 1

Gene Ontology (GO) - Cellular Components for PPP3R1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005654 nucleoplasm TAS --
GO:0005737 cytoplasm IEA --
GO:0005739 mitochondrion IEA --
GO:0005829 cytosol TAS --
GO:0005886 plasma membrane IEA --
genes like me logo Genes that share ontologies with PPP3R1: view

Pathways & Interactions for PPP3R1 Gene

genes like me logo Genes that share pathways with PPP3R1: view

Gene Ontology (GO) - Biological Process for PPP3R1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001569 branching involved in blood vessel morphogenesis IEA --
GO:0001837 epithelial to mesenchymal transition IEA --
GO:0006470 protein dephosphorylation IEA --
GO:0007223 Wnt signaling pathway, calcium modulating pathway TAS --
GO:0007507 heart development IEA --
genes like me logo Genes that share ontologies with PPP3R1: view

No data available for SIGNOR curated interactions for PPP3R1 Gene

Drugs & Compounds for PPP3R1 Gene

(6) Drugs for PPP3R1 Gene - From: DrugBank, ApexBio, HMDB, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Cyclosporine Approved, Investigational, Vet_approved Pharma Antagonist Immunosuppressant drug, Immunosuppressive agent, Calcineurin inhibitor 915
Pimecrolimus Approved, Investigational Pharma 62
MYRISTIC ACID Experimental Pharma Target 0
ISA247 Investigational Pharma Target 0
calcium Nutra 0

(2) ApexBio Compounds for PPP3R1 Gene

Compound Action Cas Number
Cyclosporine Immunosuppressant drug 79217-60-0
Pimecrolimus 137071-32-0
genes like me logo Genes that share compounds with PPP3R1: view

Transcripts for PPP3R1 Gene

mRNA/cDNA for PPP3R1 Gene

Unigene Clusters for PPP3R1 Gene

Protein phosphatase 3, regulatory subunit B, alpha:
Representative Sequences:

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for PPP3R1 Gene

No ASD Table

Relevant External Links for PPP3R1 Gene

GeneLoc Exon Structure for
PPP3R1
ECgene alternative splicing isoforms for
PPP3R1

Expression for PPP3R1 Gene

mRNA expression in normal human tissues for PPP3R1 Gene

mRNA differential expression in normal tissues according to GTEx for PPP3R1 Gene

This gene is overexpressed in Brain - Frontal Cortex (BA9) (x4.5).

Protein differential expression in normal tissues from HIPED for PPP3R1 Gene

This gene is overexpressed in Brain (24.9) and Fetal Brain (8.5).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for PPP3R1 Gene



Protein tissue co-expression partners for PPP3R1 Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of PPP3R1 Gene:

PPP3R1

SOURCE GeneReport for Unigene cluster for PPP3R1 Gene:

Hs.280604
genes like me logo Genes that share expression patterns with PPP3R1: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery and mRNA Expression by UniProt/SwissProt for PPP3R1 Gene

Orthologs for PPP3R1 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for PPP3R1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia PPP3R1 34
  • 100 (n)
oppossum
(Monodelphis domestica)
Mammalia -- 35
  • 98 (a)
ManyToMany
cow
(Bos Taurus)
Mammalia PPP3R1 34 35
  • 97.06 (n)
WDR92 35
  • 3 (a)
ManyToMany
dog
(Canis familiaris)
Mammalia PPP3R1 34
  • 95.46 (n)
-- 35
  • 22 (a)
OneToMany
mouse
(Mus musculus)
Mammalia Ppp3r1 34 16 35
  • 94.51 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia -- 35
  • 94 (a)
ManyToMany
-- 35
  • 3 (a)
ManyToMany
rat
(Rattus norvegicus)
Mammalia Ppp3r1 34
  • 92.35 (n)
chicken
(Gallus gallus)
Aves PPP3R1 34 35
  • 91.18 (n)
WDR92 35
  • 3 (a)
ManyToMany
lizard
(Anolis carolinensis)
Reptilia -- 35
  • 23 (a)
OneToMany
tropical clawed frog
(Silurana tropicalis)
Amphibia ppp3r1 34
  • 86.08 (n)
MGC75600 34
zebrafish
(Danio rerio)
Actinopterygii ppp3r1a 34 35
  • 80.59 (n)
wdr92 35
  • 2 (a)
ManyToMany
nrarpa 34
fruit fly
(Drosophila melanogaster)
Insecta CanB 36
  • 85 (a)
CanB2 36 34
  • 72.16 (n)
CG14353 35
  • 1 (a)
OneToMany
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP004298 34
  • 70.59 (n)
worm
(Caenorhabditis elegans)
Secernentea cnb-1 34
  • 68.04 (n)
K. lactis yeast
(Kluyveromyces lactis)
Saccharomycetes KLLA0D02992g 34
  • 64.3 (n)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes CNB1 34
  • 58.76 (n)
A. gosspyii yeast
(Ashbya gossypii)
Saccharomycetes AGOS_AER096C 34
  • 58.13 (n)
thale cress
(Arabidopsis thaliana)
eudicotyledons AT3G18430 34
  • 46.1 (n)
rice
(Oryza sativa)
Liliopsida Os08g0442300 34
  • 47.15 (n)
fission yeast
(Schizosaccharomyces pombe)
Schizosaccharomycetes SPCC830.06 34
  • 59.02 (n)
bread mold
(Neurospora crassa)
Ascomycetes NCU03833 34
  • 58.45 (n)
sea squirt
(Ciona savignyi)
Ascidiacea -- 35
  • 3 (a)
OneToMany
sea squirt
(Ciona intestinalis)
Ascidiacea Cin.14820 34
Species where no ortholog for PPP3R1 was found in the sources mined by GeneCards:
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for PPP3R1 Gene

ENSEMBL:
Gene Tree for PPP3R1 (if available)
TreeFam:
Gene Tree for PPP3R1 (if available)

Paralogs for PPP3R1 Gene

Paralogs for PPP3R1 Gene

genes like me logo Genes that share paralogs with PPP3R1: view

Variants for PPP3R1 Gene

Sequence variations from dbSNP and Humsavar for PPP3R1 Gene

SNP ID Clin Chr 02 pos Sequence Context AA Info Type
rs3039851 untested 68,218,182(+) TGCTA(-/TTAAT)TTAAG intron-variant
rs72174030 untested 68,252,586(+) GCGGG(-/GGCGGAGGCGGGGGCGCGCGCGGGCCGGC)GCGGG intron-variant, upstream-variant-2KB
rs10170016 -- 68,188,470(+) ACAAA(C/G/T)AGGTT intron-variant
rs10180892 -- 68,216,470(+) AAAAT(A/T)AAAAA intron-variant
rs10191352 -- 68,191,736(+) AAAAG(A/T)TCATA intron-variant

Structural Variations from Database of Genomic Variants (DGV) for PPP3R1 Gene

Variant ID Type Subtype PubMed ID
nsv1072948 CNV deletion 25765185
nsv1126551 CNV deletion 24896259
nsv834251 CNV loss 17160897
nsv953138 CNV duplication 24416366

Variation tolerance for PPP3R1 Gene

Residual Variation Intolerance Score: 55.3% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for PPP3R1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
PPP3R1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for PPP3R1 Gene

Disorders for PPP3R1 Gene

MalaCards: The human disease database

(8) MalaCards diseases for PPP3R1 Gene - From: DISEASES

Disorder Aliases PubMed IDs
calcaneonavicular coalition
  • multiple synostosis syndrome
extracranial neuroblastoma
cervical neuroblastoma
ascaridiasis
  • ascariasis
pre-malignant neoplasm
- elite association - COSMIC cancer census association via MalaCards

Relevant External Links for PPP3R1

Genetic Association Database (GAD)
PPP3R1
Human Genome Epidemiology (HuGE) Navigator
PPP3R1
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
PPP3R1
genes like me logo Genes that share disorders with PPP3R1: view

No data available for UniProtKB/Swiss-Prot and Genatlas for PPP3R1 Gene

Publications for PPP3R1 Gene

  1. Identification of a novel 5-base pair deletion in calcineurin B (PPP3R1) promoter region and its association with left ventricular hypertrophy. (PMID: 16209992) Tang W. … Ferrell R.E. (Am. Heart J. 2005) 3 22 46 64
  2. Isolation and sequence of a cDNA clone for human calcineurin B, the Ca2+-binding subunit of the Ca2+/calmodulin-stimulated protein phosphatase. (PMID: 2558868) Guerini D. … Klee C.B. (DNA 1989) 2 3 4 64
  3. Variation at the NFATC2 locus increases the risk of thiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipril and rosiglitazone Medication (DREAM) study. (PMID: 20628086) Bailey S.D. … Anand S. (Diabetes Care 2010) 3 46 64
  4. SNPs associated with cerebrospinal fluid phospho-tau levels influence rate of decline in Alzheimer's disease. (PMID: 20862329) Cruchaga C. … Goate A.M. (PLoS Genet. 2010) 3 46 64
  5. Pharmacogenetics of antipsychotic response in the CATIE trial: a candidate gene analysis. (PMID: 19156168) Need A.C. … Goldstein D.B. (Eur. J. Hum. Genet. 2009) 3 46 64

Products for PPP3R1 Gene

Sources for PPP3R1 Gene

Content
Loading form....