Home
GeneCards Guide
Suite
- MalaCards
- GeneALaCart
- GeneDecks
- GeneIP
- GeneLoc
Terms and Conditions
- Terms of Use
- 3rd Party Notice
About Us
User Feedback
Mirror sites

Set Analyses:

Generates a file of GeneCards annotations for your list of genes

Advanced Search

Search By

Section (entire)

for

All GeneCards Within gene subset (to enable gene prioritization):
or upload a file of gene symbols

Category Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21

GIFtS
-

POU6F1 Gene

protein-coding GIFtS: 54
GCID: GC12M051580

POU class 6 homeobox 1

(Previous names: POU domain, class 6, transcription factor 1 )

Explore 2 diseases affiliated with
POU6F1 via

MalaCards

our new
Human Malady Compendium

(According to ¹HGNC, ²Entrez Gene,
³UniProtKB/Swiss-Prot, ⁴UniProtKB/TrEMBL, ⁵OMIM, ⁶GeneLoc, ⁷Ensembl, ⁸DME, ⁹miRBase, and/or ¹⁰fRNAdb)
About This Section

This gene clusters with an RNA gene
Subcategory (RNA class): lncRNA

Quality score for the ORGUL clustered with this gene is 3

Aliases
POU Class 6 Homeobox 1¹ ²		MPOU Homeobox Protein² ³
BRN5¹ ² ³		Brain-5³
MPOU¹ ² ³		Brn-5³
TCFB1¹ ² ³		Brain-5³
POU Domain, Class 6, Transcription Factor 1¹ ²		Brn-5³
Brain-Specific Homeobox/POU Domain Protein 5² ³

External Ids:	HGNC: 9224¹	Entrez Gene: 5463²	Ensembl: ENSG00000184271⁷	UniProtKB: Q14863³

ORGUL members:
	NONCODE:n407436

Export aliases for POU6F1 gene to outside databases

Previous GC identifers: GC12U990075 GC12M051299 GC12M049869 GC12M048613

(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

UniProtKB/Swiss-Prot: PO6F1_HUMAN, Q14863

Function: Transcription factor that binds preferentially to a variant of the octamer motif (5'-ATGATAAT-3') (By

similarity)

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section

RefSeq DNA sequence:

NC_000012.11 NC_018923.1 NT_029419.12

Regulatory elements:

SABiosciences Regulatory transcription factor binding sites in the POU6F1 gene promoter:
E2F-4 E2F-3a E2F-5 Nkx2-5 E2F-2 CREB E2F E2F-1 deltaCREB c-Myb
Other transcription factors

SwitchGear Promoter luciferase reporter plasmids (see all 2): POU6F1 promoter sequence

Search SABiosciences Chromatin IP Primers for POU6F1

Epigenetics:

QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat POU6F1

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 12q13.13 Ensembl cytogenetic band: 12q13.13 HGNC cytogenetic band: 12q13.13

POU6F1 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
POU6F1 gene location

GeneLoc information about chromosome 12 GeneLoc Exon Structure

GeneLoc location for GC12M051580: view genomic region (about GC identifiers)

Start:	51,580,719 bp from pter	End:	51,611,477 bp from pter
Size:	30,759 bases	Orientation:	minus strand

(According to ¹UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to ²PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: PO6F1_HUMAN, Q14863 (See protein sequence)

Recommended Name: POU domain, class 6, transcription factor 1

Size: 301 amino acids; 32645 Da

Subcellular location: Nucleus

1 PDB 3D structure from and Proteopedia for POU6F1:

3D1N (3D)

Secondary accessions: Q15944 Q6DK47 Q7Z7P6

Explore the universe of human proteins at neXtProt for POU6F1: NX_Q14863

Post-translational modifications:

View modification sites using PhosphoSitePlus²

View neXtProt modification sites for NX_Q14863

POU6F1 Protein expression data from MOPED and PaxDb: About this image

REFSEQ proteins: NP_002693.3

ENSEMBL proteins:

ENSP00000373895 ENSP00000330190 ENSP00000448389 ENSP00000448266

Human Recombinant Protein Products:

	Browse Purified and Recombinant Proteins at EMD Millipore
	Browse R&D Systems for human recombinant proteins
	Browse recombinant and purified proteins available from Enzo Life Sciences
	OriGene Purified Protein: POU6F1 OriGene Protein Over-expression Lysate: POU6F1 OriGene Custom Protein Services for POU6F1
	GenScript Custom Purified and Recombinant Proteins Services for POU6F1
	Novus Biologicals POU6F1 Proteins Novus Biologicals POU6F1 Lysates
	Browse Sino Biological Recombinant Proteins
	Browse ProSpec Recombinant Proteins
	Uscn Proteins for POU6F1

Gene Ontology (GO): 3 cellular component terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0005634	nucleus	--	--
GO:0031965	nuclear membrane	IDA	--
GO:0043231	intracellular membrane-bounded organelle	IDA	--

POU6F1 for ontologies About GeneDecksing

POU6F1 Antibody Products:

	Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
	Browse R&D Systems for Antibodies
	Browse OriGene Antibodies OriGene Custom Antibody Services for POU6F1
	GenScript Custom Superior Antibodies Services for POU6F1
	Novus Biologicals POU6F1 Antibodies
	Search for Antibodies for POU6F1 at Abcam
	Uscn Antibodies for POU6F1
	Search ThermoFisher Antibodies for POU6F1

Assay Products for POU6F1:

	Browse Kits and Assays available from EMD Millipore
	OriGene Custom Immunoassay Development Browse OriGene Fluorogenic Cell Assay Kits
	Browse R&D Systems for biochemical assays
	GenScript Custom Assay Services for POU6F1
	Browse Enzo Life Sciences for kits & assays
	Uscn ELISAs and CLIAs for POU6F1

(According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section

POU6F1 for domains About GeneDecksing

5 InterPro domains/families:

IPR010982 Lambda_DNA-bd_dom

IPR013847 POU

IPR000327 POU_specific

IPR001356 Homeodomain

IPR009057 Homeodomain-like

Graphical View of Domain Structure for InterPro Entry Q14863

ProtoNet protein and cluster: Q14863

2 Blocks protein families:

IPB000327 POU domain

IPB013847 POU

UniProtKB/Swiss-Prot: PO6F1_HUMAN, Q14863

Similarity: Belongs to the POU transcription factor family. Class-6 subfamily

Similarity: Contains 1 homeobox DNA-binding domain

Similarity: Contains 1 POU-specific domain

(According to ¹UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or ²DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
About This Section

Function Summary:

UniProtKB/Swiss-Prot: PO6F1_HUMAN, Q14863

Function: Transcription factor that binds preferentially to a variant of the octamer motif (5'-ATGATAAT-3') (By

POU domain,class 6,transcription factor 1,mammalian homeo box backfoot,Drosophila bicoid related,expressed in Rathke

pouch,at an early stage of pituitary development and in a subset of adult anterior pituitary cells that express POMC

miRNA Products:		OriGene 3'-UTR Clone: POU6F1 Browse MicroRNA Expression Plasmids
		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat POU6F1
		8/63 QIAGEN miScript miRNA Assays for microRNAs that regulate POU6F1 (see all 63):
		hsa-miR-520e hsa-miR-302d hsa-miR-429 hsa-miR-106a hsa-miR-218-1* hsa-miR-301a hsa-miR-766 hsa-miR-764

		SwitchGear 3'UTR luciferase reporter plasmid: POU6F1 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for POU6F1 (see all 7) OriGene shRNA RFP: POU6F1 OriGene siRNA: POU6F1
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat POU6F1

Gene Editing
Products:

DNA2.0 Custom Protein Engineering Service for POU6F1

Clone Products:		Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for POU6F1 (see all 3) OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for POU6F1 OriGene custom cloning services � gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector: POU6F1 (NM_002702)
		Browse Sino Biological Human cDNA Clones
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for POU6F1
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat POU6F1

Cell Line Products:		GenScript Custom overexpressing Cell Line Services for POU6F1
		Search LifeMap BioReagents cell lines for POU6F1

In Situ Assay
Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for POU6F1

Gene Ontology (GO): 3 molecular function terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0003677	DNA binding	--	--
GO:0003700	sequence-specific DNA binding transcription factor activity	IEA	--
GO:0043565	sequence-specific DNA binding	IEA	--

POU6F1 for ontologies About GeneDecksing

1 GenomeRNAi human phenotype for POU6F1:

Increased gamma-H2AX phosphory

(Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to ¹UniProtKB, ²MINT, ³I2D, and/or ⁴STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
About This Section

Unified GeneCards pathways About this table

See pathways by source

Super-pathway

contained gene-specific pathways

Transcription factors in neurogenesis

Transcription factors in neurogenesis

1.00

Pathway sources
See GeneCards unified pathways
Show all pathways

1 EMD Millipore Pathway for POU6F1

Transcription factors in neurogenesis

POU6F1 for pathways About GeneDecksing

Interactions:

Search SABiosciences Gene Network Central^TM Interacting Genes and Proteins Networks for POU6F1

4 Interacting proteins for POU6F1 (Q14863³) via UniProtKB, MINT, STRING, and/or I2D

Interactant		Interaction Details
GeneCard	External ID(s)	Interaction Details
HOXD12	P35452³	I2D: score=1
POU4F2	Q12837³	I2D: score=1
POU6F2	P78424³	I2D: score=1
STAT3	P40763³	I2D: score=1

About this table

Gene Ontology (GO): 5 biological process terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0006351	transcription, DNA-dependent	IEA	--
GO:0006355	regulation of transcription, DNA-dependent	--	--
GO:0007420	brain development	TAS	7908264
GO:0007507	heart development	TAS	7908264
GO:0007517	muscle organ development	TAS	7908264

POU6F1 for ontologies About GeneDecksing

(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
About This Section

Browse Small Molecules at EMD Millipore

Browse drugs & compounds from Enzo Life Sciences

Browse Tocris compounds for POU6F1
Search CenterWatch for drugs/clinical trials and news about POU6F1 / PO6F1

(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
RNAi Products from EMD Millipore,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
About This Section

REFSEQ mRNAs for POU6F1 gene:

NM_002702.3

Unigene Cluster for POU6F1:

POU class 6 homeobox 1

Hs.555886 [show with all ESTs]

Unigene Representative Sequence: NR_026893

9 Ensembl transcripts including schematic representations, and UCSC links where relevant:

ENST00000389243(uc001rxy.3 uc001rxz.3 uc001rya.3) ENST00000333640

ENST00000550824 ENST00000552305 ENST00000547855 ENST00000549309 ENST00000546685

ENST00000548692 ENST00000547854

miRNA Products:		OriGene 3'-UTR Clone: POU6F1 Browse OriGene MicroRNA Expression Plasmids
		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat POU6F1
		8/63 QIAGEN miScript miRNA Assays for microRNAs that regulate POU6F1 (see all 63):
		hsa-miR-520e hsa-miR-302d hsa-miR-429 hsa-miR-106a hsa-miR-218-1* hsa-miR-301a hsa-miR-766 hsa-miR-764

		SwitchGear 3'UTR luciferase reporter plasmid: POU6F1 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for POU6F1 (see all 7) OriGene shRNA RFP: POU6F1 OriGene siRNA: POU6F1
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat POU6F1

Clone Products:		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for POU6F1 (see all 3) OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for POU6F1 OriGene custom cloning services � gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector: POU6F1 (NM_002702)
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for POU6F1
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat POU6F1

Primer Products:		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for POU6F1 Browse OriGene validated miRNA SYBR primer pairs
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat POU6F1
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat POU6F1
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat POU6F1

Additional cDNA sequence:

AL832881.1 BC051326.1 BC074765.2 BC107090.1 L14482.1 NR_026893.1 Z21966.1

11 DOTS entries:

DT.211139 DT.100019233 DT.92416809 DT.100719359 DT.121124774 DT.411233 DT.86852017 DT.100804567

DT.65284314 DT.95231668 DT.40200606

24/36 AceView cDNA sequences (see all 36):

AF268617 BV207801 BV207798 BV199669 CA503120 AU123692 AA205845 BG569724

Z21964 CD048028 CD247950 CD048171 BQ278003 BV174940 AA216545 AA196616

AA232432 CD247215 BM830060 BM857157 AW438879 CD049202 AA176079 AA216743

GeneLoc Exon Structure

5/6 Alternative Splicing Database (ASD) splice patterns (SP) for POU6F1 (see all 6) About this scheme

ExUns:	1	^	2	^	3	^	4	^	5a	·	5b	^	6a	·	6b	·	6c	^	7a	·	7b	^	8	^	9a	·	9b	^	10	^	11a	·	11b
SP1:													-						-
SP2:																			-
SP3:
SP4:			-										-
SP5:							-

ECgene alternative splicing isoforms for POU6F1

(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

POU6F1 expression in normal human tissues (normalized intensities)
See probesets specificity/sensitivity at GeneAnnot
About this imageBioGPS
CGAP TAG: TTGGAAGGAA

About this image

POU6F1 expression in embryonic tissues and stem cells

Expression by the Database of Embryonic development, Stem cell research, and Regenerative medicine About this table

2 LifeMap In Vivo Development Anatomical Compartments/Cells

Tissue

Anatomical Compartment

Cell

Category (developmental path)

Neural Tube

Spinal Neural Tube Cells

Neural Ectoderm

Spinal Cord

Presumptive Spinal Cord

Spinal Cord

Expression:

Positive

Negative

Selective marker

Experimental details:

Curated

Microarrays

In-situ hybridization

See POU6F1 Protein Expression from SPIRE MOPED and PaxDB
Genevestigator expression for POU6F1

SOURCE GeneReport for Unigene cluster: Hs.555886

UniProtKB/Swiss-Prot: PO6F1_HUMAN, Q14863

Tissue specificity: In the embryo, expressed exclusively in the developing brain, whereas in the adult its expression

is restricted to brain, heart, skeletal muscle and lung. In the brain, the highest expression levels are found in

specific cell layers of the cortex, the olfactory bulb, the hippocampus and the cerebellum

SABiosciences Custom PCR Arrays for POU6F1

Primer Products:		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for POU6F1 Browse OriGene validated miRNA SYBR primer pairs
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat POU6F1
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat POU6F1
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat POU6F1

In Situ
Assay Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for POU6F1

(Orthologs according to ^1,2HomoloGene (²older version, for species not in ¹newer version), ³euGenes, ⁴SGD , ⁵MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or ⁶Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section

This gene was present in the common ancestor of chordates.

Orthologs for POU6F1 gene from 3/12 species (see all 12) About this table

Organism	Taxonomic classification	Gene	Description	Human Similarity	Orthology Type	Details
lizard (Anolis carolinensis)	Reptilia	POU6F1⁶	--	37(a)	1 ↔ 1	2(67513364-67531505)
tropical clawed frog (Xenopus tropicalis)	Amphibia	Str.13006²	Transcribed sequence with strong similarity to protein more	80(n)		BX724095.1
zebrafish (Danio rerio)	Actinopterygii	pouc²	POU domain gene C	73.53(n)		30334 NM_131113.1

ENSEMBL Gene Tree for POU6F1 (if available)
TreeFam Gene Tree for POU6F1 (if available)

(Paralogs according to ¹HomoloGene,
²Ensembl, and ³SIMAP, Pseudogenes according to ⁴Pseudogene.org Build 68)
About This Section

Paralogs for POU6F1 gene

POU5F2² POU6F2² POU4F2² POU2F3² POU3F4² POU3F1² POU1F1² POU4F3²

POU3F3² POU3F2² POU2F2² POU5F1B² POU2F1² POU4F1² POU5F1²

18/82 SIMAP similar genes for POU6F1 using alignment to 3 protein entries: PO6F1_HUMAN (see all proteins) (see all similar genes):

POU6F2 POU4F3 POU3F2 OCT6 POU3F1 OCT-2

POU2F3 POU3F3 POU4F2 POU1F1 POU4F1 POU5F1B

POU5F1P4 POU2F1 POU3F4 LHX9 EN2 GSC

POU6F1 for paralogs About GeneDecksing

(SNPs/Variants according to the ¹NCBI SNP Database, ²Ensembl, ³PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
About This Section

SNP ID	Valid	Clinical significance	Chr 12 pos	Sequence	#	AA Chg	Type	More	#	Allele freq	Pop	Total sample	More
Genomic Data					Transcription Related Data				Allele Frequencies
				--	--	--		--	--
rs10783418^1,2	C,F,A,H,	--	51580219(+)	`GCTCTT/CATCAG`	2	--	ds500¹		23		NS EA NA WA CSA	2342
rs143026884^1,2		--	51580225(+)	`ATCAGA/GCATCG`	2	--	ds500¹		0	--	--	--	--
rs191341526^1,2		--	51580308(+)	`AGGCAC/TTGAGT`	2	--	ds500¹		0	--	--	--	--
rs116535830^1,2	F,	--	51580459(+)	`CTAGGT/CATAAG`	2	--	ds500¹		1		WA	118
rs182633014^1,2		--	51580468(+)	`AGAAGC/GGTGTT`	2	--	ds500¹		0	--	--	--	--
rs148195260^1,2		--	51580618(+)	`TTTTCC/TAGGCT`	2	--	ds500¹		0	--	--	--	--
rs11169752^1,2	C,F,A,H,	--	51580707(+)	`GGAAAC/AAAGCA`	2	--	ds500¹		19		NS EA NA CSA WA	2344
rs141188998^1,2		--	51580732(+)	`AAAAAA/TTACTG`	2	--	nc-transcript-variantut3¹		0	--	--	--	--
rs76928355^1,2	F,	--	51580947(+)	`AACTCG/ATGTGT`	2	--	nc-transcript-variantut3¹		1		WA	118
rs1607^1,2	H	--	51580948(+)	`ACTCGT/CGTGTT`	2	--	ut3¹ nc-transcript-variant		5		MN NS EA	604
rs11738^1,2	C,F,A,H,	--	51581007(+)	`ATGCCA/GTGGTA`	2	--	ut3¹ nc-transcript-variant		24		MN EA NA NS CSA	2708
rs79809537^1,2	F,	--	51581098(+)	`ACACAG/ATTAAA`	2	--	ut3¹ nc-transcript-variant		1		EA	120
rs115353814^1,2	F,	--	51581184(+)	`CAAAAC/TAAAAT`	2	--	ut3¹ nc-transcript-variant		2		WA NA	238
rs116037696^1,2	F,	--	51581201(+)	`CAACTC/TCTTCA`	2	--	nc-transcript-variantut3¹		1		WA	118
rs11169753^1,2	C,F,H,	--	51581245(+)	`ACCTCC/TTAGGT`	2	--	ut3¹ nc-transcript-variant		5		NS WA CSA	338
rs78392974^1,2	F,	--	51581389(+)	`CTGCAA/CACCTC`	2	--	ut3¹ nc-transcript-variant		1		WA	118
rs188891651^1,2		--	51581396(+)	`CCTCCC/TACCCC`	2	--	ut3¹ nc-transcript-variant		0	--	--	--	--
rs146961609^1,2		--	51581546(+)	`CATGAC/TTGTTT`	2	--	nc-transcript-variantut3¹		0	--	--	--	--
rs11169754^1,2	C,F,A,H,	--	51581565(+)	`TGACAC/TAGGAC`	2	--	nc-transcript-variantut3¹		11		NS EA NA	848
rs76213841^1,2		--	51581713(+)	`TGCATC/TGCCAT`	2	--	ut3¹ nc-transcript-variant		0	--	--	--	--
rs10876151^1,2	C,F,A,	--	51581740(+)	`GAGACC/AGAGTC`	2	--	nc-transcript-variantut3¹		8		NA WA CSA	250
rs143971014^1,2		--	51581858(+)	`GATGTA/GCACTA`	2	--	ut3¹ nc-transcript-variant		0	--	--	--	--
rs200488247^1,2	C,	--	51581900(+)	`GAGAC-/GGGGTTT`	2	--	nc-transcript-variantut3¹		0	--	--	--	--
rs193099734^1,2		--	51581963(+)	`ACCTCA/GGCCTT`	2	--	ut3¹ nc-transcript-variant		0	--	--	--	--
rs150676262^1,2		--	51581977(+)	`AAGTGC/TTGGAA`	2	--	nc-transcript-variantut3¹		0	--	--	--	--
rs185869567^1,2		--	51581991(+)	`CAGGCA/GTAAGC`	2	--	nc-transcript-variantut3¹		0	--	--	--	--
rs138938883^1,2		--	51582000(+)	`GCCAAG/TGTGCC`	2	--	ut3¹ nc-transcript-variant		0	--	--	--	--
rs111665877^1,2	F,	--	51582048(+)	`TACAAG/ACTCTG`	2	--	ut3¹ nc-transcript-variant		1		NA	120
rs117061312^1,2	F,	--	51582086(+)	`GTTTGC/AAACAC`	2	--	ut3¹ nc-transcript-variant		1		EA	120
rs10747605^1,2	C,F,A,H,	--	51582188(+)	`AAAGCC/TGGGTC`	2	--	nc-transcript-variantut3¹		16		NS EA NA WA CSA	792
rs116607284^1,2		--	51582189(+)	`AAGCTG/AGGTCA`	2	--	ut3¹ nc-transcript-variant		1		WA	118
rs188895029^1,2		--	51582263(+)	`CAGCAC/GAGCGT`	2	--	nc-transcript-variantut3¹		0	--	--	--	--
rs115367412^1,2		--	51582266(+)	`CAGAGC/TGTGTA`	2	--	nc-transcript-variantut3¹		0	--	--	--	--
rs142673259^1,2		--	51582272(+)	`GTGTA-/TGTGTGT`	2	--	ut3¹ nc-transcript-variant		0	--	--	--	--
rs113804849^1,2	C,F,	--	51582286(+)	`GTGTGC/TGCGCG`	2	--	ut3¹ nc-transcript-variant		1		WA	118
rs149443201^1,2		--	51582290(+)	`GCGCGC/TGTCTG`	2	--	nc-transcript-variantut3¹		0	--	--	--	--
rs77962777^1,2	F,	--	51582300(+)	`GTGCGC/TGCTGC`	2	--	nc-transcript-variantut3¹		1		WA	118
rs144653185^1,2		--	51582311(+)	`ACGTGC/TGTGTG`	2	--	ut3¹ nc-transcript-variant		0	--	--	--	--
rs59898968^1,2	C,F,	--	51582382(+)	`TGGCAC/TTGCAG`	2	--	nc-transcript-variantut3¹		3		WA CSA	122
rs148510381^1,2		--	51582412(+)	`GTAAGC/TGGGAA`	2	--	ut3¹ nc-transcript-variant		0	--	--	--	--
rs144254019^1,2		--	51582424(+)	`GGAAAC/GAGGAC`	2	--	ut3¹ nc-transcript-variant		0	--	--	--	--
rs192230011^1,2		--	51582512(+)	`CTTCCC/TTCAGG`	2	--	ut3¹ nc-transcript-variant		0	--	--	--	--
rs146097557^1,2		--	51582597(+)	`GGTGGC/TTGACC`	2	--	ut3¹ nc-transcript-variant		0	--	--	--	--
rs140091371^1,2		--	51582766(+)	`GCTAAC/TCCCCA`	2	--	nc-transcript-variantut3¹		0	--	--	--	--
rs144087815^1,2		--	51582852(+)	`GGGATG/TGCTTA`	2	--	ut3¹ nc-transcript-variant		0	--	--	--	--
rs150996598^1,2		--	51582881(+)	`GACTCA/GACAAA`	2	--	ut3¹ nc-transcript-variant		0	--	--	--	--
rs140859029^1,2		--	51583183(+)	`ACCCAA/CGTTTT`	2	--	ut3¹ nc-transcript-variant		0	--	--	--	--
rs183891028^1,2		--	51583239(+)	`AAGAAC/TAGCCT`	2	--	ut3¹ nc-transcript-variant		0	--	--	--	--
rs149748726^1,2		--	51583363(+)	`TCCCCA/GCAAAG`	2	--	ut3¹ nc-transcript-variant		0	--	--	--	--
rs73305801^1,2	C,F,	--	51583369(+)	`CAAAGG/CAACCA`	2	--	ut3¹ nc-transcript-variant		3		WA	122
rs145443725^1,2		--	51583416(+)	`CAGGGA/GTTTGG`	2	--	nc-transcript-variantut3¹		0	--	--	--	--
rs1126905^1,2	C,F,	--	51583441(-)	`CCTTGA/GCNNNN`	2	--	ut3¹ nc-transcript-variantese³		6		NA	130
rs3490^1,2	C,F,A,H,	--	51583506(-)	`AGGACC/TTGGGA`	2	--	nc-transcript-variantut3¹		26		MN EA NA NS CSA WA	2754
rs188621755^1,2		--	51583514(+)	`CCTTTC/TGGTGC`	2	--	nc-transcript-variantut3¹		0	--	--	--	--
rs12321105^1,2	C,F,H,	--	51583738(+)	`TCACCC/ATTCAG`	2	--	nc-transcript-variantut3¹ ese³		11		NS EA NA CSA WA	1312
rs141150055^1,2		--	51583776(+)	`AGTGAC/TGTCAC`	2	--	nc-transcript-variantut3¹		0	--	--	--	--
rs146938447^1,2		--	51583795(+)	`TTCTTC/TGGAGT`	2	--	ut3¹ nc-transcript-variant		0	--	--	--	--
rs115051055^1,2		--	51583883(+)	`GACATT/CGATGC`	2	--	ut3¹ nc-transcript-variant		1		WA	118
rs201594593^1,2		--	51583982(+)	`GGATGC/TCACGG`	2	--	ut3¹ nc-transcript-variant		0	--	--	--	--
rs137997442^1,2		--	51584009(+)	`TAGAAC/GACAGG`	2	--	ut3¹ nc-transcript-variant		0	--	--	--	--
rs180748178^1,2	C,	--	51584048(+)	`AAGACA/GTTCAG`	3	N	nc-transcript-variantsyn¹		0	--	--	--	--
rs2228250^1,2	C,F,H,	--	51584147(-)	`CAGGAG/AATCAC`	3	/E	nc-transcript-variantsyn¹ ese³		10		MN NS EA NA	5398
rs186003252^1,2	C,	--	51584187(+)	`AGGCAC/TTGAGA`	3	N S	mis¹		0	--	--	--	--
rs190452607^1,2	C,	--	51584296(+)	`CCGCAC/GTTCAG`	3	L V	nc-transcript-variantmis¹		0	--	--	--	--
rs139547928^1,2	F	--	51584306(+)	`GCTTCG/ATTTAG`	3	/N	nc-transcript-variantsyn¹		1		NA	4552
rs182103469^1,2		--	51584578(+)	`TGCCCA/GGTCCT`	2	--	int¹		0	--	--	--	--
rs12423352^1,2	C,F,A,H,	--	51584597(+)	`AACCAT/CTCCCA`	2	--	int¹		21		NS EA NA WA	2760
rs143339630^1,2		--	51584604(+)	`CCCACA/GGCCTC`	2	--	int¹		0	--	--	--	--
rs148351378^1,2		--	51584609(+)	`GGCCTC/GGGCTC`	2	--	int¹		0	--	--	--	--
rs10718259^1,2	C,	--	51584693(+)	`AGTCC-/TTTTGA`	2	--	int¹		1		CSA	4
rs201043114^1,2	C	--	51584693(+)	`AGTCCC/TTNNNN`	2	--	int¹		0	--	--	--	--
rs141554143^1,2		--	51584880(+)	`CATCCC/TTGAGC`	2	--	int¹		0	--	--	--	--
rs150908852^1,2		--	51584890(+)	`CCATGC/TGCTTA`	2	--	int¹		0	--	--	--	--
rs76568254^1,2	F,	--	51584891(+)	`CATGCG/ACTTAT`	2	--	int¹		1		NA	120
rs61932889^1,2		--	51584913(+)	`ACTCTA/GTCCCT`	2	--	int¹		3		NA EA	242
rs7484430^1,2	H	--	51584992(+)	`TGTTAG/AAGGGG`	2	--	int¹ trp³		4		NS EA	414
rs138186011^1,2		--	51585043(+)	`GCCAAC/TATAGA`	2	--	int¹		0	--	--	--	--
rs11608364^1,2	C,F,H,	--	51585055(+)	`TGGAAG/ATTCCC`	2	--	int¹		26		NS EA NA WA	3124
rs116573023^1,2	F,	--	51585062(+)	`TCCCAC/TTTTGG`	2	--	int¹		1		WA	118
rs140721358^1,2	C,	--	51585179(+)	`ATCTT-/CAGAGG`	2	--	int¹		0	--	--	--	--
rs10876152^1,2	C,F,A,H,	--	51585191(+)	`CCTCAG/CAAGGA`	2	--	int¹		13		NS EA NA	1028
rs7487157^1,2	C,F,A,H,	--	51585304(+)	`GGTGCT/CCAGGT`	2	--	int¹		20		NA NS EA WA CSA	916
rs10783419^1,2	C,F,A,H,	--	51585335(+)	`ACCAGG/ACAGCT`	2	--	int¹		29		NS EA NA WA CSA EU	3325
rs147563855^1,2		--	51585398(+)	`TGGCT-/GGTAGG`	3	YS YQP	nc-transcript-variantfra¹		0	--	--	--	--
rs150600315^1,2	C,F	--	51585471(+)	`CGCCGG/TATCTT`	3	I	syn¹		2		NA EU	5733
rs139626786^1,2	F	--	51585526(+)	`CCTCAT/CCCAGA`	3	/D /G	mis¹		1		NA	4548
rs10735831^1,2	C,F,A,H,	--	51585599(+)	`ATCCCT/GGCTTA`	2	--	int¹		12		NS EA NA WA CSA	638
rs10747606^1,2	C,F,A,H,	--	51585601(+)	`CCCTGC/TTTATC`	2	--	int¹		8		NA WA EA	372
rs142738809^1,2		--	51585628(+)	`ACTGAC/TGCAGT`	2	--	int¹		0	--	--	--	--
rs117145981^1,2	F,	--	51585629(+)	`CTGACG/ACAGTA`	2	--	int¹		1		NA	120
rs186569127^1,2		--	51585634(+)	`GCAGTA/GGTGAG`	2	--	int¹		0	--	--	--	--
rs117623337^1,2		--	51585638(+)	`TAGTGA/CGAGGT`	2	--	int¹		1		NA	120
rs146070725^1,2		--	51585740(+)	`TCTCCA/GGGGGT`	2	--	int¹		0	--	--	--	--
rs10747607^1,2	C,F,A,H,	--	51585869(+)	`ATAGCG/AGAGAC`	2	--	int¹		24		NS EA NA WA CSA	2352
rs11276817^1,2	C,	--	51585884(+)	`CATGG-/CTC GGCCTCTCCA`	2	--	int¹		0	--	--	--	--
rs190575624^1,2		--	51585979(+)	`AAAAGC/GCAGCC`	2	--	int¹		0	--	--	--	--
rs183136469^1,2		--	51586040(+)	`AAGCAC/GCATCT`	2	--	int¹		0	--	--	--	--
rs7136904^1,2	C,F,	--	51586138(+)	`GTGGGG/AGTCTC`	3	/T	nc-transcript-variantsyn¹ ese³		2		NS NA	4630
rs139629485^1,2	C,	--	51586185(+)	`CTTGGC/TGGCTG`	3	T A	nc-transcript-variantmis¹		1		NA	4552
rs145166430^1,2	F	--	51586186(+)	`TTGGCG/AGCTGG`	3	/A	syn¹		1		NA	4552
rs140076700^1,2		--	51586419(+)	`ATGGTA/GGCTGA`	2	--	int¹		0	--	--	--	--
rs142045477^1,2		--	51586458(+)	`CAAGGC/TGGGAG`	2	--	int¹		0	--	--	--	--
rs9668643^1,2	C,F,	--	51586490(+)	`TGATAT/CCAGCC`	2	--	int¹		5		NA WA EA	362
rs191220644^1,2		--	51586520(+)	`CTGTCC/TCTACT`	2	--	int¹		0	--	--	--	--
rs143999312^1,2		--	51586524(+)	`CTCTAC/TTAAAA`	2	--	int¹		0	--	--	--	--
rs182612130^1,2		--	51586545(+)	`TAGCTA/GGGCAT`	2	--	int¹		0	--	--	--	--
rs148669155^1,2		--	51586557(+)	`GTGGTA/GGGTGC`	2	--	int¹		0	--	--	--	--
rs57937070^1,2		--	51586604(+)	`AATTGC/TTTGAA`	2	--	int¹		0	--	--	--	--
rs187582496^1,2		--	51586642(+)	`AAGATC/TGCGCC`	2	--	int¹		0	--	--	--	--
rs151216353^1,2		--	51586649(+)	`CGCCAC/TTGCAC`	2	--	int¹		0	--	--	--	--
rs192792099^1,2		--	51586682(+)	`GACTCC/TGTCTC`	2	--	int¹		0	--	--	--	--
rs139803827^1,2		--	51586683(+)	`ACTCCA/GTCTCA`	2	--	int¹		0	--	--	--	--
rs183802085^1,2		--	51586997(+)	`ATCTCC/TCTACC`	2	--	int¹		0	--	--	--	--
rs145018372^1,2		--	51587097(+)	`CGGGCA/GCGGTG`	2	--	int¹		0	--	--	--	--
rs187855078^1,2		--	51587108(+)	`GCTCAC/TGCACT`	2	--	int¹		0	--	--	--	--
rs191960149^1,2		--	51587127(+)	`CCAAAA/GGGGGC`	2	--	int¹		0	--	--	--	--
rs147574426^1,2		--	51587281(+)	`TTGAAC/TACGGG`	2	--	int¹		0	--	--	--	--
rs57515945^1,2	C,	--	51587283(+)	`GAACAC/TGGGAG`	2	--	int¹		1		WA	2
rs6580805^1,2	C,H,	--	51587295(+)	`CAGAGG/ATTGCA`	2	--	int¹		10		NA WA CSA	143
rs150116609^1,2		--	51587303(+)	`GCAGTA/GAGCCG`	2	--	int¹		0	--	--	--	--
rs184398742^1,2		--	51587307(+)	`TAAGCC/TGAGAG`	2	--	int¹		0	--	--	--	--
rs114844969^1,2	F,	--	51587380(+)	`AATTTA/TAAAAA`	2	--	int¹		1		WA	118
rs145795413^1,2		--	51587394(+)	`GAAAAC/TCAGTT`	2	--	int¹		0	--	--	--	--
rs188399577^1,2		--	51587428(+)	`AATACA/GTATGA`	2	--	int¹		0	--	--	--	--
rs192718028^1,2		--	51587522(+)	`CTTTTC/TACATT`	2	--	int¹		0	--	--	--	--
rs185079914^1,2		--	51587589(+)	`ACTATA/GAATAT`	2	--	int¹		0	--	--	--	--
rs11169756^1,2	A	--	51587868(+)	`GCAGTA/GGCATG`	2	--	int¹		0	--	--	--	--
rs11169757^1,2	C,A,	--	51587872(+)	`TAGCAC/TGATCT`	2	--	int¹		5		NA WA CSA	10
rs143777612^1,2		--	51587878(+)	`GATCTC/GGGCTC`	2	--	int¹		0	--	--	--	--
rs189138998^1,2		--	51588098(+)	`AGCCAC/TTGTGC`	2	--	int¹		0	--	--	--	--
rs12819854^1,2	C,F,	--	51588167(+)	`GCCTGG/TAATAC`	2	--	int¹		6		NA WA CSA	12
rs143100243^1,2		--	51588290(+)	`GTGGTA/GGTGCA`	2	--	int¹		0	--	--	--	--
rs58959803^1,2		--	51588315(+)	`GCTACC/TGGGGA`	2	--	int¹		0	--	--	--	--
rs12818718^1,2	C,F,A,	--	51588372(+)	`GAGCCA/GAGGTC`	2	--	int¹		11		NA WA CSA EA	257
rs181034037^1,2		--	51588378(+)	`AGGTCA/GCATCA`	2	--	int¹		0	--	--	--	--
rs186369047^1,2		--	51588418(+)	`ACCCTC/GGTCTC`	2	--	int¹		0	--	--	--	--
rs11169758^1,2	C,F,A,	--	51588441(+)	`AAAAAG/AGCTCA`	2	--	int¹ trp³		5		WA NA	12
rs138818621^1,2		--	51588494(+)	`GTTCCC/TTACTA`	2	--	int¹		0	--	--	--	--
rs10876153^1,2	C,F,A,H,	--	51588509(+)	`ACCTGT/ATAATG`	2	--	int¹		16		NS EA NA WA CSA	795
rs73307705^1,2	C,	--	51588554(+)	`CTTTCT/CGTGCG`	2	--	int¹		2		WA	120
rs111415094^1,2	C,	--	51588616(+)	`GAAGTT/CGNNNN`	2	--	int¹		3		CSA WA NA	240
rs12422846^1,2	C,F,H,	--	51588677(+)	`GGAAGT/CGCATG`	2	--	int¹		4		NA WA EA	362
rs141451730^1,2		--	51588739(+)	`AACTCC/TTGGAC`	2	--	int¹		0	--	--	--	--
rs7297398^1,2	C,	--	51588844(+)	`agaacT/CgctgC`	2	--	int¹		2		CSA WA	120
rs150857749^1,2		--	51588939(+)	`TCTTGC/TTATGT`	2	--	int¹		0	--	--	--	--
rs139321464^1,2		--	51588997(+)	`ACTGCA/GGCCTT`	2	--	int¹		0	--	--	--	--
rs149293632^1,2		--	51589009(+)	`AACTCC/TTGGCC`	2	--	int¹		0	--	--	--	--
rs12427003^1,2	C,H,	--	51589020(+)	`TCAAGC/TGATCC`	2	--	int¹		4		NA WA EA	362
rs147415960^1,2		--	51589035(+)	`CCTTAA/GCCTCC`	2	--	int¹		0	--	--	--	--
rs67531434^1,2	C,	--	51589294(+)	`GGAAT-/AATAGT`	2	--	int¹		2		NA CSA	4
rs181466431^1,2		--	51589338(+)	`GAGTAA/TATCAA`	2	--	int¹		0	--	--	--	--
rs186104546^1,2		--	51589349(+)	`AGCCAC/TGGTGC`	2	--	int¹		0	--	--	--	--
rs139765729^1,2		--	51589403(+)	`CAGAAA/CTGACT`	2	--	int¹		0	--	--	--	--
rs145298063^1,2		--	51589468(+)	`ACTTTA/GACCAT`	2	--	int¹		0	--	--	--	--
rs192068721^1,2		--	51589552(+)	`GTAGGA/GGGTCT`	2	--	int¹		0	--	--	--	--
rs147551365^1,2		--	51589559(+)	`GTCTCA/GTGGTG`	2	--	int¹		0	--	--	--	--
rs57821022^1,2	C,F,	--	51589663(+)	`TCAGAA/CGATGC`	2	--	int¹		2		NA EA	240
rs115816377^1,2		--	51589679(+)	`TGCCTG/AGCAGT`	2	--	int¹		1		WA	118
rs199722515^1,2		--	51589736(+)	`CCACCA/CCCCCC`	2	--	int¹		0	--	--	--	--
rs201399148^1,2		--	51589791(+)	`CTTCCA/GGACAG`	3	R W	nc-transcript-variantmis¹		0	--	--	--	--
rs147582637^1,2	C	--	51589851(+)	`CTGGGC/TGTTCA`	3	T A	nc-transcript-variantmis¹		1		NA	4284
rs181238666^1,2	C,	--	51589915(+)	`GCCGCA/CACACT`	3	V	nc-transcript-variantsyn¹		0	--	--	--	--
rs113285296^1,2	F	--	51589996(+)	`GGGTAG/TCATCC`	2	--	int¹		2		CSA	4
rs74961315^1,2	C,F,	--	51590188(+)	`AGAGAC/TCTGCC`	2	--	int¹		1		EA	120
rs59245765^1,2		--	51590278(+)	`CTCCAT/ACTAAT`	2	--	int¹		3		CSA WA	121
rs140312758^1,2		--	51590299(+)	`TCCAAA/CGAAAG`	2	--	int¹		0	--	--	--	--
rs186700947^1,2		--	51590369(+)	`AAATGA/TAAACT`	2	--	int¹		0	--	--	--	--
rs142099216^1,2		--	51590479(+)	`CTTGAC/TGTCTG`	2	--	int¹		0	--	--	--	--
rs77905600^1,2	C,F,	--	51590593(+)	`CTGAGC/TATTGG`	3	T A	mis¹		1		EA	120
rs190687928^1,2	C,	--	51590606(+)	`AGGATA/CTGACT`	3	Q H	nc-transcript-variantmis¹		0	--	--	--	--
rs151163072^1,2	C,	--	51590638(+)	`AATGGC/TGCTGG`	2	--	nc-transcript-variantut5¹		1		EU	1323
rs182264458^1,2		--	51590723(+)	`TGGAGA/GAAGAG`	2	--	int¹		0	--	--	--	--
rs7398548^1,2	C,	--	51590898(+)	`CTACCG/TGCTGG`	2	--	int¹		5		NA	10
rs150453120^1,2		--	51591084(+)	`GCCACA/GGTCAT`	2	--	int¹		0	--	--	--	--
rs187586126^1,2		--	51591147(+)	`CCACAA/CTGGAG`	2	--	int¹		0	--	--	--	--
rs77488652^1,2		--	51591183(+)	`TAACGC/GCTCCC`	2	--	int¹		2		CSA WA	120
rs77725030^1,2	F,	--	51591200(+)	`AAGCCA/GGGAGC`	2	--	int¹		1		WA	118
rs190935546^1,2		--	51591231(+)	`ATAGAA/GCTGTA`	2	--	int¹		0	--	--	--	--
rs146608515^1,2		--	51591286(+)	`CAGACA/GTCATC`	2	--	int¹		0	--	--	--	--
rs141388117^1,2		--	51591301(+)	`CCTCCA/CAGCCT`	2	--	int¹		0	--	--	--	--
rs201108082^1,2		--	51591454(+)	`TTTTC-/GGGGGG`	2	--	int¹		0	--	--	--	--
rs182731987^1,2		--	51591456(+)	`TTTCGC/GGGGGG`	2	--	int¹		0	--	--	--	--
rs145172246^1,2		--	51591509(+)	`CATGAC/TTCCGT`	2	--	int¹		0	--	--	--	--
rs138799784^1,2		--	51591512(+)	`GATTCC/TGTCCA`	2	--	int¹		0	--	--	--	--
rs188372084^1,2		--	51591967(+)	`CGCACA/GCCAGC`	2	--	int¹ us2k¹		0	--	--	--	--
rs73307706^1,2		--	51592257(+)	`AGTCCA/GACATG`	2	--	us2k¹ int¹		0	--	--	--	--
rs112192043^1,2	C	--	51592332(+)	`CGTTAG/CCTTGG`	2	--	us2k¹ spd¹		1		CSA	1
rs149344808^1,2		--	51592368(+)	`CTCCCC/TCCGTA`	2	--	nc-transcript-variantus2k¹		0	--	--	--	--
rs143675379^1,2		--	51592385(+)	`GCAGCA/GGTCAG`	2	--	us2k¹ nc-transcript-variant		0	--	--	--	--
rs4076884^1,2	C,F,	--	51592761(+)	`TCCTGC/ACTTCA`	2	--	int¹ us2k¹		2		NA EA	240
rs73307707^1,2	C,F,	--	51592804(+)	`CTGCTC/TACAGG`	2	--	int¹ us2k¹		3		WA	122
rs141322268^1,2	C,	--	51592923(+)	`GGCTG-/ATGGAACCAAGTGGTC AAGGCCCCGCAGAGGCTAATGGA`	2	--	us2k¹ int¹		0	--	--	--	--
rs80221726^1,2	C	--	51592936(+)	`AAGTGC/GTCAAG`	2	--	int¹ us2k¹		0	--	--	--	--
rs148954008^1,2		--	51592970(+)	`AAGTGC/GTCAAG`	2	--	us2k¹ int¹		0	--	--	--	--
rs7398010^1,2	C,A	--	51592981(+)	`GCCCCA/GCAGAG`	2	--	int¹ us2k¹		0	--	--	--	--
rs147392111^1,2		--	51593049(+)	`CCATAC/TCCTTG`	2	--	us2k¹ int¹		0	--	--	--	--
rs35125408^1,2	F,	--	51593212(+)	`TGGAGG/AGCCGG`	2	--	us2k¹ int¹		2		NA EA	240
rs193197122^1,2		--	51593216(+)	`GGGCCA/GGCAAG`	2	--	int¹ us2k¹		0	--	--	--	--
rs184688888^1,2		--	51593232(+)	`TCATTA/CATTTA`	2	--	int¹ us2k¹		0	--	--	--	--
rs34296849^1,2	C,F,	--	51593267(+)	`GCTGCG/ATGAAA`	2	--	us2k¹ int¹		5		CSA WA NA EA	362
rs78563513^1,2	C,F,	--	51593312(+)	`AAGGAG/AATGAT`	2	--	us2k¹ int¹		1		WA	118
rs4077093^1,2	C,F,A,H,	--	51593616(-)	`CTGCCA/C/G/T CTGCC`	1	--	us2k¹		21		NS EA NA WA CSA EU	1466
rs188378003^1,2		--	51593866(+)	`GGGGAG/TCCCTG`	2	--	us2k¹ int¹		0	--	--	--	--
rs116552002^1,2	F,	--	51593945(+)	`CCCTCA/GTTTCC`	2	--	us2k¹ int¹		2		WA EA	238
rs192215246^1,2		--	51593962(+)	`TGTAAA/GGACTG`	1	--	int¹		0	--	--	--	--
rs138123189^1,2		--	51594287(+)	`TTTCCC/TGTGAC`	1	--	int¹		0	--	--	--	--
rs79886614^1,2	F,	--	51594288(+)	`TTCCCG/ATGACC`	1	--	int¹		1		WA	118
rs183828646^1,2		--	51594513(+)	`TCACCC/TATGCT`	1	--	int¹		0	--	--	--	--
rs117427833^1,2	F,	--	51594714(+)	`CAAGTG/AATGTG`	1	--	int¹		2		NA EA	240
rs116336511^1,2	C,F,	--	51594768(+)	`ACCGCG/ACCTGG`	1	--	int¹		1		WA	118
rs147224628^1,2		--	51594941(+)	`ATAACC/TGCAAA`	1	--	int¹		0	--	--	--	--
rs75231493^1,2	F,	--	51594948(+)	`CAAAGG/TTTCTG`	1	--	int¹		1		WA	118
rs139642777^1,2		--	51595050(+)	`CCAGGC/TAGTTT`	1	--	int¹		0	--	--	--	--
rs73307709^1,2	C,	--	51595068(+)	`TCAAGG/AGACAA`	1	--	int¹		1		WA	2
rs189280898^1,2		--	51595089(+)	`ACAAAA/GGCCTT`	1	--	int¹		0	--	--	--	--
rs144748884^1,2		--	51595318(+)	`GAGTT-/AAAAAA`	1	--	int¹		0	--	--	--	--
rs73106974^1,2	C,,	--	51595327(+)	`AAAAAA/CCAAAA`	1	--	int¹		0	--	--	--	--
rs11430419^1,2	C	--	51595329(+)	`AAAAAA/-TTAGC`	1	--	int¹		1		NA	2
rs149661860^1,2		--	51595432(+)	`ATGGGA/CAAGTG`	1	--	int¹		0	--	--	--	--
rs11169761^1,2	C,F,A,H,	--	51595505(+)	`ATTTAG/ATAGGA`	1	--	int¹		30		NS EA NA WA	3184
rs117097487^1,2		--	51595546(+)	`GGCTGC/TTATTG`	1	--	int¹		1		NA	120
rs71914774^1,2	C	--	51595639(+)	`TATAG-/TTGTT TTTTT`	1	--	int¹		0	--	--	--	--
rs141926877^1,2	C,	--	51595639(+)	`TATAG-/TTGTT TTTTT`	1	--	int¹		0	--	--	--	--
rs11169762^1,2	C,A,	--	51595641(+)	`TAGTTG/TTTTTT`	1	--	int¹		1		WA	2
rs67963698^1,2	C	--	51595641(+)	`TAGTT-/GTTTT TTTTT`	1	--	int¹		1		NA	2
rs202145755^1,2		--	51595643(+)	`TTGTT-/GTTTTT`	1	--	int¹		0	--	--	--	--
rs144462607^1,2		--	51595711(+)	`AATCTC/TGCCTC`	1	--	int¹		0	--	--	--	--
rs7975737^1,2	C,A,	--	51595737(+)	`TCCCAA/GGCTCA`	1	--	int¹		6		NA WA EA	246
rs148427952^1,2		--	51595855(+)	`CCCAGA/GCTGGT`	1	--	int¹		0	--	--	--	--
rs7976292^1,2	C,A,	--	51595928(+)	`CGTGAA/GCCACC`	1	--	int¹		7		NA WA	132
rs144048026^1,2		--	51595960(+)	`TTTTAC/TCATTG`	1	--	int¹		0	--	--	--	--
rs146597428^1,2		--	51596020(+)	`CTTTTC/TTTCTC`	1	--	int¹		0	--	--	--	--
rs12307209^1,2		--	51596240(+)	`gtagcC/Tgggat`	1	--	int¹		0	--	--	--	--
rs141362603^1,2		--	51596302(+)	`AAAGAC/TGGGGT`	1	--	int¹		0	--	--	--	--
rs199533751^1,2		--	51596665(+)	`ATAGT-/AAATTT`	1	--	int¹		0	--	--	--	--
rs10735832^1,2	C,F,A,H,	--	51596763(+)	`AATACT/CGCACA`	1	--	int¹		24		NS EA NA WA CSA	2348
rs76318555^1,2		--	51596873(+)	`GGAGGC/TGTTTG`	1	--	int¹		2		CSA WA	120
rs185071144^1,2		--	51596977(+)	`ATTTGA/GATAAG`	1	--	int¹		0	--	--	--	--
rs143831534^1,2		--	51597056(+)	`GCATGA/TTGAAT`	1	--	int¹		0	--	--	--	--
rs150117780^1,2	C,	--	51597080(+)	`CTCCC-/CTGTTTT`	1	--	int¹		0	--	--	--	--
rs189917429^1,2		--	51597193(+)	`TGGGAA/GCAGGT`	1	--	int¹		0	--	--	--	--
rs7397586^1,2	C,	--	51597384(+)	`GTTAAG/TGAGCT`	1	--	int¹		1		NA	2
rs182081391^1,2		--	51597388(+)	`AGGAGA/CTGTTG`	1	--	int¹		0	--	--	--	--
rs140645075^1,2		--	51597400(+)	`TTTTCA/GGAAGT`	1	--	int¹		0	--	--	--	--
rs150402136^1,2		--	51597459(+)	`CCCACA/CAGTCC`	1	--	int¹		0	--	--	--	--
rs140072843^1,2		--	51597569(+)	`GCAGA-/AGGAGATG`	1	--	int¹		0	--	--	--	--
rs138149884^1,2		--	51597615(+)	`TGAGAA/GGGTGC`	1	--	int¹		0	--	--	--	--
rs186228774^1,2		--	51597790(+)	`GAGTGG/TAGAGT`	1	--	int¹		0	--	--	--	--
rs60286120^1,2	C,F,	--	51597879(+)	`ATTCAT/CGCTGG`	1	--	int¹		4		WA CSA	124
rs12300868^1,2		--	51597899(+)	`GACCAC/TAGGAG`	1	--	int¹		0	--	--	--	--
rs2067902^1,2	C,F,A,H,	--	51597909(-)	`TGCCAG/AGTCCC`	1	--	int¹		12		NA WA CSA EA	376
rs146579586^1,2		--	51597913(+)	`CTTGGC/TACTCA`	1	--	int¹		0	--	--	--	--
rs191471978^1,2		--	51597926(+)	`TGGAGC/TAGTAC`	1	--	int¹		0	--	--	--	--
rs180709776^1,2		--	51597973(+)	`CAGAGA/GAGCCC`	1	--	nc-transcript-variant		0	--	--	--	--
rs185102508^1,2		--	51598146(+)	`ATCACA/GATGAC`	1	--	nc-transcript-variant		0	--	--	--	--
rs189905923^1,2		--	51598205(+)	`GCAGGA/GTCCAA`	1	--	int¹		0	--	--	--	--
rs183211684^1,2		--	51598431(+)	`GAGCTA/CATTTC`	1	--	int¹		0	--	--	--	--
rs7298195^1,2	C,	--	51598612(+)	`GAAACC/GATCTG`	1	--	int¹		0	--	--	--	--
rs116893960^1,2		--	51598638(+)	`TAAAGG/TGATGG`	1	--	int¹		1		EA	120
rs11613752^1,2	H	--	51598658(+)	`GCTCCA/CCAATG`	1	--	int¹		0	--	--	--	--
rs115233085^1,2		--	51598685(+)	`GCCCAT/CGATTC`	1	--	int¹		1		WA	118
rs57284238^1,2		--	51598853(+)	`GTCTCA/GCTCTG`	1	--	int¹		0	--	--	--	--
rs189196975^1,2		--	51599058(+)	`GATCTC/TGTGAT`	1	--	int¹		0	--	--	--	--
rs12579347^1,2	C,H	--	51599231(+)	`GGACCC/TTGAGC`	1	--	int¹		5		NS EA NA	420
rs11330373^1,2	C,	--	51599250(+)	`AACAC-/TTAAGT`	1	--	int¹		0	--	--	--	--
rs11338427^1,2	C,F,	--	51599252(+)	`CACTTA/-AGTCT`	1	--	int¹		3		NA CSA	6
rs56050794^1,2	C,	--	51599252(+)	`CACTTC/AAGTCT`	1	--	int¹		2		NA CSA	3
rs6580806^1,2	C,F,A,H,	--	51599339(+)	`TCAGAG/AACAAA`	1	--	int¹		24		NS EA NA WA CSA	2355
rs191497140^1,2		--	51599380(+)	`CTCTGC/TGCATT`	1	--	int¹		0	--	--	--	--
rs183760313^1,2		--	51599446(+)	`CAGTCA/GGAGGC`	1	--	int¹		0	--	--	--	--
rs187849672^1,2		--	51599497(+)	`TGAGAC/TGAGTG`	1	--	int¹		0	--	--	--	--
rs148269775^1,2		--	51599672(+)	`ATCTCA/GGCTCA`	1	--	int¹		0	--	--	--	--
rs144473993^1,2		--	51599747(+)	`ACAGGA/TGCCCA`	1	--	int¹		0	--	--	--	--
rs6580807^1,2	C,	--	51599792(+)	`GAGACG/AGGGTT`	1	--	int¹		4		NA WA	8
rs191791190^1,2		--	51599934(+)	`CGGGCA/GCGGTG`	1	--	int¹		0	--	--	--	--
rs184335981^1,2		--	51600064(+)	`TAGCCA/GGGTGT`	1	--	int¹		0	--	--	--	--
rs148961588^1,2		--	51600067(+)	`CCGGGC/TGTGGT`	1	--	int¹		0	--	--	--	--
rs116738862^1,2	C,F,	--	51600473(+)	`CCCTGG/TTAAGA`	1	--	int¹		1		WA	118
rs151280363^1,2		--	51600545(+)	`CCTTA-/CCCCCC`	1	--	int¹		0	--	--	--	--
rs191559059^1,2		--	51600721(+)	`ACAATA/TTCTAT`	1	--	int¹		0	--	--	--	--
rs144028581^1,2		--	51600805(+)	`AAAAAA/CAAAAA`	1	--	int¹		0	--	--	--	--
rs184817791^1,2		--	51600933(+)	`CACTCA/GAGTAG`	1	--	int¹		0	--	--	--	--
rs190716787^1,2		--	51600964(+)	`CACCAC/TGCCAG`	1	--	int¹		0	--	--	--	--
rs181511674^1,2		--	51600973(+)	`AGGCTA/GATTTT`	1	--	int¹		0	--	--	--	--
rs145963774^1,2		--	51601242(+)	`CAGTCC/TGGTGG`	1	--	int¹		0	--	--	--	--
rs74820207^1,2	C,F,	--	51601402(+)	`GATCAT/CCACCT`	1	--	int¹		2		NA EA	240
rs7398898^1,2	C,A,H,	--	51601489(+)	`ATAAAG/ATACAG`	1	--	int¹		11		NA WA CSA EA	377
rs139883879^1,2		--	51601594(+)	`GAATCA/GGCTCT`	1	--	int¹		0	--	--	--	--
rs143788930^1,2		--	51601650(+)	`CAGAGA/GAGGTG`	1	--	int¹		0	--	--	--	--
rs145838952^1,2		--	51601756(+)	`CAGTCA/GTAAGA`	1	--	int¹		0	--	--	--	--
rs11435715^1,2	C	--	51601895(+)	`AAAAAA/-TTAGC`	1	--	int¹		1		NA	2
rs114821745^1,2	F,	--	51602004(+)	`AGATCG/ACTTGA`	1	--	int¹		1		WA	118
rs148995321^1,2		--	51602012(+)	`TGAGCC/TTGGGA`	1	--	int¹		0	--	--	--	--
rs75602756^1,2	F,	--	51602013(+)	`GAGCCT/CGGGAG`	1	--	int¹		2		NA EA	240
rs7978956^1,2	C,A,H,	--	51602021(+)	`GAGGCG/AGAGGT`	1	--	int¹		10		NA WA CSA EA	255
rs58560201^1,2	C,F,	--	51602078(+)	`GACCCT/GGTCTC`	1	--	int¹		4		WA CSA EA	242
rs185312663^1,2		--	51602183(+)	`TTGTAC/TGCTAG`	1	--	int¹		0	--	--	--	--
rs142979152^1,2		--	51602241(+)	`GGGGGC/TGTGGG`	1	--	int¹		0	--	--	--	--
rs80170585^1,2		--	51602268(+)	`TATCCC/GCATGT`	1	--	int¹		0	--	--	--	--
rs75073150^1,2	C,F,	--	51602354(+)	`TCCCCG/CCAAAT`	1	--	int¹		3		WA NA EA	358
rs140947450^1,2		--	51602391(+)	`GGTGGA/GTAGTA`	1	--	int¹		0	--	--	--	--
rs79582969^1,2	C,F,	--	51602411(+)	`AGGGCC/TTCTGG`	1	--	int¹		2		NA EA	240
rs146422113^1,2		--	51602445(+)	`TGCCCA/GTATAA`	1	--	int¹		0	--	--	--	--
rs139122023^1,2		--	51602787(+)	`AAGTGA/GGTCCT`	1	--	int¹		0	--	--	--	--
rs76152244^1,2	F,	--	51602802(+)	`AGACAA/CCACCA`	1	--	int¹		1		WA	118
rs6580808^1,2	C,F,A,H,	--	51602852(+)	`TAAATC/TTCTGT`	1	--	int¹		13		NS NA WA EA	610
rs11169765^1,2	F,	--	51602879(+)	`AGTTTA/GTGGTA`	1	--	int¹		1		EA	120
rs11614575^1,2	H	--	51602883(+)	`tatggG/Tatttt`	1	--	int¹		0	--	--	--	--
rs141686205^1,2		--	51602913(+)	`ACTACA/GATAAA`	1	--	int¹		0	--	--	--	--
rs145943282^1,2		--	51603066(+)	`TAACAA/GTCATT`	1	--	int¹		0	--	--	--	--
rs116337524^1,2	F,	--	51603190(+)	`GTCTAG/ACTTCT`	1	--	int¹		1		WA	118
rs189394325^1,2		--	51603301(+)	`ATTTTA/GTTTAT`	1	--	int¹		0	--	--	--	--
rs117234713^1,2	F,	--	51603376(+)	`GACTAT/CTGGGT`	1	--	int¹		1		EA	120
rs11169766^1,2	C,H,	--	51603753(+)	`tttttT/Ctgttt`	1	--	int¹		5		NS EA NA	530
rs10431487^1,2	C,A,H,	--	51603791(+)	`GGCTGT/GAATGC`	1	--	int¹		9		NA WA EA	370
rs181199782^1,2		--	51603812(+)	`CCATGA/GCTCAT`	1	--	int¹		0	--	--	--	--
rs185639136^1,2		--	51604054(+)	`GGGATA/GAGCTA`	1	--	int¹		0	--	--	--	--
rs138588181^1,2		--	51604081(+)	`TAGAAA/GCCATT`	1	--	int¹		0	--	--	--	--
rs188101590^1,2		--	51604086(+)	`GCCATG/TTGCAA`	1	--	int¹		0	--	--	--	--
rs76689460^1,2	F,	--	51604101(+)	`AATAAG/CAGGAA`	1	--	int¹		1		WA	118
rs114896804^1,2		--	51604195(+)	`TTCCAA/GTTCCA`	1	--	int¹		1		WA	118
rs180951150^1,2		--	51604240(+)	`TTTGTA/GGGACA`	1	--	int¹		0	--	--	--	--
rs149315367^1,2		--	51604456(+)	`TTGAGC/GACCTG`	1	--	int¹		0	--	--	--	--
rs143615701^1,2		--	51604511(+)	`TGAGAC/TATAGC`	1	--	int¹		0	--	--	--	--
rs148068543^1,2		--	51604671(+)	`ACACAC/TGTATG`	1	--	int¹		0	--	--	--	--
rs142339480^1,2		--	51604701(+)	`ACAAGC/TAGACA`	1	--	int¹		0	--	--	--	--
rs79986837^1,2		--	51604716(+)	`GCATTT/CTGACT`	1	--	int¹		1		WA	118
rs10783420^1,2	C,F,A,H,	--	51604820(+)	`TTTTTC/TGAGCC`	1	--	int¹		27		NS EA NA WA CSA	2769
rs115088585^1,2	F,	--	51604889(+)	`TTTCCC/GCAATG`	1	--	int¹		1		WA	118
rs77221011^1,2	F,	--	51604892(+)	`CCCCAA/GTGACT`	1	--	int¹		1		WA	118
rs187085238^1,2		--	51604971(+)	`CCAGGA/GAGGAG`	1	--	int¹		0	--	--	--	--
rs115202373^1,2		--	51605100(+)	`AGCCCA/CCCAAG`	1	--	int¹		0	--	--	--	--
rs114054783^1,2	C,F,	--	51605236(+)	`AAAAAC/TGCAGG`	1	--	int¹		1		WA	118
rs117116114^1,2		--	51605238(+)	`AAACGC/TAGGCA`	1	--	int¹		1		EA	120
rs192361352^1,2		--	51605274(+)	`ACAATC/GTCAAT`	1	--	int¹		0	--	--	--	--
rs183237259^1,2		--	51605534(+)	`AAGACA/CTTGTC`	1	--	int¹		0	--	--	--	--
rs139864410^1,2		--	51605766(+)

Advanced Search

Export list of displayed genes

POU6F1 Gene

POU class 6 homeobox 1

Aliases
for POU6F1 gene

Summaries
for POU6F1 gene

Genomic Views
for POU6F1 gene

Proteins
for POU6F1 gene

Protein Domains /
Families
for POU6F1 gene

Function
for POU6F1 gene

Pathways & Interactions
for POU6F1 gene

Drugs & Compounds
for POU6F1 gene

Transcripts
for POU6F1 gene

Expression
for POU6F1 gene

Orthologs
for POU6F1 gene

Paralogs
for POU6F1 gene

Genomic Variants
for POU6F1 gene

Advanced Search

Export list of displayed genes

POU6F1 Gene

POU class 6 homeobox 1

Aliasesfor POU6F1 gene

Summariesfor POU6F1 gene

Genomic Viewsfor POU6F1 gene

Proteinsfor POU6F1 gene

Protein Domains /Familiesfor POU6F1 gene

Functionfor POU6F1 gene

Pathways & Interactionsfor POU6F1 gene

Drugs & Compoundsfor POU6F1 gene

Transcriptsfor POU6F1 gene

Expression for POU6F1 gene

Orthologsfor POU6F1 gene

Paralogsfor POU6F1 gene

Genomic Variantsfor POU6F1 gene

Aliases
for POU6F1 gene

Summaries
for POU6F1 gene

Genomic Views
for POU6F1 gene

Proteins
for POU6F1 gene

Protein Domains /
Families
for POU6F1 gene

Function
for POU6F1 gene

Pathways & Interactions
for POU6F1 gene

Drugs & Compounds
for POU6F1 gene

Transcripts
for POU6F1 gene

Expression
for POU6F1 gene

Orthologs
for POU6F1 gene

Paralogs
for POU6F1 gene

Genomic Variants
for POU6F1 gene