Free for academic non-profit institutions. Other users need a Commercial license

Aliases for POTEI Gene

Aliases for POTEI Gene

  • POTE Ankyrin Domain Family Member I 2 3 5
  • POTE Ankyrin Domain Family, Member I 2
  • POTE2beta 3

External Ids for POTEI Gene

Previous GeneCards Identifiers for POTEI Gene

  • GC02M131217

Summaries for POTEI Gene

GeneCards Summary for POTEI Gene

POTEI (POTE Ankyrin Domain Family Member I) is a Protein Coding gene. An important paralog of this gene is POTEE.

No data available for Entrez Gene Summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for POTEI Gene

Genomics for POTEI Gene

Regulatory Elements for POTEI Gene

Enhancers for POTEI Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH02F130510 0.4 Ensembl 0.8 -1.8 -1790 1.2 ZNF781 FAR2P3 POTEI ENSG00000274711
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around POTEI on UCSC Golden Path with GeneCards custom track

Genomic Location for POTEI Gene

Chromosome:
2
Start:
130,459,455 bp from pter
End:
130,509,666 bp from pter
Size:
50,212 bases
Orientation:
Minus strand

Genomic View for POTEI Gene

Genes around POTEI on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
POTEI Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for POTEI Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for POTEI Gene

Proteins for POTEI Gene

  • Protein details for POTEI Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P0CG38-POTEI_HUMAN
    Recommended name:
    POTE ankyrin domain family member I
    Protein Accession:
    P0CG38

    Protein attributes for POTEI Gene

    Size:
    1075 amino acids
    Molecular mass:
    121282 Da
    Quaternary structure:
    No Data Available

neXtProt entry for POTEI Gene

Post-translational modifications for POTEI Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for POTEI Gene

Domains & Families for POTEI Gene

Protein Domains for POTEI Gene

Suggested Antigen Peptide Sequences for POTEI Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

P0CG38

UniProtKB/Swiss-Prot:

POTEI_HUMAN :
  • In the N-terminal section; belongs to the POTE family.
  • Contains 5 ANK repeats.
Family:
  • In the N-terminal section; belongs to the POTE family.
  • In the C-terminal section; belongs to the actin family.
Similarity:
  • Contains 5 ANK repeats.
genes like me logo Genes that share domains with POTEI: view

Function for POTEI Gene

Gene Ontology (GO) - Molecular Function for POTEI Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003674 molecular_function ND --
genes like me logo Genes that share ontologies with POTEI: view

Animal Model Products

Clone Products

Flow Cytometry Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for POTEI Gene

Localization for POTEI Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for POTEI gene
Compartment Confidence
extracellular 5
nucleus 2
golgi apparatus 2

Gene Ontology (GO) - Cellular Components for POTEI Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005615 extracellular space IDA 22664934
GO:0070062 extracellular exosome IDA 23533145
genes like me logo Genes that share ontologies with POTEI: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot for POTEI Gene

Pathways & Interactions for POTEI Gene

SuperPathways for POTEI Gene

No Data Available

Gene Ontology (GO) - Biological Process for POTEI Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001895 retina homeostasis IEP 23580065
genes like me logo Genes that share ontologies with POTEI: view

No data available for Pathways by source and SIGNOR curated interactions for POTEI Gene

Transcripts for POTEI Gene

mRNA/cDNA for POTEI Gene

(9) REFSEQ mRNAs :
(2) Additional mRNA sequences :
(3) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for POTEI Gene

POTE ankyrin domain family, member I:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for POTEI Gene

No ASD Table

Relevant External Links for POTEI Gene

GeneLoc Exon Structure for
POTEI
ECgene alternative splicing isoforms for
POTEI

Expression for POTEI Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and SAGE for POTEI Gene

mRNA differential expression in normal tissues according to GTEx for POTEI Gene

This gene is overexpressed in Testis (x28.5), Prostate (x7.7), and Heart - Atrial Appendage (x5.5).

Protein differential expression in normal tissues from HIPED for POTEI Gene

This gene is overexpressed in Spleen (19.0), Skin (11.7), Brain (11.2), Heart (8.8), Lung (8.0), and Saliva (6.3).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for POTEI Gene



Protein tissue co-expression partners for POTEI Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of POTEI Gene:

POTEI

SOURCE GeneReport for Unigene cluster for POTEI Gene:

Hs.558782
genes like me logo Genes that share expression patterns with POTEI: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery and mRNA Expression by UniProt/SwissProt for POTEI Gene

Orthologs for POTEI Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for POTEI Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia POTEI 34
  • 98.39 (n)
-- 35
  • 97 (a)
OneToMany
rat
(Rattus norvegicus)
Mammalia Potef 34
  • 85.6 (n)
dog
(Canis familiaris)
Mammalia -- 35
  • 41 (a)
ManyToMany
-- 35
  • 38 (a)
ManyToMany
-- 35
  • 37 (a)
ManyToMany
-- 35
  • 13 (a)
ManyToMany
-- 35
  • 11 (a)
ManyToMany
-- 35
  • 10 (a)
ManyToMany
-- 35
  • 10 (a)
ManyToMany
-- 35
  • 8 (a)
ManyToMany
mouse
(Mus musculus)
Mammalia Gm1758 35
  • 34 (a)
ManyToMany
cow
(Bos Taurus)
Mammalia -- 35
  • 10 (a)
OneToMany
platypus
(Ornithorhynchus anatinus)
Mammalia -- 35
  • 8 (a)
OneToMany
chicken
(Gallus gallus)
Aves LOC776816 34
  • 86.13 (n)
-- 35
  • 12 (a)
OneToMany
lizard
(Anolis carolinensis)
Reptilia -- 35
  • 37 (a)
ManyToMany
zebrafish
(Danio rerio)
Actinopterygii ANKRD7 35
  • 8 (a)
OneToMany
fruit fly
(Drosophila melanogaster)
Insecta Act42A 34
  • 80.04 (n)
worm
(Caenorhabditis elegans)
Secernentea act-5 34
  • 77.6 (n)
thale cress
(Arabidopsis thaliana)
eudicotyledons ACT11 34
  • 72.56 (n)
rice
(Oryza sativa)
Liliopsida Os05g0106600 34
  • 73.91 (n)
Species where no ortholog for POTEI was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)

Evolution for POTEI Gene

ENSEMBL:
Gene Tree for POTEI (if available)
TreeFam:
Gene Tree for POTEI (if available)

Paralogs for POTEI Gene

Variants for POTEI Gene

Sequence variations from dbSNP and Humsavar for POTEI Gene

SNP ID Clin Chr 02 pos Sequence Context AA Info Type
rs104893611 Pathogenic 130,597,896(-) CCGGC(C/T)GCTAC intron-variant, downstream-variant-500B, reference, missense
rs746231039 Pathogenic 130,593,027(+) GGCGC(-/G)CCCCC intron-variant, reference, frameshift-variant
rs863223280 Pathogenic 130,597,850(-) GTGCG(-/CAGGTGGGCACAGGGGTGCG)CGGGG intron-variant, downstream-variant-500B
rs199607550 Benign 130,598,922(+) CAAAT(G/T)GATGA intron-variant, reference, missense
rs199715380 Benign 130,597,533(+) CAGGG(C/T)CCCGA intron-variant, downstream-variant-500B, reference, synonymous-codon, missense

Structural Variations from Database of Genomic Variants (DGV) for POTEI Gene

Variant ID Type Subtype PubMed ID
nsv979262 CNV duplication 23825009
nsv979119 CNV duplication 23825009
nsv963846 CNV duplication 23825009
nsv961646 CNV duplication 23825009
nsv961645 CNV duplication 23825009
nsv953164 CNV deletion 24416366
nsv7327 OTHER inversion 18451855
nsv428403 CNV loss 18775914
nsv1147463 OTHER inversion 26484159
nsv1144914 CNV deletion 24896259
nsv1144913 CNV deletion 24896259
nsv1139735 CNV duplication 24896259
nsv1126565 CNV deletion 24896259
nsv1118877 CNV deletion 24896259
nsv1112770 CNV deletion 24896259
nsv1072977 CNV deletion 25765185
nsv1072976 CNV deletion 25765185
nsv1072030 CNV deletion 25765185
nsv1072029 CNV deletion 25765185
nsv10170 CNV gain+loss 18304495
nsv1005664 CNV loss 25217958
esv3893326 CNV gain 25118596
esv2759092 CNV gain+loss 17122850
dgv2034n106 CNV deletion 24896259
dgv2032n106 OTHER inversion 24896259

Variation tolerance for POTEI Gene

Gene Damage Index Score: 8.15; 84.69% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for POTEI Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
POTEI

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for POTEI Gene

Disorders for POTEI Gene

Relevant External Links for POTEI

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
POTEI

No disorders were found for POTEI Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for POTEI Gene

Publications for POTEI Gene

  1. Duplication and extensive remodeling shaped POTE family genes encoding proteins containing ankyrin repeat and coiled coil domains. (PMID: 16364570) Hahn Y. … Lee B. (Gene 2006) 2 3 64
  2. Generation and annotation of the DNA sequences of human chromosomes 2 and 4. (PMID: 15815621) Hillier L.W. … Wilson R.K. (Nature 2005) 3 4 64
  3. The BioPlex Network: A Systematic Exploration of the Human Interactome. (PMID: 26186194) Huttlin E.L. … Gygi S.P. (Cell 2015) 3 64
  4. In-depth proteomic analyses of exosomes isolated from expressed prostatic secretions in urine. (PMID: 23533145) Principe S. … Drake R.R. (Proteomics 2013) 3 64
  5. Shotgun proteomics reveals specific modulated protein patterns in tears of patients with primary open angle glaucoma naA^ve to therapy. (PMID: 23580065) Pieragostino D. … Del Boccio P. (Mol Biosyst 2013) 3 64

Products for POTEI Gene

Sources for POTEI Gene

Content
Loading form....