Free for academic non-profit institutions. Other users need a Commercial license

Aliases for POTEI Gene

Aliases for POTEI Gene

  • POTE Ankyrin Domain Family Member I 2 3 5
  • POTE Ankyrin Domain Family, Member I 2
  • POTE2beta 3

External Ids for POTEI Gene

Previous GeneCards Identifiers for POTEI Gene

  • GC02M131217

Summaries for POTEI Gene

GeneCards Summary for POTEI Gene

POTEI (POTE Ankyrin Domain Family Member I) is a Protein Coding gene. An important paralog of this gene is POTEE.

Additional gene information for POTEI Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for POTEI Gene

Genomics for POTEI Gene

Regulatory Elements for POTEI Gene

Enhancers for POTEI Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH02H130510 0.4 dbSUPER 0.7 -2.9 -2916 3 ZNF781 ZNF697 FAR2P3 FAM168B ENSG00000274711 POTEI
GH02H130516 0.2 dbSUPER 0.4 -7.2 -7246 1 ENSG00000274711 POTEI
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around POTEI on UCSC Golden Path with GeneCards custom track

Genomic Location for POTEI Gene

130,459,455 bp from pter
130,509,666 bp from pter
50,212 bases
Minus strand

Genomic View for POTEI Gene

Genes around POTEI on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
POTEI Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for POTEI Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for POTEI Gene

Proteins for POTEI Gene

  • Protein details for POTEI Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    POTE ankyrin domain family member I
    Protein Accession:

    Protein attributes for POTEI Gene

    1075 amino acids
    Molecular mass:
    121282 Da
    Quaternary structure:
    No Data Available

neXtProt entry for POTEI Gene

Post-translational modifications for POTEI Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for POTEI Gene

Domains & Families for POTEI Gene

Gene Families for POTEI Gene

Protein Domains for POTEI Gene

Suggested Antigen Peptide Sequences for POTEI Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • In the N-terminal section; belongs to the POTE family.
  • In the N-terminal section; belongs to the POTE family.
  • In the C-terminal section; belongs to the actin family.
genes like me logo Genes that share domains with POTEI: view

Function for POTEI Gene

Phenotypes From GWAS Catalog for POTEI Gene

Gene Ontology (GO) - Molecular Function for POTEI Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003674 molecular_function ND --
genes like me logo Genes that share ontologies with POTEI: view

Animal Model Products

CRISPR Products

Clone Products

  • Applied Biological Materials Clones for POTEI
  • Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for POTEI Gene

Localization for POTEI Gene

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for POTEI gene
Compartment Confidence
extracellular 5
nucleus 2
golgi apparatus 2

Gene Ontology (GO) - Cellular Components for POTEI Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005615 extracellular space IDA 22664934
GO:0070062 extracellular exosome IDA 23533145
genes like me logo Genes that share ontologies with POTEI: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Subcellular locations from the Human Protein Atlas (HPA) for POTEI Gene

Pathways & Interactions for POTEI Gene

SuperPathways for POTEI Gene

No Data Available

Gene Ontology (GO) - Biological Process for POTEI Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001895 retina homeostasis IEP 23580065
genes like me logo Genes that share ontologies with POTEI: view

No data available for Pathways by source and SIGNOR curated interactions for POTEI Gene

Drugs & Compounds for POTEI Gene

No Compound Related Data Available

Transcripts for POTEI Gene

mRNA/cDNA for POTEI Gene

(9) REFSEQ mRNAs :
(2) Additional mRNA sequences :
(3) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for POTEI Gene

POTE ankyrin domain family, member I:
Representative Sequences:

CRISPR Products

Clone Products

  • Applied Biological Materials Clones for POTEI
  • Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more

Alternative Splicing Database (ASD) splice patterns (SP) for POTEI Gene

No ASD Table

Relevant External Links for POTEI Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for POTEI Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for POTEI Gene

mRNA differential expression in normal tissues according to GTEx for POTEI Gene

This gene is overexpressed in Testis (x28.5), Prostate (x7.7), and Heart - Atrial Appendage (x5.5).

Protein differential expression in normal tissues from HIPED for POTEI Gene

This gene is overexpressed in Spleen (19.0), Skin (11.7), Brain (11.2), Heart (8.8), Lung (8.0), and Saliva (6.3).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for POTEI Gene

Protein tissue co-expression partners for POTEI Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of POTEI Gene:


SOURCE GeneReport for Unigene cluster for POTEI Gene:

genes like me logo Genes that share expression patterns with POTEI: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for POTEI Gene

Orthologs for POTEI Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for POTEI Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia POTEI 33
  • 98.39 (n)
-- 34
  • 97 (a)
(Rattus norvegicus)
Mammalia Potef 33
  • 85.6 (n)
(Canis familiaris)
Mammalia -- 34
  • 41 (a)
-- 34
  • 38 (a)
-- 34
  • 37 (a)
-- 34
  • 13 (a)
-- 34
  • 11 (a)
-- 34
  • 10 (a)
-- 34
  • 10 (a)
-- 34
  • 8 (a)
(Mus musculus)
Mammalia Gm1758 34
  • 34 (a)
(Bos Taurus)
Mammalia -- 34
  • 10 (a)
(Ornithorhynchus anatinus)
Mammalia -- 34
  • 8 (a)
(Gallus gallus)
Aves LOC776816 33
  • 86.13 (n)
-- 34
  • 12 (a)
(Anolis carolinensis)
Reptilia -- 34
  • 37 (a)
(Danio rerio)
Actinopterygii ANKRD7 34
  • 8 (a)
fruit fly
(Drosophila melanogaster)
Insecta Act42A 33
  • 80.04 (n)
(Caenorhabditis elegans)
Secernentea act-5 33
  • 77.6 (n)
thale cress
(Arabidopsis thaliana)
eudicotyledons ACT11 33
  • 72.56 (n)
(Oryza sativa)
Liliopsida Os05g0106600 33
  • 73.91 (n)
Species where no ortholog for POTEI was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)

Evolution for POTEI Gene

Gene Tree for POTEI (if available)
Gene Tree for POTEI (if available)

Paralogs for POTEI Gene

Variants for POTEI Gene

Sequence variations from dbSNP and Humsavar for POTEI Gene

SNP ID Clin Chr 02 pos Sequence Context AA Info Type
rs104893611 Pathogenic 130,597,896(-) CCGGC(C/T)GCTAC intron-variant, downstream-variant-500B, reference, missense
rs746231039 Pathogenic 130,593,027(+) GGCGC(-/G)CCCCC intron-variant, reference, frameshift-variant
rs863223280 Pathogenic 130,597,850(-) GTGCG(-/CAGGTGGGCACAGGGGTGCG)CGGGG intron-variant, downstream-variant-500B
rs199607550 Benign 130,598,922(+) CAAAT(G/T)GATGA intron-variant, reference, missense
rs199715380 Benign 130,597,533(+) CAGGG(C/T)CCCGA intron-variant, downstream-variant-500B, reference, synonymous-codon, missense

Structural Variations from Database of Genomic Variants (DGV) for POTEI Gene

Variant ID Type Subtype PubMed ID
dgv2032n106 OTHER inversion 24896259
dgv2034n106 CNV deletion 24896259
esv2759092 CNV gain+loss 17122850
esv3893326 CNV gain 25118596
nsv1005664 CNV loss 25217958
nsv10170 CNV gain+loss 18304495
nsv1072029 CNV deletion 25765185
nsv1072030 CNV deletion 25765185
nsv1072976 CNV deletion 25765185
nsv1072977 CNV deletion 25765185
nsv1112770 CNV deletion 24896259
nsv1118877 CNV deletion 24896259
nsv1126565 CNV deletion 24896259
nsv1139735 CNV duplication 24896259
nsv1144913 CNV deletion 24896259
nsv1144914 CNV deletion 24896259
nsv1147463 OTHER inversion 26484159
nsv428403 CNV loss 18775914
nsv7327 OTHER inversion 18451855
nsv953164 CNV deletion 24416366
nsv961645 CNV duplication 23825009
nsv961646 CNV duplication 23825009
nsv963846 CNV duplication 23825009
nsv979119 CNV duplication 23825009
nsv979262 CNV duplication 23825009

Variation tolerance for POTEI Gene

Gene Damage Index Score: 8.15; 84.69% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for POTEI Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for POTEI Gene

Disorders for POTEI Gene

Relevant External Links for POTEI

Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for POTEI Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for POTEI Gene

Publications for POTEI Gene

  1. Duplication and extensive remodeling shaped POTE family genes encoding proteins containing ankyrin repeat and coiled coil domains. (PMID: 16364570) Hahn Y … Lee B (Gene 2006) 2 3 60
  2. Generation and annotation of the DNA sequences of human chromosomes 2 and 4. (PMID: 15815621) Hillier LW … Wilson RK (Nature 2005) 3 4 60
  3. Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 60
  4. The BioPlex Network: A Systematic Exploration of the Human Interactome. (PMID: 26186194) Huttlin EL … Gygi SP (Cell 2015) 3 60
  5. In-depth proteomic analyses of exosomes isolated from expressed prostatic secretions in urine. (PMID: 23533145) Principe S … Drake RR (Proteomics 2013) 3 60

Products for POTEI Gene

Sources for POTEI Gene

Loading form....