Free for academic non-profit institutions. Other users need a Commercial license

Aliases for POPDC3 Gene

Aliases for POPDC3 Gene

  • Popeye Domain Containing 3 2 3
  • POP3 3 4 6
  • Popeye Protein 3 3 4
  • Popeye Domain-Containing Protein 3 3
  • BA355M14.1 3

External Ids for POPDC3 Gene

Previous GeneCards Identifiers for POPDC3 Gene

  • GC06M105605
  • GC06M105651
  • GC06M105712
  • GC06M103048

Summaries for POPDC3 Gene

Entrez Gene Summary for POPDC3 Gene

  • This gene encodes a member of the POP family of proteins containing three putative transmembrane domains. This gene is expressed in cardiac and skeletal muscle and may play an important role in these tissues during development. Alternatively spliced transcript variants have been found. [provided by RefSeq, Nov 2008]

GeneCards Summary for POPDC3 Gene

POPDC3 (Popeye Domain Containing 3) is a Protein Coding gene. An important paralog of this gene is POPDC2.

UniProtKB/Swiss-Prot for POPDC3 Gene

  • May play an important role in heart development

Gene Wiki entry for POPDC3 Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for POPDC3 Gene

Genomics for POPDC3 Gene

Regulatory Elements for POPDC3 Gene

Epigenetics Products

  • DNA Methylation CpG Assay Predesigned for Pyrosequencing in human,mouse,rat

Genomic Location for POPDC3 Gene

105,157,900 bp from pter
105,179,995 bp from pter
22,096 bases
Minus strand

Genomic View for POPDC3 Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for POPDC3 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for POPDC3 Gene

Proteins for POPDC3 Gene

  • Protein details for POPDC3 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Popeye domain-containing protein 3
    Protein Accession:
    Secondary Accessions:
    • B2RA98
    • Q5T3Y8
    • Q8TBW6

    Protein attributes for POPDC3 Gene

    291 amino acids
    Molecular mass:
    33870 Da
    Quaternary structure:
    No Data Available

neXtProt entry for POPDC3 Gene

Proteomics data for POPDC3 Gene at MOPED

Post-translational modifications for POPDC3 Gene

  • Glycosylation at Asn4
  • Modification sites at PhosphoSitePlus

Other Protein References for POPDC3 Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

No data available for DME Specific Peptides for POPDC3 Gene

Domains for POPDC3 Gene

Protein Domains for POPDC3 Gene


Suggested Antigen Peptide Sequences for POPDC3 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the popeye family.
  • Belongs to the popeye family.
genes like me logo Genes that share domains with POPDC3: view

No data available for Gene Families for POPDC3 Gene

Function for POPDC3 Gene

Molecular function for POPDC3 Gene

UniProtKB/Swiss-Prot Function:
May play an important role in heart development

Gene Ontology (GO) - Molecular Function for POPDC3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003674 molecular_function ND --
genes like me logo Genes that share ontologies with POPDC3: view

Phenotypes for POPDC3 Gene

GenomeRNAi human phenotypes for POPDC3:
genes like me logo Genes that share phenotypes with POPDC3: view

Animal Model Products

miRNA Products

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for POPDC3

In Situ Assay Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for POPDC3 Gene

Localization for POPDC3 Gene

Subcellular locations from UniProtKB/Swiss-Prot for POPDC3 Gene

Membrane; Multi-pass membrane protein.

Subcellular locations from

Jensen Localization Image for POPDC3 Gene COMPARTMENTS Subcellular localization image for POPDC3 gene
Compartment Confidence
plasma membrane 3
cytosol 1
nucleus 1

Gene Ontology (GO) - Cellular Components for POPDC3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0016020 membrane --
GO:0016021 integral component of membrane NAS 10882522
genes like me logo Genes that share ontologies with POPDC3: view

Pathways for POPDC3 Gene

SuperPathways for POPDC3 Gene

No Data Available

Interacting Proteins for POPDC3 Gene

Gene Ontology (GO) - Biological Process for POPDC3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0008150 biological_process ND --
GO:0042391 regulation of membrane potential IEA --
genes like me logo Genes that share ontologies with POPDC3: view

No data available for Pathways by source for POPDC3 Gene

Transcripts for POPDC3 Gene

Unigene Clusters for POPDC3 Gene

Popeye domain containing 3:
Representative Sequences:

miRNA Products

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for POPDC3

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for POPDC3 Gene

ExUns: 1a · 1b ^ 2 ^ 3a · 3b ^ 4 ^ 5a · 5b · 5c · 5d ^ 6a · 6b ^ 7a · 7b · 7c · 7d
SP1: - - -
SP2: - - - - - -
SP3: - - - - -
SP5: - - -
SP7: - - - -

Relevant External Links for POPDC3 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for POPDC3 Gene

mRNA expression in normal human tissues for POPDC3 Gene

mRNA differential expression in normal tissues according to GTEx for POPDC3 Gene

This gene is overexpressed in Muscle - Skeletal (19.8) and Heart - Left Ventricle (5.7).

SOURCE GeneReport for Unigene cluster for POPDC3 Gene Hs.458336

mRNA Expression by UniProt/SwissProt for POPDC3 Gene

Tissue specificity: Expressed predominantly in skeletal muscle and detected in heart.
genes like me logo Genes that share expressions with POPDC3: view

Primer Products

  • QuantiTect SYBR Green Assays in human,mouse,rat
  • Pre-validated RT² qPCR Primer Assay in human,mouse,rat
  • QuantiFast Probe-based Assays in human,mouse,rat

In Situ Assay Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression and Expression partners for POPDC3 Gene

Orthologs for POPDC3 Gene

This gene was present in the common ancestor of animals.

Orthologs for POPDC3 Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia POPDC3 35
  • 91.41 (n)
  • 92.44 (a)
  • 92 (a)
(Canis familiaris)
Mammalia POPDC3 35
  • 93.01 (n)
  • 95.88 (a)
  • 96 (a)
(Mus musculus)
Mammalia Popdc3 35
  • 87.51 (n)
  • 89 (a)
Popdc3 16
Popdc3 36
  • 89 (a)
(Pan troglodytes)
Mammalia POPDC3 35
  • 99.77 (n)
  • 100 (a)
  • 100 (a)
(Rattus norvegicus)
Mammalia Popdc3 35
  • 85.15 (n)
  • 87.82 (a)
(Monodelphis domestica)
Mammalia POPDC3 36
  • 82 (a)
(Ornithorhynchus anatinus)
Mammalia POPDC3 36
  • 75 (a)
(Gallus gallus)
Aves POPDC3 35
  • 76.09 (n)
  • 79.86 (a)
  • 74 (a)
(Anolis carolinensis)
Reptilia POPDC3 36
  • 72 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia popdc3 35
  • 71.32 (n)
  • 70.22 (a)
Str.19727 35
(Danio rerio)
Actinopterygii popdc3 35
  • 64.77 (n)
  • 61.22 (a)
popdc3 36
  • 54 (a)
fruit fly
(Drosophila melanogaster)
Insecta bves 36
  • 17 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 36
  • 27 (a)
Species with no ortholog for POPDC3:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for POPDC3 Gene

Gene Tree for POPDC3 (if available)
Gene Tree for POPDC3 (if available)

Paralogs for POPDC3 Gene

Paralogs for POPDC3 Gene

(2) SIMAP similar genes for POPDC3 Gene using alignment to 2 proteins:

genes like me logo Genes that share paralogs with POPDC3: view

Variants for POPDC3 Gene

Sequence variations from dbSNP and Humsavar for POPDC3 Gene

SNP ID Clin Chr 06 pos Sequence Context AA Info Type MAF
rs377060256 -- 105,181,186(+) GTGTG(-/TATATATATGTATATATATATATA)TACAC upstream-variant-2KB
rs377362375 -- 105,179,560(+) GCGCG(C/G)ATAGG intron-variant
rs377606479 -- 105,181,200(+) GTATA(C/T)ATATA upstream-variant-2KB
rs397783895 -- 105,180,385(+) GAGAG(-/AG)GTAAA upstream-variant-2KB
rs532745610 -- 105,172,760(+) AAACC(A/G)TCATT intron-variant

Structural Variations from Database of Genomic Variants (DGV) for POPDC3 Gene

Variant ID Type Subtype PubMed ID
dgv2000e1 CNV Complex 17122850
essv19736 CNV CNV 17122850
nsv886529 CNV Loss 21882294
esv2665928 CNV Deletion 23128226

Relevant External Links for POPDC3 Gene

HapMap Linkage Disequilibrium report

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for POPDC3 Gene

Disorders for POPDC3 Gene

Relevant External Links for POPDC3

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator

No disorders were found for POPDC3 Gene.

No data available for MalaCards , OMIM , UniProtKB/Swiss-Prot , University of Copenhagen DISEASES , Novoseek inferred disease relationships and Genatlas for POPDC3 Gene

Publications for POPDC3 Gene

  1. Isolation and characterization of the novel popeye gene family expressed in skeletal muscle and heart. (PMID: 10882522) Andree B. … Brand T. (Dev. Biol. 2000) 2 3 4 23
  2. The DNA sequence and analysis of human chromosome 6. (PMID: 14574404) Mungall A.J. … Beck S. (Nature 2003) 3 4
  3. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4
  4. Many sequence variants affecting diversity of adult human height. (PMID: 18391951) Gudbjartsson D.F. … Stefansson K. (Nat. Genet. 2008) 3 48
  5. Genome-wide association study identifies sequence variants on 6q21 associated with age at menarche. (PMID: 19448622) Sulem P. … Stefansson K. (Nat. Genet. 2009) 3 48

Products for POPDC3 Gene

Sources for POPDC3 Gene

Back to Top
