Free for academic non-profit institutions. Other users need a Commercial license

Aliases for POMGNT1 Gene

Aliases for POMGNT1 Gene

  • Protein O-Linked Mannose N-Acetylglucosaminyltransferase 1 (Beta 1,2-) 2 3 5
  • UDP-GlcNAc:Alpha-D-Mannoside Beta-1,2-N-Acetylglucosaminyltransferase I.2 3 4
  • GnT I.2 3 4
  • MGAT1.2 3 4
  • Protein O-Linked-Mannose Beta-1,2-N-Acetylglucosaminyltransferase 1 3
  • Protein O-Linked Mannose Beta1,2-N-Acetylglucosaminyltransferase 2
  • Protein O-Mannose Beta-1,2-N-Acetylglucosaminyltransferase 2
  • Muscle-Eye-Brain Disease 2
  • EC 56
  • EC 2.4.1.- 4
  • EC 2.4.1 56
  • GnT-I.2 3
  • POMGnT1 4
  • GNTI.2 3
  • LGMD2O 3
  • RP76 3
  • MEB 3

External Ids for POMGNT1 Gene

Previous HGNC Symbols for POMGNT1 Gene

  • MEB

Previous GeneCards Identifiers for POMGNT1 Gene

  • GC01M046367
  • GC01M046654
  • GC01M044769

Summaries for POMGNT1 Gene

Entrez Gene Summary for POMGNT1 Gene

  • This gene encodes a type II transmembrane protein that resides in the Golgi apparatus. It participates in O-mannosyl glycosylation and is specific for alpha linked terminal mannose. Mutations in this gene may be associated with muscle-eye-brain disease and several congenital muscular dystrophies. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Feb 2014]

GeneCards Summary for POMGNT1 Gene

POMGNT1 (Protein O-Linked Mannose N-Acetylglucosaminyltransferase 1 (Beta 1,2-)) is a Protein Coding gene. Diseases associated with POMGNT1 include Muscular Dystrophy-Dystroglycanopathy , Type C, 3 and Retinitis Pigmentosa 76. Among its related pathways are Metabolism of proteins and O-linked glycosylation. Gene Ontology (GO) annotations related to this gene include acetylglucosaminyltransferase activity and beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity. An important paralog of this gene is MGAT1.

UniProtKB/Swiss-Prot for POMGNT1 Gene

  • Participates in O-mannosyl glycosylation. May be responsible for the synthesis of the GlcNAc(beta1-2)Man(alpha1-)O-Ser/Thr moiety on alpha-dystroglycan and other O-mannosylated proteins. Is specific for alpha linked terminal mannose and does not have MGAT3, MGAT4, MGAT5, MGAT7 or MGAT8 activity.

Gene Wiki entry for POMGNT1 Gene

Additional gene information for POMGNT1 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for POMGNT1 Gene

Genomics for POMGNT1 Gene

GeneHancer (GH) Regulatory Elements for POMGNT1 Gene

Promoters and enhancers for POMGNT1 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH01I046196 Promoter/Enhancer 2.2 EPDnew Ensembl ENCODE dbSUPER 561.9 +22.1 22059 2.8 HDGF ARNT SIN3A DMAP1 ZNF48 TCF12 POLR2B ZNF143 ATF7 RUNX3 POMGNT1 LURAP1 TOE1 GPBP1L1 LRRC41 LOC110117498 TSPAN1 PIK3R3 RAD54L RPL7AP16
GH01I046220 Promoter 0.8 EPDnew 550.8 0.0 -39 0.1 RFX1 ZBTB48 EBF1 BMI1 GC01P046223 POMGNT1 PIR61768 LURAP1
GH01I046221 Enhancer 0.5 ENCODE 550.8 -1.7 -1709 1.4 ZNF148 ELF3 SP5 ZFP64 ELF1 GABPA ZBTB20 GC01P046223 POMGNT1 PIR61768
GH01I046218 Enhancer 0.5 ENCODE 550.8 +1.6 1625 0.7 ZBTB6 ZBTB48 ZNF585B ZSCAN5C PRDM10 ZBTB17 POMGNT1 LURAP1 ZSWIM5 TSPAN1 LOC110117498 PIK3R3 MUTYH ENSG00000226957
GH01I047024 Promoter 1.2 EPDnew 10.8 -803.3 -803251 0.1 FEZF1 ZNF2 GLIS2 ZNF213 ZNF302 SP3 YY2 REST TSHZ1 ZNF488 CYP4X1 NSUN4 TEX38 LRRC41 LURAP1 POMGNT1 GC01M047004 CYP4Z1
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around POMGNT1 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the POMGNT1 gene promoter:

Genomic Locations for POMGNT1 Gene

Genomic Locations for POMGNT1 Gene
31,625 bases
Minus strand

Genomic View for POMGNT1 Gene

Genes around POMGNT1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
POMGNT1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for POMGNT1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for POMGNT1 Gene

Proteins for POMGNT1 Gene

  • Protein details for POMGNT1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Protein O-linked-mannose beta-1,2-N-acetylglucosaminyltransferase 1
    Protein Accession:
    Secondary Accessions:
    • D3DQ16
    • Q5VST2
    • Q5VST3
    • Q9BV55
    • Q9H9L8
    • Q9NXF9
    • Q9NYF7

    Protein attributes for POMGNT1 Gene

    660 amino acids
    Molecular mass:
    75252 Da
    Name=Mn(2+); Xref=ChEBI:CHEBI:29035;
    Quaternary structure:
    No Data Available
    • Sequence=BAB14207.1; Type=Erroneous initiation; Note=Translation N-terminally extended.; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for POMGNT1 Gene

    Alternative splice isoforms for POMGNT1 Gene


neXtProt entry for POMGNT1 Gene

Selected DME Specific Peptides for POMGNT1 Gene


Post-translational modifications for POMGNT1 Gene

  • Ubiquitination at isoforms=2537 and isoforms=2538
  • Glycosylation at Thr524

Domains & Families for POMGNT1 Gene

Gene Families for POMGNT1 Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted membrane proteins

Protein Domains for POMGNT1 Gene

Suggested Antigen Peptide Sequences for POMGNT1 Gene

Graphical View of Domain Structure for InterPro Entry



  • Amino acid residues between 299-311 are important for both protein expression and enzymatic activity. The minimal catalytic domain is located between positions 299-651. Single amino acid substitutions in the stem domain from MEB patients abolished the activity of the membrane-bound form but not the soluble form. This suggests that the stem domain of the soluble form is unnecessary for activity, but that some amino acids play a crucial role in the membrane-bound form.
  • Belongs to the glycosyltransferase 13 family.
  • Amino acid residues between 299-311 are important for both protein expression and enzymatic activity. The minimal catalytic domain is located between positions 299-651. Single amino acid substitutions in the stem domain from MEB patients abolished the activity of the membrane-bound form but not the soluble form. This suggests that the stem domain of the soluble form is unnecessary for activity, but that some amino acids play a crucial role in the membrane-bound form.
  • Belongs to the glycosyltransferase 13 family.
genes like me logo Genes that share domains with POMGNT1: view

Function for POMGNT1 Gene

Molecular function for POMGNT1 Gene

UniProtKB/Swiss-Prot BiophysicochemicalProperties:
Kinetic parameters: KM=1.85 mM for mannosylpeptide {ECO:0000269 PubMed:11709191, ECO:0000269 PubMed:11742540}; KM=0.73 mM for UDP-GlcNAc {ECO:0000269 PubMed:11709191, ECO:0000269 PubMed:11742540}; KM=30 mM for Man(alpha1-)O-benzyl {ECO:0000269 PubMed:11709191, ECO:0000269 PubMed:11742540}; KM=12 mM for CYA[Man(alpha1-)O-T]AV {ECO:0000269 PubMed:11709191, ECO:0000269 PubMed:11742540}; pH dependence: Optimum pH is 6.0. {ECO:0000269 PubMed:11709191, ECO:0000269 PubMed:11742540};
UniProtKB/Swiss-Prot CatalyticActivity:
UDP-N-acetyl-alpha-D-glucosamine + O-alpha-D-mannosylprotein = UDP + N-acetyl-beta-D-glucosaminyl-(1->2)-O-alpha-D-mannosylprotein.
UniProtKB/Swiss-Prot Function:
Participates in O-mannosyl glycosylation. May be responsible for the synthesis of the GlcNAc(beta1-2)Man(alpha1-)O-Ser/Thr moiety on alpha-dystroglycan and other O-mannosylated proteins. Is specific for alpha linked terminal mannose and does not have MGAT3, MGAT4, MGAT5, MGAT7 or MGAT8 activity.

Enzyme Numbers (IUBMB) for POMGNT1 Gene

Gene Ontology (GO) - Molecular Function for POMGNT1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 25416956
GO:0008375 acetylglucosaminyltransferase activity IMP 26908613
GO:0016740 transferase activity IEA --
GO:0016757 transferase activity, transferring glycosyl groups IEA --
GO:0047223 beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity TAS --
genes like me logo Genes that share ontologies with POMGNT1: view
genes like me logo Genes that share phenotypes with POMGNT1: view

Human Phenotype Ontology for POMGNT1 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for POMGNT1 Gene

MGI Knock Outs for POMGNT1:

Animal Model Products

CRISPR Products

Inhibitory RNA Products

Clone Products

No data available for Phenotypes From GWAS Catalog , Transcription Factor Targets and HOMER Transcription for POMGNT1 Gene

Localization for POMGNT1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for POMGNT1 Gene

Golgi apparatus membrane; Single-pass type II membrane protein.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for POMGNT1 gene
Compartment Confidence
golgi apparatus 5
plasma membrane 4
extracellular 2
endoplasmic reticulum 1
cytosol 1

Gene Ontology (GO) - Cellular Components for POMGNT1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000139 Golgi membrane TAS --
GO:0005794 Golgi apparatus IEA --
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IEA --
genes like me logo Genes that share ontologies with POMGNT1: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for POMGNT1 Gene

Pathways & Interactions for POMGNT1 Gene

genes like me logo Genes that share pathways with POMGNT1: view

Pathways by source for POMGNT1 Gene

UniProtKB/Swiss-Prot Q8WZA1-PMGT1_HUMAN

  • Pathway: Protein modification; protein glycosylation.

Gene Ontology (GO) - Biological Process for POMGNT1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006486 protein glycosylation IEA --
GO:0006493 protein O-linked glycosylation TAS,IEA --
genes like me logo Genes that share ontologies with POMGNT1: view

No data available for SIGNOR curated interactions for POMGNT1 Gene

Drugs & Compounds for POMGNT1 Gene

(4) Drugs for POMGNT1 Gene - From: HMDB and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Manganese Approved Nutra 37
N-Acetyl-D-glucosamine Approved, Investigational Nutra 0
Uridine-5'-Diphosphate Experimental Pharma 0

(2) Additional Compounds for POMGNT1 Gene - From: HMDB and Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
Uridine diphosphate-N-acetylglucosamine
  • N-[2-[[[5-[(2,4-Dioxo-1H-pyrimidin-1-yl)]-3,4-dihydroxy-tetrahydrofuran-2-yl]methoxy-hydroxy-phosphinoyl]oxy-hydroxy-phosphinoyl]oxy-4,5-dihydroxy-6-(hydroxymethyl)tetrahydropyran-3-yl]acetamide
  • UDP-a-D-N-Acetylglucosamine
  • UDP-Acetyl-D-glucosamine
  • UDP-Acetyl-delta-glucosamine
  • UDP-Acetylglucosamine
genes like me logo Genes that share compounds with POMGNT1: view

Transcripts for POMGNT1 Gene

Unigene Clusters for POMGNT1 Gene

Protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for POMGNT1 Gene

ExUns: 1 ^ 2a · 2b · 2c · 2d · 2e ^ 3a · 3b ^ 4 ^ 5 ^ 6a · 6b ^ 7 ^ 8 ^ 9 ^ 10a · 10b ^ 11 ^ 12a · 12b ^ 13a · 13b ^ 14a · 14b ^ 15 ^ 16 ^
SP1: - - - - -
SP2: - -
SP5: - - - - - -
SP9: - - -
SP10: -

ExUns: 17a · 17b ^ 18 ^ 19 ^ 20a · 20b ^ 21 ^ 22a · 22b ^ 23a · 23b · 23c ^ 24a · 24b · 24c
SP1: - -
SP4: - - -
SP6: -

Relevant External Links for POMGNT1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for POMGNT1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for POMGNT1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for POMGNT1 Gene

This gene is overexpressed in Breast (30.5) and Serum (19.1).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for POMGNT1 Gene

NURSA nuclear receptor signaling pathways regulating expression of POMGNT1 Gene:


SOURCE GeneReport for Unigene cluster for POMGNT1 Gene:


mRNA Expression by UniProt/SwissProt for POMGNT1 Gene:

Tissue specificity: Constitutively expressed. An additional weaker band is also detected in spinal cord, lymph node, and trachea. Expressed especially in astrocytes. Also expressed in immature and mature neurons.

Evidence on tissue expression from TISSUES for POMGNT1 Gene

  • Nervous system(4.9)
  • Liver(4.2)
  • Muscle(2.9)

Phenotype-based relationships between genes and organs from Gene ORGANizer for POMGNT1 Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
  • cardiovascular
  • digestive
  • endocrine
  • integumentary
  • nervous
  • reproductive
  • respiratory
  • skeletal muscle
  • skeleton
  • urinary
Head and neck:
  • brain
  • cerebellum
  • cerebrospinal fluid
  • cheek
  • chin
  • cranial nerve
  • ear
  • eye
  • face
  • forehead
  • head
  • inner ear
  • jaw
  • larynx
  • lip
  • mandible
  • maxilla
  • meninges
  • middle ear
  • mouth
  • neck
  • nose
  • outer ear
  • pituitary gland
  • skull
  • tongue
  • vocal cord
  • breast
  • chest wall
  • clavicle
  • heart
  • heart valve
  • lung
  • rib
  • rib cage
  • scapula
  • sternum
  • intestine
  • kidney
  • large intestine
  • anus
  • ovary
  • pelvis
  • penis
  • placenta
  • prostate
  • rectum
  • testicle
  • ureter
  • uterus
  • vagina
  • vulva
  • ankle
  • arm
  • digit
  • elbow
  • femur
  • fibula
  • finger
  • foot
  • forearm
  • hand
  • hip
  • humerus
  • knee
  • lower limb
  • radius
  • shin
  • shoulder
  • thigh
  • tibia
  • toe
  • ulna
  • upper limb
  • wrist
  • blood
  • blood vessel
  • hair
  • peripheral nerve
  • peripheral nervous system
  • red blood cell
  • skin
  • spinal column
  • spinal cord
  • vertebrae
genes like me logo Genes that share expression patterns with POMGNT1: view

Primer Products

No data available for mRNA differential expression in normal tissues and Protein tissue co-expression partners for POMGNT1 Gene

Orthologs for POMGNT1 Gene

This gene was present in the common ancestor of animals.

Orthologs for POMGNT1 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia POMGNT1 34
  • 100 (a)
(Canis familiaris)
Mammalia POMGNT1 33 34
  • 93.84 (n)
(Bos Taurus)
Mammalia POMGNT1 33 34
  • 93.64 (n)
(Mus musculus)
Mammalia Pomgnt1 33 16 34
  • 92.37 (n)
(Rattus norvegicus)
Mammalia Pomgnt1 33
  • 91.97 (n)
(Monodelphis domestica)
Mammalia POMGNT1 34
  • 81 (a)
(Ornithorhynchus anatinus)
Mammalia POMGNT1 34
  • 66 (a)
(Gallus gallus)
Aves POMGNT1 33 34
  • 77.83 (n)
(Anolis carolinensis)
Reptilia POMGNT1 34
  • 80 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia pomgnt1 33
  • 71.81 (n)
Str.11459 33
(Danio rerio)
Actinopterygii pomgnt1 33 34
  • 72.27 (n)
(Caenorhabditis elegans)
Secernentea gly-12 34
  • 19 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 45 (a)
Species where no ortholog for POMGNT1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for POMGNT1 Gene

Gene Tree for POMGNT1 (if available)
Gene Tree for POMGNT1 (if available)

Paralogs for POMGNT1 Gene

Paralogs for POMGNT1 Gene

(1) SIMAP similar genes for POMGNT1 Gene using alignment to 3 proteins:

genes like me logo Genes that share paralogs with POMGNT1: view

Variants for POMGNT1 Gene

Sequence variations from dbSNP and Humsavar for POMGNT1 Gene

SNP ID Clin Chr 01 pos Variation AA Info Type
rs1057516318 likely-pathogenic, Muscle eye brain disease 46,194,272(-) A/G splice_donor_variant
rs1057516409 likely-pathogenic, Muscle eye brain disease 46,192,499(-) CCTGGTCATTCCAGCCTACCTGGTCATTCCAG/CCTGGTCATTCCAG coding_sequence_variant, intron_variant, splice_donor_variant
rs1057516477 likely-pathogenic, Muscle eye brain disease 46,196,850(-) C/A splice_acceptor_variant
rs1057516478 likely-pathogenic, Muscle eye brain disease 46,197,759(-) CCAG/TCAC coding_sequence_variant, genic_upstream_transcript_variant, stop_gained, upstream_transcript_variant
rs1057516536 likely-pathogenic, Muscle eye brain disease 46,193,389(-) CT/ splice_acceptor_variant

Structural Variations from Database of Genomic Variants (DGV) for POMGNT1 Gene

Variant ID Type Subtype PubMed ID
esv1137837 CNV insertion 17803354
esv2761743 CNV gain 21179565
esv3306122 CNV mobile element insertion 20981092
esv3326121 CNV insertion 20981092
nsv470711 CNV gain 18288195
nsv527878 CNV gain 19592680
nsv822520 CNV loss 20364138

Variation tolerance for POMGNT1 Gene

Residual Variation Intolerance Score: 22.9% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.67; 45.96% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for POMGNT1 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for POMGNT1 Gene

Disorders for POMGNT1 Gene

MalaCards: The human disease database

(21) MalaCards diseases for POMGNT1 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, Novoseek, and GeneCards


  • Muscular dystrophy-dystroglycanopathy congenital with brain and eye anomalies A3 (MDDGA3) [MIM:253280]: An autosomal recessive disorder characterized by congenital muscular dystrophy, ocular abnormalities, cobblestone lissencephaly, and cerebellar and pontine hypoplasia. Patients present severe congenital myopia, congenital glaucoma, pallor of the optic disks, retinal hypoplasia, mental retardation, hydrocephalus, abnormal electroencephalograms, generalized muscle weakness and myoclonic jerks. Included diseases are the more severe Walker-Warburg syndrome and the slightly less severe muscle-eye-brain disease. {ECO:0000269 PubMed:11709191, ECO:0000269 PubMed:12588800, ECO:0000269 PubMed:12788071, ECO:0000269 PubMed:15207699, ECO:0000269 PubMed:15236414, ECO:0000269 PubMed:15466003, ECO:0000269 PubMed:17030669, ECO:0000269 PubMed:19067344}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Muscular dystrophy-dystroglycanopathy congenital with mental retardation B3 (MDDGB3) [MIM:613151]: An autosomal recessive disorder characterized by congenital muscular dystrophy associated with mental retardation and mild structural brain abnormalities. Clinical features include mental retardation, white matter changes, cerebellar cysts, pontine hypoplasia, myopia, optic atrophy, decreased alpha-dystroglycan on muscle biopsy and increased serum creatine kinase. {ECO:0000269 PubMed:17030669, ECO:0000269 PubMed:19067344, ECO:0000269 PubMed:19299310}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Muscular dystrophy-dystroglycanopathy limb-girdle C3 (MDDGC3) [MIM:613157]: A rare form of limb-girdle muscular dystrophy with normal cognition. Muscle biopsy shows dystrophic changes with variable staining for glycosylated alpha-dystroglycan. {ECO:0000269 PubMed:18195152}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Retinitis pigmentosa 76 (RP76) [MIM:617123]: A form of retinitis pigmentosa, a retinal dystrophy belonging to the group of pigmentary retinopathies. Retinitis pigmentosa is characterized by retinal pigment deposits visible on fundus examination and primary loss of rod photoreceptor cells followed by secondary loss of cone photoreceptors. Patients typically have night vision blindness and loss of midperipheral visual field. As their condition progresses, they lose their far peripheral visual field and eventually central vision as well. RP76 inheritance is autosomal recessive. {ECO:0000269 PubMed:26908613, ECO:0000269 PubMed:27391550}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for POMGNT1

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with POMGNT1: view

No data available for Genatlas for POMGNT1 Gene

Publications for POMGNT1 Gene

  1. Congenital muscular dystrophies with defective glycosylation of dystroglycan: a population study. (PMID: 19299310) Mercuri E … Bertini E (Neurology 2009) 3 4 22 44 58
  2. Loss-of-function of an N-acetylglucosaminyltransferase, POMGnT1, in muscle-eye-brain disease. (PMID: 12788071) Manya H … Endo T (Biochemical and biophysical research communications 2003) 2 3 4 22 58
  3. Cloning and expression of a novel UDP-GlcNAc:alpha-D-mannoside beta1,2-N-acetylglucosaminyltransferase homologous to UDP-GlcNAc:alpha-3-D-mannoside beta1,2-N-acetylglucosaminyltransferase I. (PMID: 11742540) Zhang W … Schachter H (The Biochemical journal 2002) 2 3 4 22 58
  4. Refining genotype phenotype correlations in muscular dystrophies with defective glycosylation of dystroglycan. (PMID: 17878207) Godfrey C … Muntoni F (Brain : a journal of neurology 2007) 3 22 44 58
  5. Structure-function analysis of human protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase 1, POMGnT1. (PMID: 15207699) Akasaka-Manya K … Endo T (Biochemical and biophysical research communications 2004) 3 4 22 58

Products for POMGNT1 Gene

Sources for POMGNT1 Gene

Loading form....