Free for academic non-profit institutions. Other users need a Commercial license

Aliases for POMC Gene

Aliases for POMC Gene

  • Proopiomelanocortin 2 3 5
  • Opiomelanocortin Prepropeptide 2 3
  • Adrenocorticotropic Hormone 2 3
  • Corticotropin-Lipotropin 3 4
  • Adrenocorticotropin 2 3
  • Beta-Endorphin 2 3
  • Corticotropin-Like Intermediary Peptide 3
  • Alpha-Melanocyte Stimulating Hormone 2
  • Alpha-Melanocyte-Stimulating Hormone 3
  • Beta-Melanocyte Stimulating Hormone 2
  • Beta-Melanocyte-Stimulating Hormone 3
  • Proopiomelanocortin Preproprotein 3
  • Pro-Opiomelanocortin 3
  • Melanotropin Alpha 3
  • Melanotropin Gamma 3
  • Pro-ACTH-Endorphin 3
  • Melanotropin Beta 3
  • Lipotropin Gamma 3
  • Beta-Lipotropin 2
  • Lipotropin Beta 3
  • Met-Enkephalin 3
  • Alpha-MSH 3
  • Gamma-LPH 3
  • Gamma-MSH 3
  • Beta-LPH 3
  • Beta-MSH 3
  • CLIP 3
  • ACTH 3
  • LPH 3
  • MSH 3
  • NPP 3
  • POC 3

External Ids for POMC Gene

Previous GeneCards Identifiers for POMC Gene

  • GC02M025305
  • GC02M025476
  • GC02M025358
  • GC02M025295
  • GC02M025383
  • GC02M025121

Summaries for POMC Gene

Entrez Gene Summary for POMC Gene

  • This gene encodes a preproprotein that undergoes extensive, tissue-specific, post-translational processing via cleavage by subtilisin-like enzymes known as prohormone convertases. There are eight potential cleavage sites within the preproprotein and, depending on tissue type and the available convertases, processing may yield as many as ten biologically active peptides involved in diverse cellular functions. The encoded protein is synthesized mainly in corticotroph cells of the anterior pituitary where four cleavage sites are used; adrenocorticotrophin, essential for normal steroidogenesis and the maintenance of normal adrenal weight, and lipotropin beta are the major end products. In other tissues, including the hypothalamus, placenta, and epithelium, all cleavage sites may be used, giving rise to peptides with roles in pain and energy homeostasis, melanocyte stimulation, and immune modulation. These include several distinct melanotropins, lipotropins, and endorphins that are contained within the adrenocorticotrophin and beta-lipotropin peptides. The antimicrobial melanotropin alpha peptide exhibits antibacterial and antifungal activity. Mutations in this gene have been associated with early onset obesity, adrenal insufficiency, and red hair pigmentation. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jan 2016]

GeneCards Summary for POMC Gene

POMC (Proopiomelanocortin) is a Protein Coding gene. Diseases associated with POMC include Obesity, Adrenal Insufficiency, And Red Hair Due To Pomc Deficiency and Obesity. Among its related pathways are Peptide ligand-binding receptors and Development_Leptin signaling via JAK/STAT and MAPK cascades. GO annotations related to this gene include receptor binding and G-protein coupled receptor binding.

UniProtKB/Swiss-Prot for POMC Gene

  • ACTH stimulates the adrenal glands to release cortisol.

  • MSH (melanocyte-stimulating hormone) increases the pigmentation of skin by increasing melanin production in melanocytes.

  • Beta-endorphin and Met-enkephalin are endogenous opiates.

Tocris Summary for POMC Gene

  • Melanocortin receptors are activated by members of the melanocortin family: alpha-, beta- and gamma-melanocyte stimulating hormone (MSH) and adrenocorticotropic hormone (ACTH). The melanocortins are involved in a range of physiological functions, including pigmentation and inflammation.

Gene Wiki entry for POMC Gene

No data available for CIViC summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for POMC Gene

Genomics for POMC Gene

Regulatory Elements for POMC Gene

Enhancers for POMC Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH02G025160 0.8 Ensembl ENCODE 23.3 +7.5 7451 1.4 CTCF POLR2A ZBTB33 CREM GABPA POMC GC02M025161 GC02M025162
GH02G025249 1.6 FANTOM5 ENCODE dbSUPER 11.1 -83.1 -83098 4.6 HDGF PKNOX1 MLX ZFP64 ARID4B SIN3A DMAP1 SLC30A9 ZNF207 FOS POMC ADCY3 EFR3B GC02P025255 GC02M025233 PIR34629
GH02G025077 1.5 Ensembl ENCODE dbSUPER 10.8 +90.3 90345 1.3 PKNOX1 SIN3A FEZF1 ZNF2 GTF3C2 GLIS2 GATA2 FOS SP3 JUNB ADCY3 POMC LINC01381 SUCLA2P3 RN7SL856P
GH02G025165 0.7 Ensembl 22.8 +2.7 2667 0.5 CTCF MAZ ZNF654 IRF3 TRIM22 MNT NR3C1 EBF1 RAD21 RELA POMC ADCY3 GC02M025162 GC02M025161
GH02G024970 1.4 ENCODE dbSUPER 10.8 +196.7 196668 3.6 CREB3L1 AGO1 ZFP64 DMAP1 YY1 ZNF143 SP3 NFYC GLIS1 RCOR2 ADCY3 EFR3B LINC01381 POMC DNAJC27 PTRHD1 GC02M025008 ENSG00000207069
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around POMC on UCSC Golden Path with GeneCards custom track

Genomic Location for POMC Gene

Chromosome:
2
Start:
25,160,853 bp from pter
End:
25,168,903 bp from pter
Size:
8,051 bases
Orientation:
Minus strand

Genomic View for POMC Gene

Genes around POMC on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
POMC Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for POMC Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for POMC Gene

Proteins for POMC Gene

  • Protein details for POMC Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P01189-COLI_HUMAN
    Recommended name:
    Pro-opiomelanocortin
    Protein Accession:
    P01189
    Secondary Accessions:
    • P78442
    • Q53T23
    • Q9UD39
    • Q9UD40

    Protein attributes for POMC Gene

    Size:
    267 amino acids
    Molecular mass:
    29424 Da
    Quaternary structure:
    No Data Available

    Three dimensional structures from OCA and Proteopedia for POMC Gene

neXtProt entry for POMC Gene

Post-translational modifications for POMC Gene

  • O-glycosylated; reducing sugar is probably N-acetylgalactosamine.
  • Specific enzymatic cleavages at paired basic residues yield the different active peptides.
  • Glycosylation at Thr71 and Asn91
  • Modification sites at PhosphoSitePlus

Antibody Products

  • Cell Signaling Technology (CST) Antibodies for POMC (POMC)

Assay Products

No data available for DME Specific Peptides for POMC Gene

Domains & Families for POMC Gene

Gene Families for POMC Gene

Suggested Antigen Peptide Sequences for POMC Gene

Graphical View of Domain Structure for InterPro Entry

P01189

UniProtKB/Swiss-Prot:

COLI_HUMAN :
  • Belongs to the POMC family.
Family:
  • Belongs to the POMC family.
genes like me logo Genes that share domains with POMC: view

Function for POMC Gene

Molecular function for POMC Gene

GENATLAS Biochemistry:
proopio-melanocortin (adrenocorticotropin/ beta-lipotropin)
UniProtKB/Swiss-Prot Function:
ACTH stimulates the adrenal glands to release cortisol.
UniProtKB/Swiss-Prot Function:
MSH (melanocyte-stimulating hormone) increases the pigmentation of skin by increasing melanin production in melanocytes.
UniProtKB/Swiss-Prot Function:
Beta-endorphin and Met-enkephalin are endogenous opiates.

Gene Ontology (GO) - Molecular Function for POMC Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001664 G-protein coupled receptor binding IDA 19452503
GO:0005102 receptor binding IMP 9620771
GO:0005179 hormone activity ISS --
GO:0031781 type 3 melanocortin receptor binding IPI 19743876
GO:0031782 type 4 melanocortin receptor binding IPI 19743876
genes like me logo Genes that share ontologies with POMC: view
genes like me logo Genes that share phenotypes with POMC: view

Human Phenotype Ontology for POMC Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for POMC Gene

MGI Knock Outs for POMC:

Animal Model Products

miRNA for POMC Gene

miRTarBase miRNAs that target POMC

Inhibitory RNA Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for POMC Gene

Localization for POMC Gene

Subcellular locations from UniProtKB/Swiss-Prot for POMC Gene

Secreted.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for POMC gene
Compartment Confidence
extracellular 5
peroxisome 5
mitochondrion 3
nucleus 3
plasma membrane 2
cytoskeleton 2
endoplasmic reticulum 2
cytosol 2
lysosome 2
golgi apparatus 2
endosome 1

Gene Ontology (GO) - Cellular Components for POMC Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005576 extracellular region TAS --
GO:0005615 extracellular space IDA 9620771
GO:0005737 cytoplasm ISS --
GO:0030141 secretory granule ISS --
GO:0034774 secretory granule lumen TAS --
genes like me logo Genes that share ontologies with POMC: view

Pathways & Interactions for POMC Gene

genes like me logo Genes that share pathways with POMC: view

SIGNOR curated interactions for POMC Gene

Activates:
Is activated by:

Gene Ontology (GO) - Biological Process for POMC Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006091 generation of precursor metabolites and energy IMP 9620771
GO:0007165 signal transduction IMP 9620771
GO:0007218 neuropeptide signaling pathway IEA --
GO:0007267 cell-cell signaling IMP 9620771
GO:0008217 regulation of blood pressure ISS --
genes like me logo Genes that share ontologies with POMC: view

Drugs & Compounds for POMC Gene

(104) Drugs for POMC Gene - From: DrugBank, ClinicalTrials, ApexBio, Tocris, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Loperamide Approved Pharma Target, modulator 145
dihydromorphine Experimental, Illicit Pharma Full agonist, Agonist, Target, agonist 0
Etorphine Illicit, Vet_approved Pharma Full agonist, Agonist, Target 0
Adrenocorticotropic Hormone Pharma 164
beta-endorphin Pharma Full agonist, Agonist 140

(41) Additional Compounds for POMC Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs

(5) Tocris Compounds for POMC Gene

Compound Action Cas Number
ACTH (1-39) Potent endogenous MC2 agonist 12279-41-3
BMS 470539 dihydrochloride Potent, selective MC1 receptor agonist 457893-92-4
Melanotan II High affinity melanocortin receptor agonist 121062-08-6
ML 00253764 hydrochloride Melanocortin MC4 receptor antagonist; brain penetrant 1706524-94-8
SHU 9119 MC3 and MC4 antagonist; MC5 partial agonist 168482-23-3

(1) ApexBio Compounds for POMC Gene

Compound Action Cas Number
Beta-Lipotropin (1-10), porcine Morphine-like substance 77875-68-4
genes like me logo Genes that share compounds with POMC: view

Drug Products

Transcripts for POMC Gene

Unigene Clusters for POMC Gene

Proopiomelanocortin:
Representative Sequences:

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for POMC Gene

ExUns: 1a · 1b ^ 2 ^ 3a · 3b ^ 4
SP1:
SP2: -
SP3: - -
SP4: -

Relevant External Links for POMC Gene

GeneLoc Exon Structure for
POMC
ECgene alternative splicing isoforms for
POMC

Expression for POMC Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for POMC Gene

mRNA differential expression in normal tissues according to GTEx for POMC Gene

This gene is overexpressed in Pituitary (x52.5).

Protein differential expression in normal tissues from HIPED for POMC Gene

This gene is overexpressed in Urine (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for POMC Gene



Protein tissue co-expression partners for POMC Gene

NURSA nuclear receptor signaling pathways regulating expression of POMC Gene:

POMC

SOURCE GeneReport for Unigene cluster for POMC Gene:

Hs.1897

mRNA Expression by UniProt/SwissProt for POMC Gene:

P01189-COLI_HUMAN
Tissue specificity: ACTH and MSH are produced by the pituitary gland.

Evidence on tissue expression from TISSUES for POMC Gene

  • Nervous system(4.8)
  • Adrenal gland(4)
  • Blood(3.7)
  • Thyroid gland(2.6)
  • Skin(2.5)
  • Urine(2.5)
  • Heart(2.4)
  • Pancreas(2.4)
  • Kidney(2.1)
  • Liver(2.1)
  • Intestine(2)
  • Lung(2)
  • Muscle(2)

Phenotype-based relationships between genes and organs from Gene ORGANizer for POMC Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • cardiovascular
  • digestive
  • endocrine
  • immune
  • integumentary
  • lymphatic
  • nervous
  • reproductive
  • skeletal muscle
  • skeleton
Organs:
Head and neck:
  • brain
  • ear
  • eye
  • head
  • mouth
Thorax:
  • esophagus
  • heart
Abdomen:
  • abdominal wall
  • adrenal gland
  • biliary tract
  • gallbladder
  • intestine
  • large intestine
  • liver
  • pancreas
  • small intestine
  • spleen
  • stomach
Pelvis:
  • ovary
  • penis
  • testicle
  • uterus
General:
  • blood
  • blood vessel
  • hair
  • lymph node
  • skin
  • white blood cell
genes like me logo Genes that share expression patterns with POMC: view

Primer Products

Orthologs for POMC Gene

This gene was present in the common ancestor of chordates.

Orthologs for POMC Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia POMC 34 35
  • 98.88 (n)
dog
(Canis familiaris)
Mammalia POMC 34 35
  • 87.15 (n)
cow
(Bos Taurus)
Mammalia POMC 34 35
  • 86.56 (n)
rat
(Rattus norvegicus)
Mammalia Pomc 34
  • 83.83 (n)
mouse
(Mus musculus)
Mammalia Pomc 34 16 35
  • 82.7 (n)
oppossum
(Monodelphis domestica)
Mammalia POMC 35
  • 54 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia POMC 35
  • 50 (a)
OneToOne
chicken
(Gallus gallus)
Aves POMC 34 35
  • 67.99 (n)
lizard
(Anolis carolinensis)
Reptilia POMC 35
  • 47 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia pomc 34
  • 63.4 (n)
zebrafish
(Danio rerio)
Actinopterygii pomca 34 35
  • 60 (n)
pomcb 35
  • 35 (a)
OneToMany
pomc 34
Species where no ortholog for POMC was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for POMC Gene

ENSEMBL:
Gene Tree for POMC (if available)
TreeFam:
Gene Tree for POMC (if available)

Paralogs for POMC Gene

No data available for Paralogs for POMC Gene

Variants for POMC Gene

Sequence variations from dbSNP and Humsavar for POMC Gene

SNP ID Clin Chr 02 pos Sequence Context AA Info Type
rs121918111 Pathogenic 25,161,572(-) AGCGC(A/G/T)AGGAC reference, missense, stop-gained
rs121918112 Pathogenic 25,161,734(-) CCTGC(A/T)AGCCC reference, stop-gained
rs746815510 Pathogenic 25,164,752(+) AGCGG(-/CCACCCGAGGGGCCCCCGAGGGCCC/NNNNNNNNNNNNNNNNNNNNNNNNN)CTGCA reference, frameshift-variant
rs753856820 Pathogenic 25,164,783(+) AGGCA(G/T)GCTGA utr-variant-5-prime
rs796065034 Pathogenic 25,161,452(-) ACTTC(-/C)GCTGG reference, frameshift-variant

Structural Variations from Database of Genomic Variants (DGV) for POMC Gene

Variant ID Type Subtype PubMed ID
dgv57n68 CNV loss 17160897
esv33372 CNV loss 17666407
nsv1008732 CNV loss 25217958

Variation tolerance for POMC Gene

Residual Variation Intolerance Score: 62.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 5.53; 72.01% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for POMC Gene

Human Gene Mutation Database (HGMD)
POMC
SNPedia medical, phenotypic, and genealogical associations of SNPs for
POMC

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for POMC Gene

Disorders for POMC Gene

MalaCards: The human disease database

(192) MalaCards diseases for POMC Gene - From: OMIM, ClinVar, GeneTests, Orphanet, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
obesity, adrenal insufficiency, and red hair due to pomc deficiency
  • proopiomelanocortin deficiency
obesity
  • obesity, association with
monogenic non-syndromic obesity, autosomal recessive
obesity susceptibility, pomc-related
  • obesity, early-onset, susceptibility to
cushing's syndrome
  • adrenal cortical adenoma
- elite association - COSMIC cancer census association via MalaCards
Search POMC in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

COLI_HUMAN
  • Obesity (OBESITY) [MIM:601665]: A condition characterized by an increase of body weight beyond the limitation of skeletal and physical requirements, as the result of excessive accumulation of body fat. {ECO:0000269 PubMed:12165561}. Note=Disease susceptibility may be associated with variations affecting the gene represented in this entry.
  • Pro-opiomelanocortinin deficiency (POMCD) [MIM:609734]: Affected individuals present early-onset obesity, adrenal insufficiency and red hair. {ECO:0000269 PubMed:9620771}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Genatlas disease for POMC Gene

early-onset obesity,adrenal insufficiency and red hair pigmentation

Relevant External Links for POMC

Genetic Association Database (GAD)
POMC
Human Genome Epidemiology (HuGE) Navigator
POMC
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
POMC
genes like me logo Genes that share disorders with POMC: view

Publications for POMC Gene

  1. Molecular screening of the proopiomelanocortin (POMC) gene in Italian obese children: report of three new mutations. (PMID: 11244459) del Giudice E.M. … Perrone L. (Int. J. Obes. Relat. Metab. Disord. 2001) 3 4 22 46 64
  2. Severe early-onset obesity, adrenal insufficiency and red hair pigmentation caused by POMC mutations in humans. (PMID: 9620771) Krude H. … Grueters A. (Nat. Genet. 1998) 2 3 4 22 64
  3. Colon tumor mutations and epigenetic changes associated with genetic polymorphism: insight into disease pathways. (PMID: 18992263) Slattery M.L. … Samowitz W.S. (Mutat. Res. 2009) 3 22 46 64
  4. Mutational analysis of the pro-opiomelanocortin gene in French obese children led to the identification of a novel deleterious heterozygous mutation located in the alpha-melanocyte stimulating hormone domain. (PMID: 18091355) Dubern B. … Clement K. (Pediatr. Res. 2008) 3 22 46 64
  5. Polymorphisms in genes regulating the HPA axis associated with empirically delineated classes of unexplained chronic fatigue. (PMID: 16610949) Smith A.K. … Rajeevan M.S. (Pharmacogenomics 2006) 3 22 46 64

Products for POMC Gene

Sources for POMC Gene

Content
Loading form....