Home
GeneCards Guide
Suite
- MalaCards
- GeneALaCart
- GeneDecks
- GeneIP
- GeneLoc
Terms and Conditions
- Terms of Use
- 3rd Party Notice
About Us
User Feedback
Mirror sites

Set Analyses:

Generates a file of GeneCards annotations for your list of genes

Advanced Search

Search By

Section (entire)

for

All GeneCards Within gene subset (to enable gene prioritization):
or upload a file of gene symbols

Category Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21

GIFtS
-

POLR1D Gene

protein-coding GIFtS: 61
GCID: GC13P028194

polymerase (RNA) I polypeptide D, 16kDa

Explore 7 diseases affiliated with
POLR1D via

MalaCards

our new
Human Malady Compendium

(According to ¹HGNC, ²Entrez Gene,
³UniProtKB/Swiss-Prot, ⁴UniProtKB/TrEMBL, ⁵OMIM, ⁶GeneLoc, ⁷Ensembl, ⁸DME, ⁹miRBase, and/or ¹⁰fRNAdb)
About This Section

Aliases
Polymerase (RNA) I Polypeptide D, 16kDa¹ ²		RNA Polymerases I And III Subunit AC2² ³
RPA16¹ ² ³ ⁵		TCS2² ⁵
RPAC2¹ ² ⁵		MGC9850¹
RPA9¹ ²		POLR1C²
RPO1-3¹ ²		DNA-Directed RNA Polymerases I And III Subunit RPAC2²
AC19² ³		HRPA19¹
RPC16² ³		RNA Polymerase I 16 KDa Subunit³
DNA-Directed RNA Polymerase I Subunit D² ³

External Ids:	HGNC: 20422¹	Entrez Gene: 51082²	Ensembl: ENSG00000186184⁷	OMIM: 613715⁵	UniProtKB: Q9Y2S0³

Export aliases for POLR1D gene to outside databases

Previous GC identifers: GC13P022176 GC13P027125 GC13P025994 GC13P025993 GC13P027093 GC13P009017

(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for POLR1D:

The protein encoded by this gene is a component of the RNA polymerase I and RNA polymerase III complexes, which

function in the synthesis of ribosomal RNA precursors and small RNAs, respectively. Mutations in this gene are a cause

of Treacher Collins syndrome (TCS), a craniofacial development disorder. Alternative splicing results in multiple

transcript variants. (provided by RefSeq, Apr 2011)

UniProtKB/Swiss-Prot: RPAC2_HUMAN, Q9Y2S0

Function: DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside

triphosphates as substrates. Common core component of RNA polymerases I and III which synthesize ribosomal RNA

precursors and small RNAs, such as 5S rRNA and tRNAs, respectively

Gene Wiki entry for POLR1D

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section

RefSeq DNA sequence:

NC_000013.10 NC_018924.1 NT_024524.14

Regulatory elements:

SABiosciences Regulatory transcription factor binding sites in the POLR1D gene promoter:
AhR FOXI1 Pbx1a Pax-5 Lmo2 Arnt
Other transcription factors

SwitchGear Promoter luciferase reporter plasmid: POLR1D promoter sequence

Search SABiosciences Chromatin IP Primers for POLR1D

Epigenetics:

QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat POLR1D

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 13q12.2 Ensembl cytogenetic band: 13q12.2 HGNC cytogenetic band: 13q12.2

POLR1D Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
POLR1D gene location

GeneLoc information about chromosome 13 GeneLoc Exon Structure

GeneLoc location for GC13P028194: view genomic region (about GC identifiers)

Start:	28,194,903 bp from pter	End:	28,241,548 bp from pter
Size:	46,646 bases	Orientation:	plus strand

(According to ¹UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to ²PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: RPAC2_HUMAN, Q9Y2S0 (See protein sequence)

Recommended Name: DNA-directed RNA polymerases I and III subunit RPAC2

Size: 133 amino acids; 15237 Da

Subunit: Component of the RNA polymerase I (Pol I) and RNA polymerase III (Pol III) complexes consisting of at least 13

and 17 subunits, respectively (By similarity)

Subcellular location: Nucleus (By similarity)

Secondary accessions: Q5TBX2 Q96BR3

Alternative splicing: 2 isoforms: Q9Y2S0-1 Q9Y2S0-2 (Contains a phosphoserine at position 104)

Explore the universe of human proteins at neXtProt for POLR1D: NX_Q9Y2S0

Post-translational modifications:

View modification sites using PhosphoSitePlus²

View neXtProt modification sites for NX_Q9Y2S0

POLR1D Protein expression data from MOPED and PaxDb: About this image

REFSEQ proteins (3 alternative transcripts):

NP_001193488.1 NP_057056.1 NP_689918.1

ENSEMBL proteins:

ENSP00000302478 ENSP00000382604 ENSP00000382603

Reactome Protein details: Q9Y2S0
Human Recombinant Protein Products for POLR1D:

	Browse Purified and Recombinant Proteins at EMD Millipore
	Browse R&D Systems for human recombinant proteins
	Browse recombinant and purified proteins available from Enzo Life Sciences
	OriGene Purified Proteins (see all 2): POLR1D OriGene Protein Over-expression Lysate (see all 2): POLR1D OriGene Custom Protein Services for POLR1D
	GenScript Custom Purified and Recombinant Proteins Services for POLR1D
	Novus Biologicals POLR1D Protein Novus Biologicals POLR1D Lysates
	Browse Sino Biological Recombinant Proteins
	Browse ProSpec Recombinant Proteins
	Uscn Proteins for POLR1D

Gene Ontology (GO): 2 cellular component terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0005654	nucleoplasm	TAS	--
GO:0005736	DNA-directed RNA polymerase I complex	IEA	--

POLR1D for ontologies About GeneDecksing

POLR1D Antibody Products:

	Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
	Browse R&D Systems for Antibodies
	Browse OriGene Antibodies OriGene Custom Antibody Services for POLR1D
	GenScript Custom Superior Antibodies Services for POLR1D
	Novus Biologicals POLR1D Antibodies
	Abcam antibodies for POLR1D
	Uscn Antibodies for POLR1D
	ThermoFisher Antibody for POLR1D

Assay Products for POLR1D:

	Browse Kits and Assays available from EMD Millipore
	OriGene Custom Immunoassay Development Browse OriGene Fluorogenic Cell Assay Kits
	Browse R&D Systems for biochemical assays
	GenScript Custom Assay Services for POLR1D
	Browse Enzo Life Sciences for kits & assays
	Uscn ELISAs and CLIAs for POLR1D

(According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section

POLR1D for domains About GeneDecksing

2 InterPro domains/families:

IPR008193 RNA_pol_Rpb11_13-16kDa_CS

IPR009025 DNA-dir_RNA_pol_RBP11-like

Graphical View of Domain Structure for InterPro Entry Q9Y2S0

ProtoNet protein and cluster: Q9Y2S0

1 Blocks protein family: IPB008193 DNA-directed RNA polymerase

UniProtKB/Swiss-Prot: RPAC2_HUMAN, Q9Y2S0

Similarity: Belongs to the archaeal RpoL/eukaryotic RPB11/RPC19 RNA polymerase subunit family

(According to ¹UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or ²DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory,
bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, Sirion Biotech, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, Sirion Biotech, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
About This Section

Molecular Function:

UniProtKB/Swiss-Prot Summary: RPAC2_HUMAN, Q9Y2S0

Function: DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside

triphosphates as substrates. Common core component of RNA polymerases I and III which synthesize ribosomal RNA

precursors and small RNAs, such as 5S rRNA and tRNAs, respectively

Gene Ontology (GO): 2 molecular function terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0003677	DNA binding	IEA	--
GO:0003899	DNA-directed RNA polymerase activity	IEA	--

POLR1D for ontologies About GeneDecksing

Animal Models:

inGenious Targeting Laboratory - Customizable classic, inducible, and humanized mouse model solutions for POLR1D

miRNA Products:		OriGene 3'-UTR Clone: POLR1D Browse MicroRNA Expression Plasmids
		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat POLR1D
		8/20 QIAGEN miScript miRNA Assays for microRNAs that regulate POLR1D (see all 20):
		hsa-miR-30c hsa-miR-3685 hsa-miR-539 hsa-miR-29a hsa-miR-29c hsa-miR-578 hsa-miR-488 hsa-miR-30d

		SwitchGear 3'UTR luciferase reporter plasmid: POLR1D 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for POLR1D OriGene shRNA RFP: POLR1D OriGene siRNA: POLR1D
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat POLR1D
		Sirion Biotech Custom design and validation of potent shRNA sequences against POLR1D

Gene Editing Products:			DNA2.0 Custom Protein Engineering Service for POLR1D
			Sirion Biotech Customized adenovirus for overexpression of POLR1D Sirion Biotech Customized adenovirus for potent knockdown of POLR1D

Clone Products:		Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for POLR1D (see all 4) OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for POLR1D (see all 3) OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector (see all 3): POLR1D (NM_015972)
		Browse Sino Biological Human cDNA Clones
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for POLR1D
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat POLR1D

Cell Line Products:		GenScript Custom overexpressing Cell Line Services for POLR1D
		Search LifeMap BioReagents cell lines for POLR1D
		Sirion Biotech Customized stable knockdown cell line services for POLR1D Sirion Biotech Customized inducible knockdown cell line services for POLR1D Sirion Biotech Customized stable overexpressing cell line services for POLR1D Sirion Biotech Customized inducible overexpressing cell line services for POLR1D

In Situ Assay
Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for POLR1D

(Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to ¹UniProtKB, ²MINT, ³I2D, and/or ⁴STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
About This Section

Unified GeneCards pathways - 5/10 super-pathways (see all 10) About this table

See pathways by source

Super-pathway

contained gene-specific pathways

RNA Polymerase III Transcription Initiation

8/10 pathways (see all 10)
RNA Polymerase III Transcription Initiation	1.00	RNA Polymerase III Transcription Initiation From Type 2 Promoter	0.74
RNA Polymerase III Abortive And Retractive Initiation	1.00	RNA Polymerase I, RNA Polymerase III, and Mitochondrial Transcription	0.59
RNA Polymerase III Transcription	1.00	RNA Polymerase III Chain Elongation	0.51
RNA Polymerase III Transcription Initiation From Type 3 Promoter	0.80	RNA Polymerase III Transcription Termination	0.51

RNA Polymerase I Chain Elongation

RNA Polymerase I Chain Elongation	1.00	RNA Polymerase I Transcription Termination	0.90
RNA Polymerase I Promoter Escape	0.95	RNA Polymerase I Promoter Clearance	0.86
RNA Polymerase I Transcription Initiation	0.90	RNA Polymerase I Transcription	0.79

ATP/ITP metabolism

ATP/ITP metabolism

1.00

ATP/ITP metabolism

0.98

Purine metabolism

Purine metabolism

1.00

Pyrimidine metabolism

0.38

Transcription

Transcription

1.00

Pathway sources
See GeneCards unified pathways
Show all pathways

1 EMD Millipore Pathway for POLR1D

ATP/ITP metabolism

1 GeneGo (Thomson Reuters) Pathway for POLR1D

ATP/ITP metabolism

2 BioSystems Pathways for POLR1D

	Eukaryotic Transcription Initiation
	TNF-alpha/NF-kB Signaling Pathway

5/17 Reactome Pathways for POLR1D (see all 17)

	RNA Polymerase III Transcription Initiation
	RNA Polymerase III Transcription Initiation From Type 3 Promoter
	RNA Polymerase III Chain Elongation
	RNA Polymerase I Promoter Escape
	RNA Polymerase I, RNA Polymerase III, and Mitochondrial Transcription

5 Kegg Pathways (Kegg details for POLR1D):

	Purine metabolism
	Pyrimidine metabolism
	Metabolic pathways
	RNA polymerase
	Cytosolic DNA-sensing pathway

POLR1D for pathways About GeneDecksing

Interactions:

Search SABiosciences Gene Network Central^TM Interacting Genes and Proteins Networks for POLR1D

STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

5/155 Interacting proteins for POLR1D (Q9Y2S0^{2, 3} ENSP00000302478⁴) via UniProtKB, MINT, STRING, and/or I2D (see all 155)

Interactant		Interaction Details
GeneCard	External ID(s)	Interaction Details
HIST1H4A	P62805³	I2D: score=4
HIST1H4B	P62805³	I2D: score=4
HIST1H4C	P62805³	I2D: score=4
HIST1H4D	P62805³	I2D: score=4
HIST1H4E	P62805³	I2D: score=4

About this table

Gene Ontology (GO): 5/8 biological process terms (GO ID links to tree view) (see all 8): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0006360	transcription from RNA polymerase I promoter	TAS	--
GO:0006361	transcription initiation from RNA polymerase I promoter	TAS	--
GO:0006362	transcription elongation from RNA polymerase I promoter	TAS	--
GO:0006363	termination of RNA polymerase I transcription	TAS	--
GO:0006383	transcription from RNA polymerase III promoter	TAS	--

POLR1D for ontologies About GeneDecksing

(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
About This Section

EMD Millipore small molecules for POLR1D:
Small Molecule - inhibitor

Browse drugs & compounds from Enzo Life Sciences

Browse Tocris compounds for POLR1D

6 HMDB Compounds for POLR1D About this table

Compound	Synonyms	CAS #	PubMed Ids
Adenosine triphosphate	5'-(tetrahydrogen triphosphate) Adenosine (see all 24)	56-65-5	--
Cytidine triphosphate	cytidine 5'-(tetrahydrogen triphosphate) (see all 15)	65-47-4	--
Guanosine triphosphate	5'-GTP (see all 10)	86-01-1	--
Phosphoric acid	acide phosphorique (FRENCH) (see all 20)	7664-38-2	--
Pyrophosphate	(4-)Diphosphoric acid ion (see all 10)	14000-31-8	--
Uridine triphosphate	5'-UTP (see all 7)	63-39-8	--

Search CenterWatch for drugs/clinical trials and news about POLR1D / RPAC2

(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
RNAi Products from EMD Millipore,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, Sirion Biotech, microRNA from QIAGEN,
Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
About This Section

REFSEQ mRNAs for POLR1D gene (3 alternative transcripts):

NM_001206559.1 NM_015972.3 NM_152705.2

Unigene Cluster for POLR1D:

Polymerase (RNA) I polypeptide D, 16kDa

Hs.507584 [show with all ESTs]

Unigene Representative Sequence: NM_001206559

6 Ensembl transcripts including schematic representations, and UCSC links where relevant:

ENST00000302979(uc001uro.3) ENST00000399697(uc010aam.3 uc001urp.3 uc001urq.3)

ENST00000465887 ENST00000489647 ENST00000472179 ENST00000399696

miRNA Products:		OriGene 3'-UTR Clone: POLR1D Browse OriGene MicroRNA Expression Plasmids
		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat POLR1D
		8/20 QIAGEN miScript miRNA Assays for microRNAs that regulate POLR1D (see all 20):
		hsa-miR-30c hsa-miR-3685 hsa-miR-539 hsa-miR-29a hsa-miR-29c hsa-miR-578 hsa-miR-488 hsa-miR-30d

		SwitchGear 3'UTR luciferase reporter plasmid: POLR1D 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for POLR1D OriGene shRNA RFP: POLR1D OriGene siRNA: POLR1D
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat POLR1D
		Sirion Biotech Custom design and validation of potent shRNA sequences against POLR1D

Clone Products:		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for POLR1D (see all 4) OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for POLR1D (see all 3) OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector (see all 3): POLR1D (NM_015972)
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for POLR1D
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat POLR1D

Primer Products:		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for POLR1D Browse OriGene validated miRNA SYBR primer pairs
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat POLR1D
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat POLR1D
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat POLR1D

Additional cDNA sequence:

AF077044.1 AK000623.1 AK097973.1 AK307356.1 AK311833.1 BC000889.1 BC006972.1 BC015319.2

BC018528.1 BC054519.1

15 DOTS entries:

DT.118938 DT.454517 DT.120775982 DT.120776064 DT.100659869 DT.95374196 DT.100707580 DT.100022133

DT.439378 DT.100026787 DT.97766265 DT.118941 DT.120776076 DT.95375465 DT.40283150

24/427 AceView cDNA sequences (see all 427):

AA082454 CR620465 AI783487 CD671876 BM693721 BM544526 AI092321 BU785507

CK905617 AA133389 BE396581 BX375953 AI628440 CR607937 BG251152 AA814895

BG568940 BE566061 CA388884 BU947724 AA765094 AA581669 BQ180879 AL138217

GeneLoc Exon Structure

5 Alternative Splicing Database (ASD) splice patterns (SP) for POLR1D About this scheme

ExUns:	1	^	2a	·	2b	·	2c	^	3	^	4	^	5a	·	5b	^	6a	·	6b	·	6c
SP1:									-						-
SP2:			-		-		-		-				-		-
SP3:									-				-		-
SP4:									-
SP5:

ECgene alternative splicing isoforms for POLR1D

(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

POLR1D expression in normal human tissues (normalized intensities)
See probesets specificity/sensitivity at GeneAnnot
About this imageBioGPS
CGAP TAG: TGCTTGACAA

About this image

POLR1D expression in embryonic tissues and stem cells
Expression by the Database of Embryonic development, Stem cell research, and Regenerative medicine About this table

1 LifeMap In Vivo Development Anatomical Compartment/Cell

Tissue

Anatomical Compartment

Cell

Category (developmental path)

Ovary

Primary Follicle

Primary Oocyte

Female Gametocytes, Germ Cells

Expression:

Positive

Negative

Selective marker

Experimental details:

Curated

Microarrays

In-situ hybridization

See POLR1D Protein Expression from SPIRE MOPED and PaxDB
Genevestigator expression for POLR1D

SOURCE GeneReport for Unigene cluster: Hs.507584

SABiosciences Custom PCR Arrays for POLR1D

Primer Products:		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for POLR1D Browse OriGene validated miRNA SYBR primer pairs
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat POLR1D
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat POLR1D
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat POLR1D

In Situ
Assay Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for POLR1D

(Orthologs according to ^1,2HomoloGene (²older version, for species not in ¹newer version), ³euGenes, ⁴SGD , ⁵MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or ⁶Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section

This gene was present in the common ancestor of eukaryotes.

Orthologs for POLR1D gene from 8/27 species (see all 27) About this table

Organism	Taxonomic classification	Gene	Description	Human Similarity	Orthology Type	Details
mouse (Mus musculus)	Mammalia	Polr1d^{1 , 5}	polymerase (RNA) I polypeptide D^{1, 5}	92.48(n)¹ 90.23(a)¹		5 (86.73 cM)⁵ 20018¹ NM_009087.1¹ NP_033113.1¹ 147077050⁵
chicken (Gallus gallus)	Aves	POLR1D¹	polymerase (RNA) I polypeptide D, 16kDa	74.69(n) 78.7(a)		428713 XM_426271.3 XP_426271.2
lizard (Anolis carolinensis)	Reptilia	POLR1D⁶	--	68(a)	1 ↔ 1	GL343202.1(1813776-1817457)
zebrafish (Danio rerio)	Actinopterygii	polr1d¹	polymerase (RNA) I polypeptide D	67.27(n) 66.36(a)		445412 NM_001003888.1 NP_001003888.1
fruit fly (Drosophila melanogaster)	Insecta	l(2)37Cg⁶	lethal (2) 37Cg	33(a)	1 ↔ 1	2L(19133023-19135233)
worm (Caenorhabditis elegans)	Secernentea	F58A4.9⁶	Probable DNA-directed RNA polymerases I and III su...	24(a)	1 ↔ 1	III(9629162-9629833)
baker's yeast (Saccharomyces cerevisiae)	Saccharomycetes	RPC19(YNL113W)⁴ RPC19¹	RNA polymerase subunit AC19, common to RNA polymerases more⁴ Rpc19p¹	55.46(n)¹ 45.38(a)¹		14(412771-413199)⁴ 855609^{1, 4} NP_014286.1^{1, 4}
rice (Oryza sativa)	Liliopsida	--	RNA polymerase subunit, putative, expressed	35(a)	1 ↔ 1	12(4859177-4862153)

ENSEMBL Gene Tree for POLR1D (if available)
TreeFam Gene Tree for POLR1D (if available)

(Paralogs according to ¹HomoloGene,
²Ensembl, and ³SIMAP, Pseudogenes according to ⁴Pseudogene.org Build 68)
About This Section

(SNPs/Variants according to the ¹NCBI SNP Database, ²Ensembl, ³PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
About This Section

SNP ID	Valid	Clinical significance	Chr 13 pos	Sequence	#	AA Chg	Type	More	#	Allele freq	Pop	Total sample	More
Genomic Data					Transcription Related Data				Allele Frequencies
				--	--	--		--	--
rs111843093^1,2		--	9014404(+)	`CAAGAT/AGCAAC`	1	--	us2k¹		1		CSA	2
rs71928754^1,2	C	--	9014638(+)	`ACTTT-/GTTATTCATGGCTCAACA AAGCTTTGACAAGCCAAAAAGGATAC`	1	--	us2k¹		0	--	--	--	--
rs113269948^1,2	C	--	9016226(+)	`GGTGTC/TTGCGC`	3	--	ut5¹ us2k¹		2		WA	120
rs618733^1,2	C,F,A	--	9016304(-)	`CCCCCC/ACCCCG`	3	--	ut5¹ us2k¹		3		NA EA	124
rs2232665^1,2	C	--	9016512(+)	`CGGGGA/GCTGGG`	3	--	us2k¹ ut5¹		0	--	--	--	--
rs2232667^1,2	C,H	--	9016589(+)	`GGGAAA/CAGGAA`	3	--	us2k¹ int¹ trp³		0	--	--	--	--
rs2232668^1,2	C	--	9016651(+)	`AAAGGA/TTAAGG`	3	--	int¹ us2k¹		2		WA	120
rs2232671^1,2		--	9016781(+)	`ACCTTC/TGTATT`	3	--	us2k¹ int¹ ese³		0	--	--	--	--
rs11617035^1,2	H	--	9016782(+)	`CCTTCA/GTATTC`	3	--	us2k¹ int¹ ese³		0	--	--	--	--
rs113015696^1,2	C	--	9016818(+)	`CCCCCA/G/TCCCTC`	3	--	int¹ us2k¹		1		CSA	1

HapMap Linkage Disequilibrium report for POLR1D (28194903 - 28241548 bp)
Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
Database of Genomic Variants (DGV) variations for POLR1D: --
Human Gene Mutation Database (HGMD): POLR1D

SABiosciences Cancer Mutation PCR Assays

QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing POLR1D

DNA2.0 Custom Variant and Variant Library Synthesis for POLR1D

(in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
About This Section

POLR1D for disorders           About GeneDecksing

OMIM gene information: 613715
OMIM disorders: 613717
UniProtKB/Swiss-Prot: RPAC2_HUMAN, Q9Y2S0

Defects in POLR1D are the cause of Treacher Collins syndrome type 2 (TCS2) [MIM:613717]. A form of Treacher

Collins syndrome, a disorder of craniofacial development. Treacher Collins syndrome is characterized by a combination

of bilateral downward slanting of the palpebral fissures, colobomas of the lower eyelids with a paucity of eyelashes

medial to the defect, hypoplasia of the facial bones, cleft palate, malformation of the external ears, atresia of the

external auditory canals, and bilateral conductive hearing loss

7 diseases for POLR1D: About MalaCards

treacher collins syndrome central nervous system disease nervous system disease coloboma

kidney disease colorectal cancer malaria

1 disease from the University of Copenhagen DISEASES database for POLR1D:

Treacher Collins syndrome

Human Genome Epidemiology (HuGE) Navigator: POLR1D (4 documents)

Export disorders for POLR1D gene to outside databases

(in PubMed. Associations of this gene to articles via ¹Entrez Gene, ²UniProtKB/Swiss-Prot, ³HGNC, ⁴GAD, ⁵PharmGKB, ⁶HMDB, ⁷DrugBank, ⁸UniProtKB/TrEMBL, ⁹ Novoseek, and/or ¹⁰fRNAdb)
About This Section

PubMed articles for POLR1D gene, integrated from 9 sources (see all 37):
(articles sorted by number of sources associating them with POLR1D)

Utopia: connect your pdf to the dynamic
world of online information

Characterization of human RNA polymerase III identifies orthologues for Saccharomyces cerevisiae RNA polymerase III subunits. (PubMed id 12391170)^{1, 2, 3} Hu P....Hernandez N. (2002)
Mutations in genes encoding subunits of RNA polymerases I and III cause Treacher Collins syndrome. (PubMed id 21131976)^{1, 2} Dauwerse J.G.... Wieczorek D. (2011)
The DNA sequence and analysis of human chromosome 13. (PubMed id 15057823)^{1, 2} Dunham A.... Ross M.T. (2004)
Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)^{1, 2} Ota T.... Sugano S. (2004)
The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)^{1, 2} Gerhard D.S....Malek J. (2004)
Cloning and functional analysis of cDNAs with open reading frames for 300 previously undefined genes expressed in CD34+ hematopoietic stem/progenitor cells. (PubMed id 11042152)^{1, 3} Zhang Q.-H.... Chen Z. (2000)
A census of human soluble protein complexes. (PubMed id 22939629)¹ Havugimana P.C....Emili A. (2012)
Initial characterization of the human central proteome. (PubMed id 21269460)² Burkard T.R.... Colinge J. (2011)
Mass spectrometric analysis of lysine ubiquitylation r eveals promiscuity at site level. (PubMed id 21139048)¹ Danielsen J.M....Nielsen M.L. (2011)
Systematic and quantitative assessment of the ubiquiti n-modified proteome. (PubMed id 21906983)¹ Kim W....Gygi S.P. (2011)

(in PubMed, OMIM, and NCBI Bookshelf)
About This Section

		AND	OR
Aliases
Free Text

Query String		PubMed OMIM NCBI Bookshelf
	(Note: In FireFox, select the above section and copy using Ctrl-C)

(According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
About This Section

Entrez Gene: 51082	HGNC: 20422	AceView: POLR1D	Ensembl:ENSG00000186184	euGenes: HUgn51082
ECgene: POLR1D	Kegg: 51082	H-InvDB: POLR1D

(According to HUGE)
About This Section

(According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
About This Section

Name	Description
PharmGKB entry for POLR1D	Pharmacogenomics, SNPs, Pathways

Intellectual Property for POLR1D gene
(Patent information from GeneIP, Licensable technologies from WIS Yeda, Salk, Tufts, IP news from LifeMap Sciences, Inc.)

About This Section

Patent Information for POLR1D gene:
Search GeneIP for patents involving POLR1D

GeneCards and IP:
Japan Patent Office Licenses GeneCards European Patent Office Licenses GeneCards Improving the IP Search

(Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript, LifeMap BioReagents, and Sirion Biotech, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory)
About This Section

	Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
	Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
	Browse for Gene Knock-down Tools from EMD Millipore
	Browse Kits and Assays available from EMD Millipore
	EMD Millipore small molecules (inhibitor) for POLR1D
	Browse Purified and Recombinant Proteins at EMD Millipore

	EMD Millipore Custom Antibody & Bulk Services
	EMD Millipore Preclinical / Clinical Development Services
	EMD Millipore Immunoassay Services
	EMD Millipore Target Screening & Profiling Services

	Browse Antibodies		Browse Cell Culture Products
	Browse ELISAs		Browse Flow Cytometry Kits
	Browse Primer Pairs		Browse Kinase Activity Assays/Reagents
	Browse ELISpot Kits/Development Modules		Browse TFB/Immunoprecipitation Assays
	Browse Apoptosis Detection Kits/Reagents		Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents
	Browse DNA Damage/Repair Kits/Reagents		Browse Multiplex/Array Assay Kits/Reagents
	Browse Cell Selection/Detection Kits/Reagents		Browse Secondary Antibodies/Controls/Staining Reagents
	Browse Phosphatase Activity Assays/Reagents		Browse Recombinant/Natural Proteins

	Browse OriGene Antibodies		OriGene shRNA RFP for POLR1D
	OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for POLR1D		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for POLR1D
	OriGene Protein Over-expression Lysate for POLR1D		Browse OriGene Fluorogenic Cell Assay Kits
	OriGene siRNA for POLR1D		OriGene 3'-UTR Clone for POLR1D
	OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for POLR1D		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for POLR1D
	Browse OriGene GFP tagged cDNA clones in CMV expression vector		Browse OriGene MicroRNA Expression Plasmids
	Browse OriGene basic RS shRNAs		Browse OriGene validated miRNA SYBR primer pairs
	OriGene Purified Protein for POLR1D		OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
	OriGene Custom Antibody Services for POLR1D		OriGene Custom Protein Services for POLR1D
	OriGene Custom Immunoassay Development

	QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat POLR1D
	QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing POLR1D
	QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat POLR1D
	QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat POLR1D
	QIAGEN QuantiFast Probe-based Assays in human, mouse, rat POLR1D
	QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat POLR1D

	GenScript Custom Purified and Recombinant Proteins Services for POLR1D		GenScript cDNA clones with any tag delivered in your preferred vector for POLR1D
	GenScript Custom Assay Services for POLR1D		GenScript Custom Superior Antibodies Services for POLR1D
	GenScript Custom overexpressing Cell Line Services for POLR1D		CloneReady with Over 120,000 Genes
	Gene Synthesis: Any Gene in Any Vector		Vector-based siRNA and miRNA, Ready for Transfection
	Gene Mutant Library, Variants up to 10^11		Plasmid Preparation
	Custom Peptide Services

Search for Antibodies & Assays

	Regulatory tfbs in POLR1D promoter
	Search Chromatin IP Primers for POLR1D
	RT² qPCR Primer Assay in human, mouse, rat POLR1D
	Search GNC Networks for POLR1D
	SABiosciences Custom PCR Arrays for POLR1D

Search Tocris compounds for POLR1D

	Browse Sino Biological Proteins and Antibodies
	Browse Sino Biological cDNA Clones
	Antibodies/Proteins Production Services
	Rabbit Monoclonal Antibody Platform
	Bulk Purchasing

Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

	Novus Tissue Slides
	POLR1D antibodies
	POLR1D proteins
	POLR1D lysates

	Antibodies for POLR1D
	See all of Abcam's Antibodies, Kits and Proteins for POLR1D
	Custom Antibody / Protein Production Service
	Bulk Purchasing
	Advantages of Rabbit Monoclonal antibodies
	Abcam protocols and scientific support

Browse ProSpec Recombinant Proteins

POLR1D Proteins, Antibodies, CLIAs, and ELISAs

Search LifeMap BioReagents cell lines for POLR1D

	Gene Synthesis
	Protein Engineering
	Variant Library Synthesis
	Codon Optimization
	Protein Production and Purification

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for POLR1D

	SwitchGear 3'UTR luciferase reporter plasmids for POLR1D
	SwitchGear Promoter luciferase reporter plasmids for POLR1D

ThermoFisher Antibody for POLR1D

Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat POLR1D

inGenious Targeting Laboratory - Customizable classic, inducible, and humanized mouse model solutions for POLR1D

Sirion Biotech Customized:

	stable knockdown cell line services for POLR1D
	inducible knockdown cell line services for POLR1D
	design and validation of potent shRNA sequences against POLR1D
	adenovirus for potent knockdown of POLR1D
	adenovirus for overexpression of POLR1D
	stable overexpressing cell line services for POLR1D
	inducible overexpressing cell line services for POLR1D

GeneCards Homepage - Last full update: 19 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013 , 14 May 2013

View Random Gene

Category			VWF (GIFTS: 73) von Willebrand factor
GIFtS Group

The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

The GeneCards Human Gene Database

Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

Hot genes Disease genes POLR1D gene at Home site.

hostname: 356980-web2.xennexinc.com index build: 106 solr: 1.4

Advanced Search

Export list of displayed genes

POLR1D Gene

polymerase (RNA) I polypeptide D, 16kDa

Aliases
for POLR1D gene

Summaries
for POLR1D gene

Genomic Views
for POLR1D gene

Proteins
for POLR1D gene

Protein Domains /
Families
for POLR1D gene

Function
for POLR1D gene

Pathways & Interactions
for POLR1D gene

Drugs & Compounds
for POLR1D gene

Transcripts
for POLR1D gene

Expression
for POLR1D gene

Orthologs
for POLR1D gene

Paralogs
for POLR1D gene

Genomic Variants
for POLR1D gene

Disorders / Diseases
for POLR1D gene

Publications
for POLR1D gene

External Searches for POLR1D gene

Genome Databases showing POLR1D gene

Other Databases showing POLR1D gene

Specialized Databases showing POLR1D gene

Intellectual Property
for POLR1D gene

Products
for POLR1D gene

View Random Gene

Advanced Search

Export list of displayed genes

POLR1D Gene

polymerase (RNA) I polypeptide D, 16kDa

Aliasesfor POLR1D gene

Summariesfor POLR1D gene

Genomic Viewsfor POLR1D gene

Proteinsfor POLR1D gene

Protein Domains /Familiesfor POLR1D gene

Functionfor POLR1D gene

Pathways & Interactionsfor POLR1D gene

Drugs & Compoundsfor POLR1D gene

Transcriptsfor POLR1D gene

Expression for POLR1D gene

Orthologsfor POLR1D gene

Paralogsfor POLR1D gene

Genomic Variantsfor POLR1D gene

Disorders / Diseasesfor POLR1D gene

Publicationsfor POLR1D gene

External Searches for POLR1D gene

Genome Databases showing POLR1D gene

Other Databases showing POLR1D gene

Specialized Databases showing POLR1D gene

Intellectual Propertyfor POLR1D gene

Productsfor POLR1D gene

View Random Gene

Aliases
for POLR1D gene

Summaries
for POLR1D gene

Genomic Views
for POLR1D gene

Proteins
for POLR1D gene

Protein Domains /
Families
for POLR1D gene

Function
for POLR1D gene

Pathways & Interactions
for POLR1D gene

Drugs & Compounds
for POLR1D gene

Transcripts
for POLR1D gene

Expression
for POLR1D gene

Orthologs
for POLR1D gene

Paralogs
for POLR1D gene

Genomic Variants
for POLR1D gene

Disorders / Diseases
for POLR1D gene

Publications
for POLR1D gene

Intellectual Property
for POLR1D gene

Products
for POLR1D gene