Free for academic non-profit institutions. Other users need a Commercial license

Aliases for PODXL Gene

Aliases for PODXL Gene

  • Podocalyxin Like 2 3 5
  • Podocalyxin-Like Protein 1 3 4
  • GCTM-2 Antigen 3 4
  • PCLP-1 3 4
  • Gp200 3 4
  • PCLP 3 4
  • PC 3 4
  • Podocalyxin-Like 2
  • Podocalyxin 3
  • PCLP1 4

External Ids for PODXL Gene

Previous GeneCards Identifiers for PODXL Gene

  • GC07M129527
  • GC07M130587
  • GC07M130601
  • GC07M130642
  • GC07M130835
  • GC07M131185
  • GC07M125500

Summaries for PODXL Gene

Entrez Gene Summary for PODXL Gene

  • This gene encodes a member of the sialomucin protein family. The encoded protein was originally identified as an important component of glomerular podocytes. Podocytes are highly differentiated epithelial cells with interdigitating foot processes covering the outer aspect of the glomerular basement membrane. Other biological activities of the encoded protein include: binding in a membrane protein complex with Na+/H+ exchanger regulatory factor to intracellular cytoskeletal elements, playing a role in hematopoetic cell differentiation, and being expressed in vascular endothelium cells and binding to L-selectin. [provided by RefSeq, Jul 2008]

GeneCards Summary for PODXL Gene

PODXL (Podocalyxin Like) is a Protein Coding gene. Diseases associated with PODXL include Parkinson Disease, Juvenile, Type 2 and Embryonal Carcinoma. Among its related pathways are Primary Focal Segmental Glomerulosclerosis FSGS and Embryonic and Induced Pluripotent Stem Cell Differentiation Pathways and Lineage-specific Markers.

UniProtKB/Swiss-Prot for PODXL Gene

  • Involved in the regulation of both adhesion and cell morphology and cancer progression. Function as an anti-adhesive molecule that maintains an open filtration pathway between neighboring foot processes in the podocyte by charge repulsion. Acts as a pro-adhesive molecule, enhancing the adherence of cells to immobilized ligands, increasing the rate of migration and cell-cell contacts in an integrin-dependent manner. Induces the formation of apical actin-dependent microvilli. Involved in the formation of a preapical plasma membrane subdomain to set up inital epithelial polarization and the apical lumen formation during renal tubulogenesis. Plays a role in cancer development and aggressiveness by inducing cell migration and invasion through its interaction with the actin-binding protein EZR. Affects EZR-dependent signaling events, leading to increased activities of the MAPK and PI3K pathways in cancer cells.

Gene Wiki entry for PODXL Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for PODXL Gene

Genomics for PODXL Gene

Regulatory Elements for PODXL Gene

Enhancers for PODXL Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH07F131602 1.5 FANTOM5 Ensembl ENCODE 14 -47.3 -47314 6.3 PKNOX1 ZNF493 ZFP64 SIN3A ETS1 ZNF121 GATA2 FOS ZNF202 TSHZ1 PODXL PIR56881 GC07P131655
GH07F131585 1.6 FANTOM5 Ensembl ENCODE 12 -28.2 -28219 1.1 HDGF PKNOX1 ATF1 YBX1 BRCA1 GATA2 ZNF548 DEK NCOA1 MEF2D PODXL PIR56881 GC07P131655
GH07F131643 1.2 FANTOM5 10.8 -85.2 -85179 0.4 HDGF ARNT MLX CREB3L1 ZFP64 SIN3A DMAP1 ZNF2 YY1 ZNF302 NDUFB9P2 ENSG00000236386 LOC100130704 LOC101928782 LOC101928807 TSGA13 PODXL GC07P131655 PIR56881
GH07F131521 0.9 Ensembl ENCODE 11.9 +36.1 36081 2.1 GTF2F1 IRF2 ZNF133 TEAD4 ZNF140 MCM7 GTF3C2 PRDM10 IRF1 MYC PODXL MKLN1-AS GC07P131521 GC07M131484
GH07F131580 0.8 Ensembl ENCODE 12.1 -23.7 -23676 2.6 CTCF STAT1 IKZF1 MAX NR2F2 PODXL PIR56881 GC07P131655
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around PODXL on UCSC Golden Path with GeneCards custom track

Genomic Location for PODXL Gene

Chromosome:
7
Start:
131,500,262 bp from pter
End:
131,558,217 bp from pter
Size:
57,956 bases
Orientation:
Minus strand

Genomic View for PODXL Gene

Genes around PODXL on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
PODXL Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for PODXL Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for PODXL Gene

Proteins for PODXL Gene

  • Protein details for PODXL Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    O00592-PODXL_HUMAN
    Recommended name:
    Podocalyxin
    Protein Accession:
    O00592
    Secondary Accessions:
    • A6NHX8
    • Q52LZ7
    • Q53ER6

    Protein attributes for PODXL Gene

    Size:
    558 amino acids
    Molecular mass:
    58635 Da
    Quaternary structure:
    • Monomer; when associated with the membrane raft. Oligomer; when integrated in the apical membrane. Interacts (via the C-terminal PDZ-binding motif DTHL) with SLC9A3R1 (via the PDZ domains); the interaction is not detected in glomerular epithelium cells, take place early in the secretory pathway and is necessary for its apical membrane sorting. Found in a complex with EZR, PODXL and SLC9A3R2. Associates with the actin cytoskeleton through complex formation with EZR and SLC9A3R2. Interacts (via the C-terminal PDZ-binding motif DTHL) with SLC9A3R2 (via the PDZ 1 domain); interaction is detected in glomerular epithelium cells (By similarity). Interacts with EZR.

    Alternative splice isoforms for PODXL Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for PODXL Gene

Post-translational modifications for PODXL Gene

  • N- and O-linked glycosylated. Sialoglycoprotein (By similarity).
  • Glycosylation at Asn 33, Asn 43, Asn 104, Thr 118, Asn 144, Thr 173, Thr 179, Thr 184, Ser 194, Thr 309, Thr 330, Ser 332, Thr 334, Ser 339, Asn 360, Thr 387, Ser 401, and Thr 417
  • Modification sites at PhosphoSitePlus

Other Protein References for PODXL Gene

No data available for DME Specific Peptides for PODXL Gene

Domains & Families for PODXL Gene

Protein Domains for PODXL Gene

InterPro:
Blocks:
ProtoNet:

Suggested Antigen Peptide Sequences for PODXL Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

O00592

UniProtKB/Swiss-Prot:

PODXL_HUMAN :
  • Both the O-glycan-rich domain of the extracellular domain and the C-terminus PDZ-binding motif (DTHL) in the cytoplasmic tail harbor an apical sorting signal. The cytoplasmic domain is necessary for the apical membrane targeting and renal tubulogenesis. The cytoplasmic C-terminus PDZ-binding motif (DTHL) is essential for interaction with SLC9A3R1 and for targeting SLC9A3R1 to the apical cell membrane. The extracellular domain is necessary for microvillus formation (By similarity). The large highly anionic extracellular domain allows to maintain open filtration pathways between neighboring podocyte foot processes.
  • Belongs to the podocalyxin family.
Domain:
  • Both the O-glycan-rich domain of the extracellular domain and the C-terminus PDZ-binding motif (DTHL) in the cytoplasmic tail harbor an apical sorting signal. The cytoplasmic domain is necessary for the apical membrane targeting and renal tubulogenesis. The cytoplasmic C-terminus PDZ-binding motif (DTHL) is essential for interaction with SLC9A3R1 and for targeting SLC9A3R1 to the apical cell membrane. The extracellular domain is necessary for microvillus formation (By similarity). The large highly anionic extracellular domain allows to maintain open filtration pathways between neighboring podocyte foot processes.
Family:
  • Belongs to the podocalyxin family.
genes like me logo Genes that share domains with PODXL: view

No data available for Gene Families for PODXL Gene

Function for PODXL Gene

Molecular function for PODXL Gene

GENATLAS Biochemistry:
podocalyxin-like protein,integral component of the glomerular epithelial cell glycocalyx
UniProtKB/Swiss-Prot Function:
Involved in the regulation of both adhesion and cell morphology and cancer progression. Function as an anti-adhesive molecule that maintains an open filtration pathway between neighboring foot processes in the podocyte by charge repulsion. Acts as a pro-adhesive molecule, enhancing the adherence of cells to immobilized ligands, increasing the rate of migration and cell-cell contacts in an integrin-dependent manner. Induces the formation of apical actin-dependent microvilli. Involved in the formation of a preapical plasma membrane subdomain to set up inital epithelial polarization and the apical lumen formation during renal tubulogenesis. Plays a role in cancer development and aggressiveness by inducing cell migration and invasion through its interaction with the actin-binding protein EZR. Affects EZR-dependent signaling events, leading to increased activities of the MAPK and PI3K pathways in cancer cells.

Gene Ontology (GO) - Molecular Function for PODXL Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 22662192
genes like me logo Genes that share ontologies with PODXL: view
genes like me logo Genes that share phenotypes with PODXL: view

Animal Model Products

miRNA for PODXL Gene

miRTarBase miRNAs that target PODXL

Inhibitory RNA Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for PODXL Gene

Localization for PODXL Gene

Subcellular locations from UniProtKB/Swiss-Prot for PODXL Gene

Apical cell membrane. Cell projection, lamellipodium. Cell projection, filopodium. Cell projection, ruffle. Cell projection, microvillus. Membrane raft. Membrane; Single-pass type I membrane protein. Note=In single attached epithelial cells is restricted to a preapical pole on the free plasma membrane whereas other apical and basolateral proteins are not yet polarized. Colocalizes with SLC9A3R2 at the apical plasma membrane during epithelial polarization. Colocalizes with SLC9A3R1 at the trans-Golgi network (transiently) and at the apical plasma membrane. Its association with the membrane raft is transient. Colocalizes with actin filaments, EZR and SLC9A3R1 in a punctate pattern at the apical cell surface where microvilli form. Colocalizes with EZR and SLC9A3R2 at the apical cell membrane of glomerular epithelium cells (By similarity). Forms granular, punctuated pattern, forming patches, preferentially adopting a polar distribution, located on the migrating poles of the cell or forming clusters along the terminal ends of filipodia establishing contact with the endothelial cells. Colocalizes with the submembrane actin of lamellipodia, particularly associated with ruffles. Colocalizes with vinculin at protrusions of cells. Colocalizes with ITGB1. Colocalizes with PARD3, PRKCI, EXOC5, OCLN, RAB11A and RAB8A in apical membrane initiation sites (AMIS) during the generation of apical surface and luminogenesis (By similarity). {ECO:0000250}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for PODXL gene
Compartment Confidence
plasma membrane 5
extracellular 5
cytoskeleton 5
nucleus 5
endoplasmic reticulum 2
cytosol 2
golgi apparatus 1

Gene Ontology (GO) - Cellular Components for PODXL Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001726 ruffle IDA 18456258
GO:0005615 extracellular space IDA 16502470
GO:0005737 cytoplasm IDA 18456258
GO:0005886 plasma membrane IEA,IDA 18456258
GO:0005887 integral component of plasma membrane TAS 9188463
genes like me logo Genes that share ontologies with PODXL: view

Pathways & Interactions for PODXL Gene

genes like me logo Genes that share pathways with PODXL: view

Pathways by source for PODXL Gene

Gene Ontology (GO) - Biological Process for PODXL Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007155 cell adhesion IEA --
GO:0007162 negative regulation of cell adhesion ISS --
GO:0016477 cell migration IEA,ISS --
GO:0022407 regulation of cell-cell adhesion IEA --
GO:0022408 negative regulation of cell-cell adhesion ISS --
genes like me logo Genes that share ontologies with PODXL: view

No data available for SIGNOR curated interactions for PODXL Gene

Transcripts for PODXL Gene

Unigene Clusters for PODXL Gene

Podocalyxin-like:
Representative Sequences:

Inhibitory RNA Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for PODXL Gene

ExUns: 1 ^ 2a · 2b ^ 3 ^ 4 ^ 5 ^ 6 ^ 7a · 7b · 7c ^ 8 ^ 9a · 9b · 9c · 9d
SP1: - -
SP2: - -
SP3: -
SP4: -
SP5:

Relevant External Links for PODXL Gene

GeneLoc Exon Structure for
PODXL
ECgene alternative splicing isoforms for
PODXL

Expression for PODXL Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and SAGE for PODXL Gene

mRNA differential expression in normal tissues according to GTEx for PODXL Gene

This gene is overexpressed in Kidney - Cortex (x5.5).

Protein differential expression in normal tissues from HIPED for PODXL Gene

This gene is overexpressed in Nasal epithelium (28.2), Breast (11.3), and Urine (6.5).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for PODXL Gene



NURSA nuclear receptor signaling pathways regulating expression of PODXL Gene:

PODXL

SOURCE GeneReport for Unigene cluster for PODXL Gene:

Hs.744213

mRNA Expression by UniProt/SwissProt for PODXL Gene:

O00592-PODXL_HUMAN
Tissue specificity: Glomerular epithelium cell (podocyte).
genes like me logo Genes that share expression patterns with PODXL: view

Primer Products

No data available for Protein tissue co-expression partners for PODXL Gene

Orthologs for PODXL Gene

This gene was present in the common ancestor of chordates.

Orthologs for PODXL Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia PODXL 34 35
  • 98.99 (n)
mouse
(Mus musculus)
Mammalia Podxl 35
  • 44 (a)
OneToOne
dog
(Canis familiaris)
Mammalia PODXL 35
  • 41 (a)
OneToOne
cow
(Bos Taurus)
Mammalia PODXL 35
  • 38 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia PODXL 35
  • 31 (a)
OneToOne
chicken
(Gallus gallus)
Aves PODXL 35
  • 27 (a)
OneToOne
lizard
(Anolis carolinensis)
Reptilia PODXL 35
  • 50 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia Str.9085 34
African clawed frog
(Xenopus laevis)
Amphibia Xl.18470 34
zebrafish
(Danio rerio)
Actinopterygii podxl 35
  • 22 (a)
OneToOne
Species where no ortholog for PODXL was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for PODXL Gene

ENSEMBL:
Gene Tree for PODXL (if available)
TreeFam:
Gene Tree for PODXL (if available)

Paralogs for PODXL Gene

(7) SIMAP similar genes for PODXL Gene using alignment to 5 proteins:

genes like me logo Genes that share paralogs with PODXL: view

No data available for Paralogs for PODXL Gene

Variants for PODXL Gene

Sequence variations from dbSNP and Humsavar for PODXL Gene

SNP ID Clin Chr 07 pos Sequence Context AA Info Type
rs759639123 Likely pathogenic 131,556,270(+) GGGAG(-/GGCGAC/GGCGACGGCGAC/GGCGACGGCGACGGCGACGGC/GGGGCGAC)GGCGA reference, frameshift-variant, cds-indel
rs786204840 Uncertain significance 131,505,926(-) CCTGC(G/T)CCTCG reference, missense
rs869312170 Uncertain significance 131,505,966(-) GCATG(A/C)CCCTC reference, missense
rs869312171 Uncertain significance 131,506,614(-) AGGAA(A/G)TCAGA reference, missense
rs869312172 Uncertain significance 131,509,411(-) CCACC(A/G)ATACC reference, missense

Structural Variations from Database of Genomic Variants (DGV) for PODXL Gene

Variant ID Type Subtype PubMed ID
nsv981580 CNV duplication 23825009
nsv831134 CNV gain 17160897
nsv608424 CNV loss 21841781
nsv473637 CNV novel sequence insertion 20440878
nsv1126809 CNV deletion 24896259
esv7269 CNV gain 19470904
esv2735156 CNV deletion 23290073
esv2735155 CNV deletion 23290073
esv2735154 CNV deletion 23290073
dgv6617n100 CNV gain 25217958

Variation tolerance for PODXL Gene

Residual Variation Intolerance Score: 94.9% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 3.35; 53.80% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for PODXL Gene

Human Gene Mutation Database (HGMD)
PODXL
SNPedia medical, phenotypic, and genealogical associations of SNPs for
PODXL

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for PODXL Gene

Disorders for PODXL Gene

MalaCards: The human disease database

(3) MalaCards diseases for PODXL Gene - From: Orphanet, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
parkinson disease, juvenile, type 2
  • autosomal recessive juvenile parkinson disease 2
embryonal carcinoma
  • primary extragonadal embryonal carcinoma
acute proliferative glomerulonephritis
  • acute glomerulonephritis with lesion of proliferative glomerulonephritis
- elite association - COSMIC cancer census association via MalaCards
Search PODXL in MalaCards View complete list of genes associated with diseases

Relevant External Links for PODXL

Genetic Association Database (GAD)
PODXL
Human Genome Epidemiology (HuGE) Navigator
PODXL
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
PODXL
genes like me logo Genes that share disorders with PODXL: view

No data available for UniProtKB/Swiss-Prot and Genatlas for PODXL Gene

Publications for PODXL Gene

  1. Expression of podocalyxin enhances the adherence, migration, and intercellular communication of cells. (PMID: 18456258) Larrucea S. … Parrilla R. (Exp. Cell Res. 2008) 3 4 22 64
  2. Podocalyxin variants and risk of prostate cancer and tumor aggressiveness. (PMID: 16434482) Casey G. … Witte J.S. (Hum. Mol. Genet. 2006) 3 22 46 64
  3. Human embryonal carcinoma tumor antigen, Gp200/GCTM-2, is podocalyxin. (PMID: 12504081) Schopperle W.M. … DeWolf W.C. (Biochem. Biophys. Res. Commun. 2003) 3 4 22 64
  4. Molecular cloning and characterization of human podocalyxin-like protein. Orthologous relationship to rabbit PCLP1 and rat podocalyxin. (PMID: 9188463) Kershaw D.B. … Wiggins R.C. (J. Biol. Chem. 1997) 3 4 22 64
  5. Evaluation of candidate stromal epithelial cross-talk genes identifies association between risk of serous ovarian cancer and TERT, a cancer susceptibility "hot-spot". (PMID: 20628624) Johnatty S.E. … . (PLoS Genet. 2010) 3 46 64

Products for PODXL Gene

Sources for PODXL Gene

Content
Loading form....