V3 here soon-try beta now


Gene Search (GeneCards Home)	\|	GeneCards Guide	\|	User Feedback	\|	Terms of Use	\|	Notice about third-party sites

PNKP Gene

protein-coding GIFtS: 62

GC19M055056

polynucleotide kinase 3'-phosphatase
Symbol approved by the HUGO Gene Nomenclature Committee (HGNC) database

(According to ¹HGNC, ²Entrez Gene,
³UniProtKB/Swiss-Prot, ⁴UniProtKB/TrEMBL, ⁵OMIM, ⁶GeneLoc , and/or ⁷Ensembl, ⁸miRBase)
About This Section

Aliases
PNK ^¹, ²

Descriptions
DNA 5'-kinase/3'-phosphatase ^³
Homo sapiens polynucleotide kinase 3'-phosphatase (PNKP) ^²
Polynucleotide kinase-3'-phosphatase ^³
polynucleotide kinase 3' phosphatase ^²
polynucleotide kinase 3'-phosphatase ^²
polynucleotide kinase 3-prime-phosphatase ^²

External Ids
HGNC: 9154¹
Entrez Gene: 11284²
UniProtKB: Q96T60³
Ensembl: ENSG00000039650⁷

Search outside databases for aliases for PNKP gene

Previous GC identifers: GC19M051022 GC19M050732 GC19M055040

(According to Entrez Gene, Wikipedia's Gene Wiki,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

UniProtKB/Swiss-Prot: PNKP_HUMAN, Q96T60

Function: Catalyzes the phosphorylation of DNA at 5'-hydroxyl termini and can dephosphorylate its

3'-phosphate termini. Plays an important function in DNA repair following ionizing radiation or

oxidative damage

Gene Wiki entry for PNKP

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 36),
and/or miRBase,
Genomic Views according to UCSC and Ensembl, Transcription factor binding sites according to SABiosciences)
About This Section

Genomic View:

UCSC Golden Path with GeneCards custom track

Transcription factor binding sites upstream to the PNKP gene

Entrez Gene cytogenetic band: 19q13.3-q13.4 Ensembl cytogenetic band: 19q13.33 HGNC cytogenetic band: 19q13.3-q13.4

PNKP Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)

GeneLoc gene densities for chromosome 19 GeneLoc Exon Structure

GeneLoc location for GC19M055056: (about GC identifiers)

Start:	55,056,273 bp from pter
End:	55,062,630 bp from pter
Size:	6,358 bases
Orientation:	minus strand

RefSeq DNA sequence:

NC_000019.8 NT_011109.15

(According to ¹UniProtKB, and/or Ensembl, Phosphorylation sites according to ²Phosphosite, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from Invitrogen, Millipore, Sigma-Aldrich, R&D Systems, Enzo Life Sciences, Abnova, OriGene and/or, Abcam,
Biochemical Assays by Invitrogen, Millipore, R&D Systems, Cell Signaling Technology, and/or Enzo Life Sciences, Ontologies according to Gene Ontology Consortium 01 Apr 2009 and Entrez Gene, Antibodies by Invitrogen, Millipore, Sigma-Aldrich, R&D Systems, Cell Signaling Technology, Abcam, Abnova, and/or Novus Biologicals)
About This Section

UniProtKB/Swiss-Prot: PNKP_HUMAN, Q96T60 (See protein sequence)

Recommended Name: Bifunctional polynucleotide phosphatase/kinase

Size: 521 amino acids; 57076 Da

Subcellular location: Nucleus

Sequence caution: Sequence=AAD47379.1; Type=Frameshift; Positions=Several;

PDB structure from and Proteopedia :

2BRF (3D)

2W3O (3D)

Secondary accessions: Q9P1V2 Q9UKU8 Q9UNF8 Q9UNI0

Post-translational modifications:

Phosphorylated upon DNA damage, probably by ATM or ATR¹

View phosphorylation sites using PhosphoSite²

REFSEQ proteins: NP_009185.2

ENSEMBL proteins:

ENSP00000323511

Human Recombinant Proteins

	Browse Drug Discovery Central at Invitrogen for human recombinant proteins
	Browse Purified and Recombinant Proteins at Millipore
	Browse Human Recombinant Proteins at Sigma-Aldrich
	Browse R&D Systems for human recombinant proteins
	Browse recombinant and purified proteins available from Enzo Life Sciences
	Recombinant Proteins from Abcam (PNK)
	Human Recombinant Proteins from Abnova (PNKP)

Browse Origene for full length recombinant human proteins expressed in human HEK293 cells

2 Gene Ontology (GO) cellular component terms (links to tree view):

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0005634	nucleus	IDA	10446193
GO:0005730	NOT nucleolus	IDA	18029348

About this table

Antibodies for PNKP:

	Browse Antibodies Central at Invitrogen
	Browse Millipore's Extensive Line of Mono- and Polyclonal Antibodies
	Sigma-Aldrich Antibodies for PNKP
	Browse R&D Systems for Antibodies
	Cell Signaling Technology (CST) Antibodies for PNKP (PNK1)
	Antibodies from Abcam (PNK), each with their Abpromise^SM
	Monoclonal and Polyclonal Antibodies from Abnova (PNKP)
	Novus Biologicals Antibodies for PNKP

Assays for PNKP:

	Browse Invitrogen for biochemical assays
	Browse Kits and Assays available from Millipore
	Browse R&D Systems for biochemical assays
	Browse biochemical assays available from Enzo Life Sciences

(According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section

Graphical View of Domain Structure for InterPro Entry Q96T60

ProtoNet protein and cluster: Q96T60

1 Blocks protein family: IPB013954 Polynucleotide kinase 3 phosphatase

UniProtKB/Swiss-Prot: PNKP_HUMAN, Q96T60

Similarity: In the N-terminal section; belongs to the DNA 3' phosphatase family

(According to MGI Jun 06 2009, UniProtKB, IUBMB,and/or Genatlas,
shRNA from OriGene, Sigma-Aldrich, RNAi from Sigma-Aldrich,
RNAi Products, Clones, and Q-PCR Products from Invitrogen, Millipore, OriGene, and/or Abnova, siRNAs from Applied Biosystems, SYBR primers from OriGene, Cell-based Assays from Millipore, Ontologies according to Gene Ontology Consortium 01 Apr 2009 via Entrez Gene.)
About This Section

Inhib. RNA:		Invitrogen RNAi Products for gene knock-down (PNKP)
		Browse for Gene Knock-down Tools from Millipore
		Abnova Chimera RNAi Products for Gene knock-down (PNKP)

OriGene 29mer shRNA kit in GFP-retroviral vector: NM_007254

Applied Biosystems Silencer® siRNAs for PNKP

Sigma-Aldrich siRNA for PNKP

Sigma-Aldrich shRNA Panels and shRNA for PNKP

Explore Sigma-Aldrich super-pooled esiRNAs

Clones:		Invitrogen Clones for PNKP
		Browse Clones for the Expression of Recombinant Proteins Available from Millipore

OriGene GFP tagged cDNA clone in CMV expression vector: NM_007254
Myc/DDK tagged cDNA clone in CMV expression vector: NM_007254
untagged cDNA clones in CMV expression vector (see all 2): NM_007254

Primers:

Browse Quantitative PCR Central at Invitrogen for Q-PCR LUX™ Primers

OriGene genome-wide validated SYBR primer pairs: NM_007254

UniProtKB/Swiss-Prot: PNKP_HUMAN, Q96T60

Function: Catalyzes the phosphorylation of DNA at 5'-hydroxyl termini and can dephosphorylate its

3'-phosphate termini. Plays an important function in DNA repair following ionizing radiation or

oxidative damage

Catalytic activity: A 3'-phosphopolynucleotide + H(2)O = a polynucleotide + phosphate

Catalytic activity: ATP + 5'-dephospho-DNA = ADP + 5'-phospho-DNA

Genatlas biochemistry entry for PNKP:

polynucleotide kinase-3 phosphatase,facilitating DNA repair of DNA strand breaks caused by

oxidative damage

5/12 Gene Ontology (GO) molecular function terms (links to tree view) (see all 12 ):

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0003684	damaged DNA binding	NAS	10446193
GO:0003690	double-stranded DNA binding	TAS	10446193
GO:0004519	endonuclease activity	NAS	10446192
GO:0005515	protein binding	IPI	17353931
GO:0005524	ATP binding	NAS	10446192

About this table

(Pathways according to Invitrogen (maps by GeneGo), Millipore, Cell Signaling Technology, Sigma-Aldrich, KEGG and/or UniProtKB,
Sets of similar genes according to GeneDecks, Proteins Network according to SABiosciences, Interactions according to ¹UniProtKB, ²MINT, and/or ³STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2009 via Entrez Gene.)
About This Section

Gene Network Central^TM Interacting Genes and Proteins Network for PNKP

5/23 Interacting proteins for PNKP (Q96T60^{1, 2} ENSP00000323511³) via UniProtKB, MINT, and/or STRING (see all 23 )

Interactant		Interaction Details
GeneCard	External ID(s)	Interaction Details
XRCC1	P18887¹, ENSP00000262887³	EBI-1045072, EBI-947466 STRING (score=.999)
LIG3	P49916¹, ENSP00000367787³	EBI-1045072, EBI-1753381 STRING (score=.982)
XRCC4	Q13426¹^,², ENSP00000342011³	EBI-1045072, EBI-717592 MINT-51171 MINT-51174 MINT-51172 MINT-51173 MINT-51175 EBI-1045072, EBI-717592 MINT-51171 MINT-51174 MINT-51172 MINT-51173 MINT-51175 STRING (score=.968)
DDX20	Q9UHI6¹	EBI-1045072, EBI-347658
HEATR2	Q86Y56¹	EBI-1045072, EBI-719966

About this table

5/8 Gene Ontology (GO) biological process terms (links to tree view) (see all 8 ):

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0000718	nucleotide-excision repair, DNA damage removal	NAS	10446193
GO:0006261	DNA-dependent DNA replication	NAS	10446192
GO:0006281	DNA repair	IGI	10446192
GO:0006979	response to oxidative stress	IDA	10446192
GO:0009314	response to radiation	TAS	10446192

About this table

(Chemical Compounds according to UniProtKB, Enzo Life Sciences, Sigma-Aldrich, Tocris Bioscience, and/or Novoseek and Drugs according to Enzo Life Sciences and/or PharmGKB)
About This Section

Browse drugs & compounds from Enzo Life Sciences

Browse Small Molecules at Sigma-Aldrich

Browse Tocris compounds for PNKP
4 Novoseek chemical compound relationships for PNKP gene

Compound	Score	Articles	PubMed IDs for Articles with Shared Sentences (# sentences)
polynucleotide	93.00	20	10446192 (2), 11586300 (1), 16982218 (1), 13679147 (1) (see all 17)
phosphonate	78.69	7	16648365 (2), 16982218 (1), 17116430 (1), 10446192 (1) (see all 6)
atp	30.49	3	1621950 (1), 18007613 (1), 10446192 (1)
oxygen	0.00	1	11586300 (1)

About this table

(GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 219 Homo sapiens; Jun 2 2009) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView,
non coding RNAs according to RNAdb,
ESTs according to GeneTide,
exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
RNAi Products from Invitrogen, Millipore, and/or Abnova,
siRNAs from Applied Biosystems, Sigma-Aldrich,
shRNA from Sigma-Aldrich, OriGene,
Tagged/untagged cDNA clones from OriGene,
Expression Assays from Applied Biosystems)
About This Section

Inhib. RNA:		Invitrogen RNAi Products for gene knock-down (PNKP)
		Browse for Gene Knock-down Tools from Millipore
		Abnova Chimera RNAi Products for Gene knock-down (PNKP)

OriGene 29mer shRNA kit in GFP-retroviral vector: NM_007254

Sigma-Aldrich siRNA for PNKP

Sigma-Aldrich shRNA Panels and shRNA for PNKP

Explore Sigma-Aldrich super-pooled esiRNAs

Applied Biosystems Silencer® siRNAs:

NM_007254

REFSEQ mRNAs for PNKP gene:

NM_007254.2

Applied Biosystems TaqMan ® Gene Expression Assays:

NM_007254

              OriGene GFP tagged cDNA clone in CMV expression vector: NM_007254
                                 Myc/DDK tagged cDNA clone in CMV expression vector: NM_007254
                                 untagged cDNA clones in CMV expression vector (see all 2): NM_007254

Additional cDNA sequence:

AF120499.1 AF125807.1 AF126486.1 BC002519.2 BC009339.2 BC013034.2 BC033822.1 CR590331.1

CR594341.1 CR598028.1 CR599191.1 CR600664.1 CR605495.1 CR612354.1 CR615833.1 CR620645.1

CR621711.1 CR623076.1 CR624604.1

17 DOTS entries:

DT.211706 DT.100789769 DT.121429426 DT.40275406 DT.100789766 DT.121429538 DT.121429380 DT.100789779

DT.100769341 DT.100789767 DT.100789780 DT.40202941 DT.95219672 DT.95219688 DT.121429373 DT.75102180

DT.95219695

24/205 AceView cDNA sequences (see all 205 ):

BC002519 CR600664 BC033822 CD671425 BM811617 BM664223 CR621711 BF507485

BC009339 BI761490 CR605495 NM_007254 BQ008966 CR612354 BQ002105 CR620645

AF125807 BM021163 BI820868 BE394572 BF037255 BU619715 BI821496 CR615833

highest scoring ESTs for PNKP:

AF120499 AL042657 AL518253 AL525997 AL529487 AL530223 AL531398 AL555192 BC033822 BE260690

Unigene Cluster for PNKP:

Polynucleotide kinase 3'-phosphatase

Hs.78016 [show with all ESTs]

Unigene Representative Sequence: BC013034

GeneLoc Exon Structure

5/9 Alternative Splicing Database (ASD) splice patterns (SP) for PNKP (see all 9 )

ExUns:	1	^	2a	·	2b	·	2c	^	3a	·	3b	^	4a	·	4b	·	4c	·	4d	^	5a	·	5b	^	6	^	7	^	8a	·	8b	^	9a	·	9b	^	10	^	11	^	12	^	13	^	14	^	15a	·	15b	^	16	^
SP1:									-				-		-				-
SP2:													-		-				-																												-		-
SP3:																			-
SP4:																			-
SP5:													-						-

ExUns:	17	^	18
SP1:
SP2:
SP3:
SP4:
SP5:

About this scheme

ECgene alternative splicing isoforms for PNKP

1 Ensembl transcript including schematic representation:

ENST00000322344

(Experimental results according to ¹GeneNote and GNF BioGPS,
probe sets-to-genes annotations according to ²GeneAnnot , ³GeneTide , Sets of similar genes according to GeneDecks, Electronic Northern calculations according to data from UniGene (Build 219 Homo sapiens), SAGE tags according to CGAP, plus additional links to SOURCE, and/or GNF BioGPS, and/or EXPOLDB, and/or UniProtKB,
Expression Assays from Applied Biosystems )
About This Section

PNKP expression in normal and diseased human tissues

Applied Biosystems TaqMan ® Gene Expression Assays for PNKP

¹ / ² / ³

3 probe-sets matching PNKP gene

Affymetrix probe-set	Array	# genes	Sensitivity	Specificity	Correlation	Length	Gb_Accession	Consensus	Uniqueness	Score	Rank
Affymetrix probe-set	Array	GeneAnnot data			GeneNote data		GeneTide data
47058_at²^{, 3}	U95-B	1	1.00	1.00	1.00	1.00	AL042657	0.80	1.00	0.91	1
218961_s_at²^{, 3}	U133-A	1	1.00	1.00	--	--	NM_007254	0.60	1.00	0.82	1
218961_s_at²	U133Plus2	1	1.00	1.00	--	--	--	--	--	--	--

About this table

Data from

(Publications) and GNF BioGPS
About these images
About these images

CGAP SAGE TAG: TATGGCTACA

SOURCE GeneReport for Unigene cluster: Hs.78016
UniProtKB/Swiss-Prot: PNKP_HUMAN, Q96T60
Tissue specificity: Expressed in many tissues with highest expression in spleen and testis, and
lowest expression in small intestine (PubMed:10446192). Expressed in higher amount in pancreas,
heart and kidney and at lower levels in brain, lung and liver (PubMed:10446193)

(Orthologs according to ^1,2HomoloGene (²older version, for species not in ¹newer version), ³euGenes, ⁴SGD and/or ⁵MGI Jun 06 2009, with possible further links to Flybase and/or WormBase, Gene Trees according to Ensembl)
About This Section

Orthologs for PNKP gene from 5/14 species (see all 14 )

Organism	Gene	Locus	Description	Human Similarity	NCBI accessions
dog (Canis familiaris)	PNKP¹	--	polynucleotide kinase 3'-phosphatase	84.84(n) 86.56(a)	484373 XM_541488.2 XP_541488.2
cow (Bos taurus)	PNKP¹	--	polynucleotide kinase 3'-phosphatase	87.08(n) 85.41(a)	616621 XM_869442.2 XP_874535.2
rat (Rattus norvegicus)	Pnkp¹	--	polynucleotide kinase 3'-phosphatase	80.45(n) 81.54(a)	308576 NM_001004259.1 NP_001004259.1
mouse (Mus musculus)	Pnkp^{1, 5}	7⁵	polynucleotide kinase 3'- phosphatase^{1, 5}	79.55(n)¹ 81.35(a)¹	59047¹ NM_021549.2¹ NP_067524.2¹ AA682096⁵ AF129451⁵ (see all 23)
zebrafish (Danio rerio)	zgc:153084¹	--	zgc:153084	58.33(n) 55.44(a)	569462 NM_001077578.1 NP_001071046.1

About this table Species with no ortholog for PNKP

ENSEMBL Gene Tree for PNKP

(Paralogs according to ¹HomoloGene
and ²Ensembl, Pseudogenes according to ³Pseudogene.org)
About This Section

(According to the ¹NCBI SNP Database, ²Ensembl, ³PupaSUITE, and UniProtKB, Linkage Disequilibrium by HapMap, Genotyping Reagents from Applied Biosystems)
About This Section

10/86 NCBI SNPs in PNKP are shown (see all 86 )
(Click for Applied Biosystems TaqMan ® Genotyping Assay) (see all 58)

AB	SNP ID	Valid	Chr 19 pos	Sequence	Recs	AA Chg	Type	More	Recs	Allele freq	Pop	Total sample	More
AB	Genomic Data				Transcription Data				Allele Frequencies
				--	--	--		--	--				--
	rs3739186^1,2	C,F,H	55059298(-)	`TCTTGT/AACCCA`	1	N/Y	mis¹ ese³		15		NS EU EA WA	1672
	rs3739185^1,2	C,F,H	55059433(-)	`CCACAC/AGCTCT`	1	S/R	mis¹ ese³		10		NS EU EA WA NA	1092
	rs3739166^1,2	F,H	55062574(-)	`TCCCTG/CGTCGG`	1	--	ut5¹ ese³		5		NS EU EA WA	578
--	rs3739206^1,2	F,H	55056533(-)	`CATGGT/GCATGT`	1	G/V	mis¹		5		NS EU EA WA	574
--	rs3760709^1,2	C	55063211(+)	`AGCTGA/GGACTA`	1	--	ng3¹		0	--	--	--	--
--	rs3739164^1,2	F	55062659(-)	`CCCAC-/CCAC GAGGG`	1	--	ng3¹		1		NS	158
--	rs11555414^1,2	H	55060287(-)	`GCTGCC/TGAAGA`	1	P/L	mis¹ ese³		4		EU EA WA	406
--	rs3739163^1,2	F	55062698(-)	`GGCGT-/TGCAGCAAGAGAGATGAAGGTCAGGGCTGCCGA GAGACCCTGGGGGCCGGGAGTCGGGGAAGGGGCGTGGCTG`	1	--	ng3¹		1		NS	104
--	rs3739162^1,2	F	55062906(-)	`CGGGGG/-CGGAG`	1	--	ng3¹		1		NS	166
--	rs11671530^1,2	H	55060357(+)	`GGATTC/TTGGTG`	1	E/K	mis¹ ese³		4		EU EA WA	406

About this table

HapMap Linkage Disequilibrium images for PNKP (up to first 250kb)

(in which this Gene is Involved, According to OMIM, UniProtKB, PharmGKB, Genatlas, GeneTests, Blood group antigen gene mutations by BGMUT, HGMD, GAD, HuGE Navigator, BCGD, and/or TGDB.)
About This Section

OMIM: 605610

Human Genome Epidemiology Navigator: PNKP (1 document)

(Possibly Related Articles in Doctor's Guide)
About This Section

(in PubMed. Associations of this gene to articles via ¹Novoseek, ²HGNC, ³Entrez Gene, ⁴UniProtKB/Swiss-Prot, ⁵UniProtKB/TrEMBL, ⁶GAD, and/or ⁷PharmGKB)
About This Section

10/48 PubMed articles for PNKP gene (see all 48 ):

Molecular cloning of the human gene, PNKP, encoding a polynucleotide kinase 3'-phosphatase and evidence for its role in repair of DNA strand breaks caused by oxidative damage. (PubMed id 10446192)^{1, 2, 3, 4} Jilani A....Lasko D.D. (1999)
Molecular characterization of a human DNA kinase. (PubMed id 10446193)^{2, 3, 4} Karimi-Busheri F....Weinfeld M. (1999)
Global, in vivo, and site-specific phosphorylation dynamics in signaling networks. (PubMed id 17081983)^{3, 4} Olsen J.V....Mann M. (2006)
The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)^{3, 4} Gerhard D.S....Malek J. (2004)
The DNA sequence and biology of human chromosome 19. (PubMed id 15057824)^{3, 4} Grimwood J.... Lucas S.M. (2004)
Specific recognition of a multiply phosphorylated motif in the DNA repair scaffold XRCC1 by the FHA domain of human PNK. (PubMed id 19155274)^{1, 3} Ali A.A....Oliver A.W. (2009)
AP endonuclease-independent DNA base excision repair in human cells. (PubMed id 15260972)^{1, 3} Wiederhold L....Hazra T.K. (2004)
Polynucleotide kinase 3' phosphatase variant, dietary variables and risk of adenoma recurrence in the Polyp Prevention Trial. (PubMed id 18414202)^{1, 3} Murphy G....Lanza E. (2008)
Xrcc4 physically links DNA end processing by polynucleotide kinase to DNA ligation by DNA ligase IV. (PubMed id 15385968)^{1, 3} Koch C.A....Durocher D. (2004)
XRCC1 stimulates human polynucleotide kinase activity at damaged DNA termini and accelerates DNA single-strand break repair. (PubMed id 11163244)^{1, 3} Whitehouse C.J.... Caldecott K.W. (2001)

(in PubMed, OMIM, and NCBI Bookshelf)
About This Section

		AND	OR
Aliases
Free Text

Query String		PubMed OMIM NCBI Bookshelf
	(Note: In FireFox, select the above section and copy using Ctrl-C)

(According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, and/or H-InvDB)
About This Section

Entrez Gene: 11284	HGNC: 9154	AceView: PNKP	Ensembl:ENSG00000039650	euGenes: HUgn11284
ECgene: PNKP	H-InvDB: PNKP

(According to HUGE)
About This Section

(According to ATLAS, HORDE, IMGT, MTDB, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
About This Section

Name	Description
ATLAS Chromosomes in Cancer entry for PNKP	Genetics and Cytogenetics in Oncology and Haematology
NIEHS-SNPs	http://egp.gs.washington.edu/data/pnkp/

Licensable Technologies for PNKP
(Available from WIS Yeda, Salk, Tufts)

About This Section

(Reagents available from Applied Biosystems, Antibodies and assays by Cell Signaling Technology, Abcam, Novus Biologicals,
Sigma-Aldrich, R&D Systems, Millipore, Abnova, and/or Invitrogen, Clones available from OriGene,and/or Invitrogen, Drugs and/or compounds by Sigma-Aldrich,
Enzo Life Sciences, and/or Tocris Bioscience)
About This Section

Products for PNKP:

TaqMan ® Gene Expression Assays

TaqMan ® Genotyping Assays

Free SNP selection tool

Invitrogen iPath Pathways	Invitrogen BLOCK-iT™ RNAi
Invitrogen Antibodies	Invitrogen Assays
Invitrogen Clones	Invitrogen Q-PCR Products
Invitrogen Human Recombinant Kinases	Invitrogen Custom Antibody and Peptide Service
Invitrogen Proteins / Assays / Screening Services	Search Invitrogen catalog for PNKP-related products

	Millipore Custom Antibody & Bulk Services
	Millipore Preclinical / Clinical Development Services
	Millipore Immunoassay Services
	Millipore Target Screening & Profiling Services

	Predesigned and custom siRNAs for PNKP		Antibodies for PNKP
	Explore super-pooled esiRNAs		Browse proteins at Sigma-Aldrich
	Lentivirus-delivered shRNAs for PNKP		Browse small molecules at Sigma-Aldrich
	"Your Favorite Gene" Pathways		feedback

	Antibodies		Primer Pairs
	Cell Culture Products		ELISAs
	Flow Cytometry Kits		Protease Activity Assays & Reagents
	Cell Selection/Detection Kits & Reagents		ELISA/Assay Development Kits & Reagents
	Multiplex/Array Assay Kits & Reagents		ELISpot Kits & Development Modules
	Recombinant & Natural Proteins

	Recombinant Proteins (PNKP)
	Antibodies (PNKP)
	Chimera RNAi (PNKP)
	Custom Service for Mouse Mab
	Custom Service for Rabbit Pab from Full-length Protein

Antibodies & Assays for PNKP (PNK1)

	Recombinant Proteins (PNK)
	Antibodies (PNK)

Search OriGene for PNKP

Search Tocris compounds for PNKP

Search www.enzolifesicences.com for proteins, assays, substrates, inhibitors & antibodies

Antibodies for PNKP

GeneCards Homepage - Last full update: 2 Jul 2009 Incremental update: 13 Oct 2009

Random Gene From GIFtS :

about GIFtS

Gene Index: 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

Developed at the Crown Human Genome Center & Weizmann Institute of Science

The GeneCards Human Gene Database: Copyright © 1996-2009, Weizmann Institute of Science. All Rights Reserved.
PNKP Gene at Home site.
Version 2.41.1
server4.xennexinc.com

PNKP Gene

protein-coding GIFtS: 62

Aliases &
Descriptions
for PNKP

Summaries
for PNKP

Genomic Location
for PNKP

Proteins
for PNKP

Protein Domains/
Families
for PNKP

Gene Function
for PNKP

Pathways & Interactions
for PNKP

Drugs & Compounds
for PNKP

Transcripts
for PNKP

Expression
for PNKP

Orthologs
for PNKP

Paralogs
for PNKP

SNPs/Variants
for PNKP

Disorders & Mutations
for PNKP

Medical News
for PNKP

Publications
for PNKP

Search for PNKP

Genome Databases showing PNKP

Other Databases showing PNKP

Specialized Databases showing PNKP

Licensable Technologies
for PNKP

Services
for PNKP

Gene Index: 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

PNKP Gene

protein-coding GIFtS: 62

Aliases & Descriptionsfor PNKP

Summariesfor PNKP

Genomic Locationfor PNKP

Proteinsfor PNKP

Protein Domains/Familiesfor PNKP

Gene Functionfor PNKP

Pathways & Interactionsfor PNKP

Drugs & Compoundsfor PNKP

Transcriptsfor PNKP

Expression for PNKP

Orthologsfor PNKP

Paralogsfor PNKP

SNPs/Variantsfor PNKP

Disorders & Mutationsfor PNKP

Medical Newsfor PNKP

Publicationsfor PNKP

Search for PNKP

Genome Databases showing PNKP

Other Databases showing PNKP

Specialized Databases showing PNKP

Licensable Technologiesfor PNKP

Servicesfor PNKP

Gene Index: 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

Aliases &
Descriptions
for PNKP

Summaries
for PNKP

Genomic Location
for PNKP

Proteins
for PNKP

Protein Domains/
Families
for PNKP

Gene Function
for PNKP

Pathways & Interactions
for PNKP

Drugs & Compounds
for PNKP

Transcripts
for PNKP

Expression
for PNKP

Orthologs
for PNKP

Paralogs
for PNKP

SNPs/Variants
for PNKP

Disorders & Mutations
for PNKP

Medical News
for PNKP

Publications
for PNKP

Licensable Technologies
for PNKP

Services
for PNKP