V3 here soon-try beta now
Gene Search (GeneCards Home) | GeneCards Guide | User Feedback | Terms of Use | Notice about third-party sites
 

PNKP Gene

protein-coding   GIFtS: 62

GC19M055056
polynucleotide kinase 3'-phosphatase
Symbol approved by the HUGO Gene Nomenclature Committee (HGNC) database
Services    
(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc , and/or 7Ensembl, 8miRBase)
About This Section

Aliases
PNK 1, 2
Descriptions
DNA 5'-kinase/3'-phosphatase 3
Homo sapiens polynucleotide kinase 3'-phosphatase (PNKP) 2
Polynucleotide kinase-3'-phosphatase 3
polynucleotide kinase 3' phosphatase 2
polynucleotide kinase 3'-phosphatase 2
polynucleotide kinase 3-prime-phosphatase 2
External Ids
HGNC: 91541
Entrez Gene: 112842
UniProtKB: Q96T603
Ensembl: ENSG000000396507
Search outside databases for aliases for PNKP gene

Previous GC identifers: GC19M051022 GC19M050732 GC19M055040

(According to Entrez Gene, Wikipedia's Gene Wiki,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

UniProtKB/Swiss-Prot: PNKP_HUMAN, Q96T60
Function: Catalyzes the phosphorylation of DNA at 5'-hydroxyl termini and can dephosphorylate its
3'-phosphate termini. Plays an important function in DNA repair following ionizing radiation or
oxidative damage

Gene Wiki entry for PNKP

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 36),
and/or miRBase,
Genomic Views according to UCSC and Ensembl, Transcription factor binding sites according to SABiosciences)
About This Section

Genomic View:
UCSC Golden Path with GeneCards custom track

 Transcription factor binding sites upstream to the PNKP gene  

Entrez Gene cytogenetic band: 19q13.3-q13.4   Ensembl cytogenetic band:  19q13.33   HGNC cytogenetic band: 19q13.3-q13.4

PNKP Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)

GeneLoc gene densities for chromosome 19         GeneLoc Exon Structure

GeneLoc location for GC19M055056:     (about GC identifiers)

Start:
55,056,273 bp from pter
End:
55,062,630 bp from pter
Size:
6,358 bases
Orientation:
minus strand
RefSeq DNA sequence:
NC_000019.8  NT_011109.15  
(According to 1UniProtKB, and/or Ensembl, Phosphorylation sites according to 2Phosphosite, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from Invitrogen, Millipore, Sigma-Aldrich, R&D Systems, Enzo Life Sciences, Abnova, OriGene and/or, Abcam,
Biochemical Assays by Invitrogen, Millipore, R&D Systems, Cell Signaling Technology, and/or Enzo Life Sciences, Ontologies according to Gene Ontology Consortium 01 Apr 2009 and Entrez Gene, Antibodies by Invitrogen, Millipore, Sigma-Aldrich, R&D Systems, Cell Signaling Technology, Abcam, Abnova, and/or Novus Biologicals)
About This Section

UniProtKB/Swiss-Prot: PNKP_HUMAN, Q96T60 (See protein sequence)
Recommended Name: Bifunctional polynucleotide phosphatase/kinase  
Size: 521 amino acids; 57076 Da
Subcellular location: Nucleus
Sequence caution: Sequence=AAD47379.1; Type=Frameshift; Positions=Several;
PDB structure from and Proteopedia :
2BRF (3D)    2W3O (3D)    
Secondary accessions: Q9P1V2 Q9UKU8 Q9UNF8 Q9UNI0

Post-translational modifications:

  • Phosphorylated upon DNA damage, probably by ATM or ATR1
  • View phosphorylation sites using PhosphoSite2


  • REFSEQ proteins: NP_009185.2  

    ENSEMBL proteins: 
    ENSP00000323511 


    Human Recombinant Proteins 
    Browse Drug Discovery Central at Invitrogen for human recombinant proteins
    Browse Purified and Recombinant Proteins at Millipore
    Browse Human Recombinant Proteins at Sigma-Aldrich  
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Recombinant Proteins from Abcam (PNK)
    Human Recombinant Proteins from Abnova (PNKP)
                    Browse Origene for full length recombinant human proteins expressed in human HEK293 cells 

    2 Gene Ontology (GO) cellular component terms (links to tree view):

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005634 nucleus IDA10446193
    GO:0005730NOT nucleolus IDA18029348
    About this table

    Antibodies for PNKP: 
    Browse Antibodies Central at Invitrogen
    Browse Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Sigma-Aldrich Antibodies for PNKP
    Browse R&D Systems for Antibodies
    Cell Signaling Technology (CST) Antibodies for PNKP  (PNK1)
    Antibodies from Abcam (PNK), each with their AbpromiseSM
    Monoclonal and Polyclonal Antibodies from Abnova (PNKP)
    Novus Biologicals Antibodies for PNKP

    Assays for PNKP: 
    Browse Invitrogen for biochemical assays
    Browse Kits and Assays available from Millipore
    Browse R&D Systems for biochemical assays
    Browse biochemical assays available from Enzo Life Sciences

    (According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    5 InterPro domains/families:
     IPR006549 HAD-SF_hydro_IIIA
     IPR013954 PNK3P_central-region
     IPR015636 PNK_3Pase
     IPR006550 PNK-3Pase
     IPR006551 DNA-3-Pase


       GeneDecks  PNKP for the domains selected above  
    About GeneDecksing

    Graphical View of Domain Structure for InterPro Entry Q96T60

    ProtoNet protein and cluster: Q96T60

    1 Blocks protein family: IPB013954 Polynucleotide kinase 3 phosphatase

    UniProtKB/Swiss-Prot: PNKP_HUMAN, Q96T60
    Similarity: In the N-terminal section; belongs to the DNA 3' phosphatase family

    (According to MGI Jun 06 2009, UniProtKB, IUBMB,and/or Genatlas,
    shRNA from OriGene, Sigma-Aldrich, RNAi from Sigma-Aldrich,
    RNAi Products, Clones, and Q-PCR Products from Invitrogen, Millipore, OriGene, and/or Abnova, siRNAs from Applied Biosystems, SYBR primers from OriGene, Cell-based Assays from Millipore, Ontologies according to Gene Ontology Consortium 01 Apr 2009 via Entrez Gene.)
    About This Section

    Inhib.
    RNA:
    Invitrogen RNAi Products for gene knock-down (PNKP)
    Browse for Gene Knock-down Tools from Millipore
    Abnova Chimera RNAi Products for Gene knock-down (PNKP)
                  OriGene 29mer shRNA kit in GFP-retroviral vector: NM_007254

                  Applied Biosystems Silencer® siRNAs for PNKP

                  Sigma-Aldrich siRNA for PNKP  
                         Sigma-Aldrich shRNA Panels and shRNA for PNKP  
                         Explore Sigma-Aldrich super-pooled esiRNAs  

    Clones:Invitrogen Clones for PNKP
    Browse Clones for the Expression of Recombinant Proteins Available from Millipore
                  OriGene GFP tagged cDNA clone in CMV expression vector: NM_007254
                                     Myc/DDK tagged cDNA clone in CMV expression vector: NM_007254
                                     untagged cDNA clones in CMV expression vector (see all 2): NM_007254 

    Primers: Browse Quantitative PCR Central at Invitrogen for Q-PCR LUX™ Primers
                  OriGene genome-wide validated SYBR primer pairs: NM_007254

    UniProtKB/Swiss-Prot: PNKP_HUMAN, Q96T60
    Function: Catalyzes the phosphorylation of DNA at 5'-hydroxyl termini and can dephosphorylate its
    3'-phosphate termini. Plays an important function in DNA repair following ionizing radiation or
    oxidative damage
    Catalytic activity: A 3'-phosphopolynucleotide + H(2)O = a polynucleotide + phosphate
    Catalytic activity: ATP + 5'-dephospho-DNA = ADP + 5'-phospho-DNA

    Genatlas biochemistry entry for PNKP:
    polynucleotide kinase-3 phosphatase,facilitating DNA repair of DNA strand breaks caused by
    oxidative damage

    5/12 Gene Ontology (GO) molecular function terms (links to tree view) (see all 12 ):

    GO IDQualified GO termEvidencePubMed IDs
    GO:0003684 damaged DNA binding NAS10446193
    GO:0003690 double-stranded DNA binding TAS10446193
    GO:0004519 endonuclease activity NAS10446192
    GO:0005515 protein binding IPI17353931
    GO:0005524 ATP binding NAS10446192
    About this table

    (Pathways according to Invitrogen (maps by GeneGo), Millipore, Cell Signaling Technology, Sigma-Aldrich, KEGG and/or UniProtKB,
    Sets of similar genes according to GeneDecks, Proteins Network according to SABiosciences, Interactions according to 1UniProtKB, 2MINT, and/or 3STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2009 via Entrez Gene.)
    About This Section


    1 Millipore Pathway for PNKP
     DNA damage NHEJ mechanisms of DSBs repair

       GeneDecks  PNKP for the pathways selected above  
    About GeneDecksing

     Gene Network CentralTM Interacting Genes and Proteins Network for  PNKP 


    5/23 Interacting proteins for PNKP (Q96T601, 2 ENSP000003235113) via UniProtKB, MINT, and/or STRING (see all 23 )
    InteractantInteraction Details
    GeneCardExternal ID(s)
    XRCC1P188871, ENSP000002628873EBI-1045072, EBI-947466 STRING (score=.999)
    LIG3P499161, ENSP000003677873EBI-1045072, EBI-1753381 STRING (score=.982)
    XRCC4Q134261, 2, ENSP000003420113EBI-1045072, EBI-717592 MINT-51171 MINT-51174 MINT-51172 MINT-51173 MINT-51175 EBI-1045072, EBI-717592 MINT-51171 MINT-51174 MINT-51172 MINT-51173 MINT-51175 STRING (score=.968)
    DDX20Q9UHI61EBI-1045072, EBI-347658
    HEATR2Q86Y561EBI-1045072, EBI-719966
    About this table

    5/8 Gene Ontology (GO) biological process terms (links to tree view) (see all 8 ):

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000718 nucleotide-excision repair, DNA damage removal NAS10446193
    GO:0006261 DNA-dependent DNA replication NAS10446192
    GO:0006281 DNA repair IGI10446192
    GO:0006979 response to oxidative stress IDA10446192
    GO:0009314 response to radiation TAS10446192
    About this table
    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, Sigma-Aldrich, Tocris Bioscience, and/or Novoseek and Drugs according to Enzo Life Sciences and/or PharmGKB)
    About This Section

    Browse drugs & compounds from Enzo Life Sciences
    Browse Small Molecules at Sigma-Aldrich

    Browse Tocris compounds for PNKP
    4 Novoseek chemical compound relationships for PNKP gene
    Compound   Score   Articles   PubMed IDs for Articles with Shared Sentences (# sentences)
    polynucleotide 93.00 20 10446192 (2), 11586300 (1), 16982218 (1), 13679147 (1) (see all 17)
    phosphonate 78.69 7 16648365 (2), 16982218 (1), 17116430 (1), 10446192 (1) (see all 6)
    atp 30.49 3 1621950 (1), 18007613 (1), 10446192 (1)
    oxygen 0.00 1 11586300 (1)
    About this table


    (GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 219 Homo sapiens; Jun 2 2009) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView,
    non coding RNAs according to RNAdb,
    ESTs according to GeneTide,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from Invitrogen, Millipore, and/or Abnova,
    siRNAs from Applied Biosystems, Sigma-Aldrich,
    shRNA from Sigma-Aldrich, OriGene,
    Tagged/untagged cDNA clones from OriGene,
    Expression Assays from Applied Biosystems)
    About This Section

    Inhib.
    RNA:
    Invitrogen RNAi Products for gene knock-down (PNKP)
    Browse for Gene Knock-down Tools from Millipore
    Abnova Chimera RNAi Products for Gene knock-down (PNKP)
                  OriGene 29mer shRNA kit in GFP-retroviral vector: NM_007254

                  Sigma-Aldrich siRNA for PNKP  
                         Sigma-Aldrich shRNA Panels and shRNA for PNKP  
                         Explore Sigma-Aldrich super-pooled esiRNAs  

    Applied Biosystems Silencer® siRNAs: 

    NM_007254  

    REFSEQ mRNAs for PNKP gene: 

    NM_007254.2   

    Applied Biosystems TaqMan ® Gene Expression Assays: 

    NM_007254  

                  OriGene GFP tagged cDNA clone in CMV expression vector: NM_007254
                                     Myc/DDK tagged cDNA clone in CMV expression vector: NM_007254
                                     untagged cDNA clones in CMV expression vector (see all 2): NM_007254 

    Additional cDNA sequence: 

    AF120499.1 AF125807.1 AF126486.1 BC002519.2 BC009339.2 BC013034.2 BC033822.1 CR590331.1 
    CR594341.1 CR598028.1 CR599191.1 CR600664.1 CR605495.1 CR612354.1 CR615833.1 CR620645.1 
    CR621711.1 CR623076.1 CR624604.1 

    17 DOTS entries:

    DT.211706  DT.100789769  DT.121429426  DT.40275406  DT.100789766  DT.121429538  DT.121429380  DT.100789779 
    DT.100769341  DT.100789767  DT.100789780  DT.40202941  DT.95219672  DT.95219688  DT.121429373  DT.75102180 
    DT.95219695 

    24/205 AceView cDNA sequences (see all 205 ):

    BC002519 CR600664 BC033822 CD671425 BM811617 BM664223 CR621711 BF507485 
    BC009339 BI761490 CR605495 NM_007254 BQ008966 CR612354 BQ002105 CR620645 
    AF125807 BM021163 BI820868 BE394572 BF037255 BU619715 BI821496 CR615833 

    highest scoring ESTs for PNKP:

    AF120499 AL042657 AL518253 AL525997 AL529487 AL530223 AL531398 AL555192 BC033822 BE260690 

    Unigene Cluster for PNKP:

    Polynucleotide kinase 3'-phosphatase
    Hs.78016  [show with all ESTs]
    Unigene Representative Sequence: BC013034


    GeneLoc Exon Structure

    5/9 Alternative Splicing Database (ASD) splice patterns (SP) for PNKP (see all 9 )

    ExUns: 1 ^ 2a · 2b · 2c ^ 3a · 3b ^ 4a · 4b · 4c · 4d ^ 5a · 5b ^ 6 ^ 7 ^ 8a · 8b ^ 9a · 9b ^ 10 ^ 11 ^ 12 ^ 13 ^ 14 ^ 15a · 15b ^ 16 ^
    SP1:                          -           -     -           -                                                                                                   
    SP2:                                      -     -           -                                                                                   -     -         
    SP3:                                                        -                                                                                                   
    SP4:                                                        -                                                                                                   
    SP5:                                      -                 -                                                                                                   

    ExUns: 17 ^ 18
    SP1:            
    SP2:            
    SP3:            
    SP4:            
    SP5:            

    About this scheme

    ECgene alternative splicing isoforms for PNKP

    1 Ensembl transcript including schematic representation:
    ENST00000322344  
    (Experimental results according to 1GeneNote and GNF BioGPS,
    probe sets-to-genes annotations according to 2GeneAnnot , 3GeneTide , Sets of similar genes according to GeneDecks, Electronic Northern calculations according to data from UniGene (Build 219 Homo sapiens), SAGE tags according to CGAP, plus additional links to SOURCE, and/or GNF BioGPS, and/or EXPOLDB, and/or UniProtKB,
    Expression Assays from Applied Biosystems )
    About This Section

    PNKP expression in normal and diseased human tissues

     Applied Biosystems TaqMan ® Gene Expression Assays for PNKP

    1 / 2 / 3

    3 probe-sets matching PNKP gene


    Affymetrix
    probe-set
    Array  GeneAnnot data GeneNote data GeneTide data
    # genes Sensitivity Specificity Correlation Length Gb_Accession Consensus Uniqueness Score Rank

    47058_at2, 3 U95-B 1 1.00 1.00 1.00 1.00 AL042657 0.80 1.00 0.91 1

    218961_s_at2, 3 U133-A 1 1.00 1.00 -- -- NM_007254 0.60 1.00 0.82 1

    218961_s_at2 U133Plus2 1 1.00 1.00 -- -- -- -- -- -- --
    About this table
    Data from (Publications) and GNF BioGPS
        About these images
    About these images

    CGAP SAGE TAG: TATGGCTACA

    SOURCE GeneReport for Unigene cluster: Hs.78016

    UniProtKB/Swiss-Prot: PNKP_HUMAN, Q96T60
    Tissue specificity: Expressed in many tissues with highest expression in spleen and testis, and
    lowest expression in small intestine (PubMed:10446192). Expressed in higher amount in pancreas,
    heart and kidney and at lower levels in brain, lung and liver (PubMed:10446193)

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD and/or 5MGI Jun 06 2009, with possible further links to Flybase and/or WormBase, Gene Trees according to Ensembl)
    About This Section


    Orthologs for PNKP gene from 5/14 species (see all 14 )
    Organism Gene Locus Description Human
    Similarity
    NCBI accessions
    dog
    (Canis familiaris)
    PNKP1   -- polynucleotide kinase 3'-phosphatase 84.84(n)
    86.56(a)
    484373  XM_541488.2  XP_541488.2 
    cow
    (Bos taurus)
    PNKP1   -- polynucleotide kinase 3'-phosphatase 87.08(n)
    85.41(a)
    616621  XM_869442.2  XP_874535.2 
    rat
    (Rattus norvegicus)
    Pnkp1   -- polynucleotide kinase 3'-phosphatase 80.45(n)
    81.54(a)
    308576  NM_001004259.1  NP_001004259.1 
    mouse
    (Mus musculus)
    Pnkp1, 5 75
    polynucleotide kinase 3'- phosphatase1, 5 79.55(n)1
    81.35(a)1
    590471  NM_021549.21  NP_067524.21 
     AA6820965  AF1294515  (see all 23)
    zebrafish
    (Danio rerio)
    zgc:1530841   -- zgc:153084 58.33(n)
    55.44(a)
    569462  NM_001077578.1  NP_001071046.1 
    About this table        Species with no ortholog for PNKP

    ENSEMBL Gene Tree for PNKP
    (Paralogs according to 1HomoloGene
    and 2Ensembl, Pseudogenes according to 3Pseudogene.org)
    About This Section

      --
    (According to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, and UniProtKB, Linkage Disequilibrium by HapMap, Genotyping Reagents from Applied Biosystems)
    About This Section


    10/86 NCBI SNPs in PNKP are shown (see all 86 )
    (Click for Applied Biosystems TaqMan ® Genotyping Assay)  (see all 58)
    ABGenomic DataTranscription DataAllele Frequencies
    SNP IDValidChr 19 posSequenceRecsAA
    Chg
    TypeMoreRecsAllele
    freq
    PopTotal
    sample
    More
    ------------
    rs37391861,2
    C,F,H55059298(-) TCTTGT/AACCCA 1 N/Y mis1 ese315Minor allele frequency- A:0.01NS EU EA WA 1672
    rs37391851,2
    C,F,H55059433(-) CCACAC/AGCTCT 1 S/R mis1 ese310Minor allele frequency- A:0.00NS EU EA WA NA 1092
    rs37391661,2
    F,H55062574(-) TCCCTG/CGTCGG 1 -- ut51 ese35Minor allele frequency- C:0.01NS EU EA WA 578
    --
    rs37392061,2
    F,H55056533(-) CATGGT/GCATGT 1 G/V mis15Minor allele frequency- G:0.02NS EU EA WA 574
    --
    rs37607091,2
    C55063211(+) AGCTGA/GGACTA 1 -- ng310--------
    --
    rs37391641,2
    F55062659(-) CCCAC-/CCAC  
            
    GAGGG
    1 -- ng311Minor allele frequency- CCAC:0.34NS 158
    --
    rs115554141,2
    H55060287(-) GCTGCC/TGAAGA 1 P/L mis1 ese34Minor allele frequency- T:0.00EU EA WA 406
    --
    rs37391631,2
    F55062698(-) GGCGT-/TGCAGCAAGAGAGATGAAGGTCAGGGCTGCCGA
    GAGACCCTGGGGGCCGGGAGTCGGGGAAGGGGCGT
    GGCTG
    1 -- ng311Minor allele frequency- TGCAGCAAGAGAGATGAAGGTCAGGGCTGCCGAGAGACCCTGGGGGCCGGGAGTCGGGGAAGGGGCGT:0.30NS 104
    --
    rs37391621,2
    F55062906(-) CGGGGG/-CGGAG 1 -- ng311Minor allele frequency- -:0.23NS 166
    --
    rs116715301,2
    H55060357(+) GGATTC/TTGGTG 1 E/K mis1 ese34Minor allele frequency- T:0.00EU EA WA 406
    About this table

    HapMap Linkage Disequilibrium images for PNKP (up to first 250kb)

    (in which this Gene is Involved, According to OMIM, UniProtKB, PharmGKB, Genatlas, GeneTests, Blood group antigen gene mutations by BGMUT, HGMD, GAD, HuGE Navigator, BCGD, and/or TGDB.)
    About This Section

    OMIM: 605610

    Human Genome Epidemiology Navigator: PNKP (1 document)

    (Possibly Related Articles in Doctor's Guide)
    About This Section

      --

    (in PubMed. Associations of this gene to articles via 1Novoseek, 2HGNC, 3Entrez Gene, 4UniProtKB/Swiss-Prot, 5UniProtKB/TrEMBL, 6GAD, and/or 7PharmGKB)
    About This Section

    10/48 PubMed articles for PNKP gene (see all 48 ):
    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)
    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, and/or H-InvDB)
    About This Section

    Entrez Gene: 11284 HGNC: 9154 AceView: PNKP Ensembl:ENSG00000039650 euGenes: HUgn11284
    ECgene: PNKP H-InvDB: PNKP
    (According to HUGE)
    About This Section

      --
    (According to ATLAS, HORDE, IMGT, MTDB, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section

    NameDescription
    ATLAS Chromosomes in Cancer entry for PNKP Genetics and Cytogenetics in Oncology and Haematology
    NIEHS-SNPshttp://egp.gs.washington.edu/data/pnkp/
    (Available from WIS Yeda, Salk, Tufts)
    About This Section

      --
    (Reagents available from Applied Biosystems, Antibodies and assays by Cell Signaling Technology, Abcam, Novus Biologicals,
    Sigma-Aldrich, R&D Systems, Millipore, Abnova, and/or Invitrogen, Clones available from OriGene,and/or Invitrogen, Drugs and/or compounds by Sigma-Aldrich,
    Enzo Life Sciences, and/or Tocris Bioscience)
    About This Section



    Products for PNKP:
     TaqMan ® Gene Expression Assays
     TaqMan ® Genotyping Assays
      Free SNP selection tool



      Invitrogen iPath Pathways  Invitrogen BLOCK-iT™ RNAi
      Invitrogen Antibodies  Invitrogen Assays
      Invitrogen Clones  Invitrogen Q-PCR Products
      Invitrogen Human Recombinant Kinases  Invitrogen Custom Antibody and Peptide Service
      Invitrogen Proteins / Assays / Screening Services  Search Invitrogen catalog for PNKP-related products

     Millipore Custom Antibody & Bulk Services
     Millipore Preclinical / Clinical Development Services
     Millipore Immunoassay Services
     Millipore Target Screening & Profiling Services


     Predesigned and custom siRNAs for PNKP Antibodies for PNKP
     Explore super-pooled esiRNAs Browse proteins at Sigma-Aldrich
     Lentivirus-delivered shRNAs for PNKP Browse small molecules at Sigma-Aldrich
     "Your Favorite Gene" Pathwaysfeedback


      
     Antibodies   Primer Pairs  
     Cell Culture Products   ELISAs  
     Flow Cytometry Kits   Protease Activity Assays & Reagents  
     Cell Selection/Detection Kits & Reagents   ELISA/Assay Development Kits & Reagents  
     Multiplex/Array Assay Kits & Reagents   ELISpot Kits & Development Modules  
     Recombinant & Natural Proteins  

     Recombinant Proteins (PNKP)
     Antibodies (PNKP)
     Chimera RNAi (PNKP)
     Custom Service for Mouse Mab
     Custom Service for Rabbit Pab from Full-length Protein
      
     Antibodies & Assays for PNKP  (PNK1)

     Recombinant Proteins
    (PNK)
     Antibodies (PNK)
     Search OriGene for PNKP
     Search Tocris compounds for PNKP




     Search www.enzolifesicences.com for proteins, assays, substrates, inhibitors & antibodies
     Antibodies for PNKP

    GeneCards Homepage    -    Last full update: 2 Jul 2009        Incremental update: 13 Oct 2009

    Random Gene From GIFtS : about GIFtS

    Gene Index:   3   5   A   B   C   D   E   F   G   H   I   J   K   L   M   N   O   P   Q   R   S   T   U   V   W   X   Y   Z

    Developed at the Crown Human Genome Center & Weizmann Institute of Science



    The GeneCards Human Gene Database: Copyright © 1996-2009, Weizmann Institute of Science. All Rights Reserved.
    PNKP Gene at Home site.
    Version 2.41.1
    server4.xennexinc.com