Aliases for PITX1 Gene
Aliases for PITX1 Gene
External Ids for PITX1 Gene
- HGNC: 9004
- Entrez Gene: 5307
- Ensembl: ENSG00000069011
- OMIM: 602149
- UniProtKB: P78337
Previous HGNC Symbols for PITX1 Gene
- BFT
Previous GeneCards Identifiers for PITX1 Gene
- GC05M134015
- GC05M134930
- GC05M134394
- GC05M134439
- GC05M134391
- GC05M129551
- GC05M134363
Summaries for PITX1 Gene
-
This gene encodes a member of the RIEG/PITX homeobox family, which is in the bicoid class of homeodomain proteins. Members of this family are involved in organ development and left-right asymmetry. This protein acts as a transcriptional regulator involved in basal and hormone-regulated activity of prolactin. [provided by RefSeq, Jul 2008]
GeneCards Summary for PITX1 Gene
PITX1 (Paired Like Homeodomain 1) is a Protein Coding gene. Diseases associated with PITX1 include Clubfoot, Congenital, With Or Without Deficiency Of Long Bones And/Or Mirror-Image Polydactyly and Liebenberg Syndrome. Among its related pathways are DAG and IP3 signaling. Gene Ontology (GO) annotations related to this gene include DNA binding transcription factor activity and transcriptional activator activity, RNA polymerase II proximal promoter sequence-specific DNA binding. An important paralog of this gene is PITX2.
UniProtKB/Swiss-Prot for PITX1 Gene
-
Sequence-specific transcription factor that binds gene promoters and activates their transcription. May play a role in the development of anterior structures, and in particular, the brain and facies and in specifying the identity or structure of hindlimb.
Additional gene information for PITX1 Gene
- Monarch Initiative
- Search for PITX1 at DataMed
- Search for PITX1 at HumanCyc
No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for PITX1 Gene
Genomics for PITX1 Gene
GeneHancer (GH) Regulatory Elements for PITX1 Gene
Regulatory Element Products
Genomic Locations for PITX1 Gene
- chr5:135,027,734-135,034,813
- (GRCh38/hg38)
- Size:
- 7,080 bases
- Orientation:
- Minus strand
- chr5:134,363,424-134,370,503
- (GRCh37/hg19)
Genomic View for PITX1 Gene
- Cytogenetic band:
-
- 5q31.1 by Ensembl
- 5q31.1 by Entrez Gene
- 5q31.1 by HGNC


RefSeq DNA sequence for PITX1 Gene
Proteins for PITX1 Gene
-
Protein details for PITX1 Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- P78337-PITX1_HUMAN
- Recommended name:
- Pituitary homeobox 1
- Protein Accession:
- P78337
- A8K3M0
- D3DQB0
- O14677
- O60425
- Q9BTI5
Protein attributes for PITX1 Gene
- Size:
- 314 amino acids
- Molecular mass:
- 34128 Da
- Quaternary structure:
-
- Interacts with POU1F1 (PubMed:26612202).
Protein Expression for PITX1 Gene
Post-translational modifications for PITX1 Gene
Other Protein References for PITX1 Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
-
Custom Antibody ServicesOriGene Antibodies for PITX1
- Novus Biologicals Antibodies for PITX1
-
Abcam antibodies for PITX1
- Invitrogen Antibodies for PITX1
- Search GeneTex for Antibodies for PITX1
-
Santa Cruz Biotechnology (SCBT) Antibodies for PITX1
Protein Products
-
OriGene Purified Proteins for PITX1
- Search Origene for MassSpec and Protein Over-expression Lysates for PITX1
- Origene Custom Protein Services for PITX1
- antibodies-online: Search results for 7 available PITX1 Proteins ranked by validation data
- Compare Top PITX1 Proteins
-
Quality Products:
- Search GeneTex for Proteins for PITX1
-
Abcam proteins for PITX1
Assay Products
- antibodies-online: Search results for 6 available PITX1 Elisa Kits ranked by validation data
- Compare Top PITX1 Elisa Kits
-
Quality Products:
No data available for DME Specific Peptides for PITX1 Gene
Domains & Families for PITX1 Gene
Gene Families for PITX1 Gene
- HGNC:
- Human Protein Atlas (HPA):
-
- Disease related genes
- Predicted intracellular proteins
- Transcription factors
Protein Domains for PITX1 Gene
- InterPro:
- Blocks:
- ProtoNet:
Suggested Antigen Peptide Sequences for PITX1 Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
P78337- Family:
-
- Belongs to the paired homeobox family. Bicoid subfamily.
Function for PITX1 Gene
Molecular function for PITX1 Gene
- GENATLAS Biochemistry:
- POU domain,class 1,transcription factor 3,mammalian homeo box backfoot,Drosophila bicoid related,mapping in TCOF1 region and possibly involved in the syndrome,expressed in Rathke pouch at an early stage of pituitary development in a subset of adult anterior pituitary cells that express POMC,and in craniofacial development
- UniProtKB/Swiss-Prot Function:
- Sequence-specific transcription factor that binds gene promoters and activates their transcription. May play a role in the development of anterior structures, and in particular, the brain and facies and in specifying the identity or structure of hindlimb.
Phenotypes From GWAS Catalog for PITX1 Gene
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0000978 | RNA polymerase II proximal promoter sequence-specific DNA binding | IEA | -- |
GO:0001077 | transcriptional activator activity, RNA polymerase II proximal promoter sequence-specific DNA binding | IEA | -- |
GO:0001085 | RNA polymerase II transcription factor binding | IPI | 26612202 |
GO:0001190 | transcriptional activator activity, RNA polymerase II transcription factor binding | IEA | -- |
GO:0003677 | DNA binding | IEA | -- |
Phenotypes for PITX1 Gene
- MGI mutant phenotypes for PITX1:
-
inferred from 2 alleles
- nervous system phenotype
- muscle phenotype
- cardiovascular system phenotype
- mortality/aging
- growth/size/body region phenotype
- digestive/alimentary phenotype
- endocrine/exocrine gland phenotype
- hearing/vestibular/ear phenotype
- embryo phenotype
- skeleton phenotype
- craniofacial phenotype
- adipose tissue phenotype
- limbs/digits/tail phenotype
- GenomeRNAi human phenotypes for PITX1:
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
-
ViGene Biosciences lentiviral particle packaged cDNA for PITX1 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for PITX1 gene
- Search ViGene Biosciences for PITX1
CRISPR Products
-
OriGene CRISPR knockouts for PITX1
- genomics-online: gRNA clones - Search results for 121 available PITX1 gene related products
- Overview of 121 available PITX1 gene related products
- Applied Biological Materials CRISPR for PITX1
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for PITX1
- GenScript: Design CRISPR guide RNA sequences for PITX1
miRNA for PITX1 Gene
- miRTarBase miRNAs that target PITX1
-
- hsa-mir-331-3p (MIRT043542)
- hsa-mir-320a (MIRT044749)
- hsa-mir-149-5p (MIRT045636)
- hsa-mir-92a-3p (MIRT049789)
- hsa-mir-6836-3p (MIRT614511)
- hsa-mir-6749-3p (MIRT614512)
- hsa-mir-1908-3p (MIRT614513)
- hsa-mir-6850-3p (MIRT614514)
- hsa-mir-4707-5p (MIRT614515)
- hsa-mir-6840-5p (MIRT614516)
- hsa-mir-431-3p (MIRT614517)
- hsa-mir-19b-3p (MIRT734360)
- hsa-mir-129-5p (MIRT783563)
- hsa-mir-511-5p (MIRT787126)
- hsa-mir-6830-3p (MIRT788985)
- hsa-mir-7850-5p (MIRT789573)
Targeted motifs for PITX1 Gene
- Consensus sequence: TAATCCCN Submotif: canonical Cell Type: Chicken GEO ID: GSE38910
miRNA Products
- Search ViGene Biosciences for PITX1
Inhibitory RNA Products
- Origene RNAi, sirna, and shrna products in human, mouse, rat for PITX1
- Browse OriGene Inhibitory RNA Products For PITX1
- genomics-online: shRNA clones - Search results for 121 available PITX1 gene related products
- Overview of 121 available PITX1 gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for PITX1 gene
Clone Products
- Sino Biological Human cDNA Clone for PITX1
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- Applied Biological Materials Clones for PITX1
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Cell Line Products
-
Horizon Cell Lines for PITX1
-
ViGene Biosciences adenoviral particle packaged cDNA for PITX1 gene
-
ViGene Biosciences lentiviral particle packaged cDNA for PITX1 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for PITX1 gene
No data available for Enzyme Numbers (IUBMB) and Transcription Factor Targets for PITX1 Gene
Localization for PITX1 Gene
Subcellular locations from UniProtKB/Swiss-Prot for PITX1 Gene
- Nucleus.
- Nucleoli (3)
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0005634 | nucleus | IEA,IDA | 17984056 |
GO:0005667 | transcription factor complex | IEA | -- |
GO:0005730 | nucleolus | IDA | -- |
GO:0005737 | cytoplasm | IEA | -- |
Pathways & Interactions for PITX1 Gene
SuperPathway | Contained pathways | ||
---|---|---|---|
1 | DAG and IP3 signaling |
Pathways by source for PITX1 Gene
1 GeneGo (Thomson Reuters) pathway for PITX1 Gene
Interacting Proteins for PITX1 Gene
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0001501 | skeletal system development | TAS | 9070926 |
GO:0006351 | transcription, DNA-templated | IEA | -- |
GO:0006355 | regulation of transcription, DNA-templated | IEA | -- |
GO:0006366 | transcription by RNA polymerase II | IEA | -- |
GO:0007275 | multicellular organism development | IEA | -- |
No data available for SIGNOR curated interactions for PITX1 Gene
Transcripts for PITX1 Gene
mRNA/cDNA for PITX1 Gene
- (1) REFSEQ mRNAs :
- (4) Additional mRNA sequences :
- (162) Selected AceView cDNA sequences:
- (6) Ensembl transcripts including schematic representations, and UCSC links where relevant :
Unigene Clusters for PITX1 Gene
CRISPR Products
-
OriGene CRISPR knockouts for PITX1
- genomics-online: gRNA clones - Search results for 121 available PITX1 gene related products
- Overview of 121 available PITX1 gene related products
- Applied Biological Materials CRISPR for PITX1
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for PITX1
- GenScript: Design CRISPR guide RNA sequences for PITX1
miRNA Products
- Search ViGene Biosciences for PITX1
Inhibitory RNA Products
- Origene RNAi, sirna, and shrna products in human, mouse, rat for PITX1
- Browse OriGene Inhibitory RNA Products For PITX1
- genomics-online: shRNA clones - Search results for 121 available PITX1 gene related products
- Overview of 121 available PITX1 gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for PITX1 gene
Clone Products
- Sino Biological Human cDNA Clone for PITX1
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- Applied Biological Materials Clones for PITX1
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Expression for PITX1 Gene
mRNA expression in embryonic tissues and stem cells from LifeMap Discovery
-
Neural Crest (Gastrulation Derivatives)
- Mesencephalic Neural Crest Cells Prechordal Mesenchyme
- Diencephalic Neural Crest Cells Prechordal Mesenchyme
- Cranial Neural Crest Cells Branchial Arch 1
- PureStem SK11, NCr-fac & Meso-prx Progenitor
- PureStem SM30, NCr-fac & Meso-latp Progenitor
-
Head Mesenchyme (Muscoskeletal System)
- Mesencephalic Neural Crest Cells Prechordal Mesenchyme
- Diencephalic Neural Crest Cells Prechordal Mesenchyme
- Cranial Neural Crest Cells Branchial Arch 1
- Mesenchymal Stem Cells (Uncategorized)
- Umbilical Cord (Extraembryonic Tissues)
-
Skeletal Muscle (Muscoskeletal System)
- Muscle satellite Cells Extraocular Muscles
- Paraxial Mesoderm (Gastrulation Derivatives)
- Lateral Plate Mesoderm (Gastrulation Derivatives)
mRNA differential expression in normal tissues according to GTEx for PITX1 Gene
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for PITX1 Gene
NURSA nuclear receptor signaling pathways regulating expression of PITX1 Gene:
PITX1SOURCE GeneReport for Unigene cluster for PITX1 Gene:
Hs.84136Evidence on tissue expression from TISSUES for PITX1 Gene
- Pancreas(4.1)
- Muscle(2.7)
- Intestine(2.4)
Phenotype-based relationships between genes and organs from Gene ORGANizer for PITX1 Gene
- ectoderm
- mesoderm
- integumentary
- nervous
- skeleton
- brain
- head
- skull
- ankle
- arm
- digit
- elbow
- finger
- foot
- forearm
- hand
- hip
- humerus
- knee
- lower limb
- nail
- shoulder
- toe
- ulna
- upper limb
- wrist
- skin
Primer Products
-
OriGene qPCR primer pairs for PITX1
-
OriGene qPCR primer pairs and template standards for PITX1
No data available for mRNA Expression by UniProt/SwissProt for PITX1 Gene
Orthologs for PITX1 Gene
This gene was present in the common ancestor of animals.
Organism | Taxonomy | Gene | Similarity | Type | Details |
---|---|---|---|---|---|
chimpanzee (Pan troglodytes) |
Mammalia | PITX1 34 33 |
|
OneToOne | |
dog (Canis familiaris) |
Mammalia | PITX1 34 33 |
|
OneToOne | |
cow (Bos Taurus) |
Mammalia | PITX1 34 33 |
|
OneToOne | |
mouse (Mus musculus) |
Mammalia | Pitx1 34 16 33 |
|
OneToOne | |
rat (Rattus norvegicus) |
Mammalia | Pitx1 33 |
|
||
oppossum (Monodelphis domestica) |
Mammalia | PITX1 34 |
|
OneToOne | |
platypus (Ornithorhynchus anatinus) |
Mammalia | PITX1 34 |
|
OneToOne | |
chicken (Gallus gallus) |
Aves | PITX1 34 33 |
|
OneToOne | |
lizard (Anolis carolinensis) |
Reptilia | PITX1 34 |
|
OneToOne | |
tropical clawed frog (Silurana tropicalis) |
Amphibia | pitx1 33 |
|
||
African clawed frog (Xenopus laevis) |
Amphibia | pitx1 33 |
|
||
zebrafish (Danio rerio) |
Actinopterygii | pitx1 34 33 |
|
OneToOne | |
rainbow trout (Oncorhynchus mykiss) |
Actinopterygii | Omy.5257 33 |
|
||
fruit fly (Drosophila melanogaster) |
Insecta | Ptx1 34 35 |
|
OneToMany | |
worm (Caenorhabditis elegans) |
Secernentea | unc-30 34 |
|
OneToMany | |
sea squirt (Ciona savignyi) |
Ascidiacea | -- 34 |
|
OneToMany |
- Species where no ortholog for PITX1 was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
Paralogs for PITX1 Gene
Paralogs for PITX1 Gene
(14) SIMAP similar genes for PITX1 Gene using alignment to 4 proteins:
Variants for PITX1 Gene
SNP ID | Clin | Chr 05 pos | Variation | AA Info | Type |
---|---|---|---|---|---|
rs121909109 | pathogenic, Talipes equinovarus, Clubfoot, congenital, with or without deficiency of long bones and/or mirror-image polydactyly (CCF) [MIM:119800] | 135,031,290(-) | C/T | coding_sequence_variant, missense_variant | |
rs730882191 | pathogenic, Talipes equinovarus | 135,028,925(-) | GAGTGCCGTACGGGCAAGCGCCCGGCGACATGGCCGAGT/GAGT | coding_sequence_variant, frameshift | |
rs1057523765 | likely-pathogenic, not provided | 135,031,510(-) | T/C | splice_acceptor_variant | |
rs200888898 | uncertain-significance, not specified | 135,031,416(-) | T/G | coding_sequence_variant, missense_variant | |
rs201133610 | uncertain-significance, not specified | 135,031,427(-) | G/T | coding_sequence_variant, missense_variant |
Additional Variant Information for PITX1 Gene
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for PITX1 Gene
Disorders for PITX1 Gene

(12) MalaCards diseases for PITX1 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, Swiss-Prot, DISEASES, and GeneCards
Disorder | Aliases | PubMed IDs |
---|---|---|
clubfoot, congenital, with or without deficiency of long bones and/or mirror-image polydactyly |
|
|
liebenberg syndrome |
|
|
talipes equinovarus |
|
|
clubfoot |
|
|
acute diarrhea |
|
|
UniProtKB/Swiss-Prot
PITX1_HUMAN- Clubfoot, congenital, with or without deficiency of long bones and/or mirror-image polydactyly (CCF) [MIM:119800]: A congenital limb deformity defined as fixation of the foot in cavus, adductus, varus, and equinus (i.e., inclined inwards, axially rotated outwards, and pointing downwards) with concomitant soft tissue abnormalities. Clubfoot may occur in isolation or as part of a syndrome. Some patients present tibial hemimelia, bilateral patellar hypoplasia, and preaxial mirror-image polydactyly. {ECO:0000269 PubMed:18950742, ECO:0000269 PubMed:22258522}. Note=The disease is caused by mutations affecting the gene represented in this entry.
- Liebenberg syndrome (LBNBG) [MIM:186550]: An upper limb-malformation syndrome characterized by the combination of dysplastic elbow joints and the fusion of wrist bones with consequent radial deviation. {ECO:0000269 PubMed:23022097}. Note=The gene represented in this entry is involved in disease pathogenesis. A chromosomal aberration involving the PITX1 locus results in LBNBG. Translocation t(5;18)(q31.1;q12.3). Additionally, two chromosome 5 deletions located 5of PITX1 have been found in LBNBG patients. These structural variations cause altered expression of PITX1 in the forelimb via the activation of ectopic enhancers (PubMed:23022097). {ECO:0000269 PubMed:23022097}.
Additional Disease Information for PITX1
- Genetic Association Database
- (GAD)
- Human Genome Epidemiology Navigator
- (HuGE)
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
No data available for Genatlas for PITX1 Gene
Publications for PITX1 Gene
- Human and murine PTX1/Ptx1 gene maps to the region for Treacher Collins syndrome. (PMID: 9337397) Crawford MJ … Drouin J (Mammalian genome : official journal of the International Mammalian Genome Society 1997) 2 3 4 22 58
- Backfoot, a novel homeobox gene, maps to human chromosome 5 (BFT) and mouse chromosome 13 (Bft). (PMID: 9070926) Shang J … Francke U (Genomics 1997) 2 3 4 58
- Functional characterization of a human POU1F1 mutation associated with isolated growth hormone deficiency: a novel etiology for IGHD. (PMID: 26612202) Sobrier ML … Amselem S (Human molecular genetics 2016) 3 4 58
- Deletions in PITX1 cause a spectrum of lower-limb malformations including mirror-image polydactyly. (PMID: 22258522) Klopocki E … Kurth I (European journal of human genetics : EJHG 2012) 3 4 58
- Homeotic arm-to-leg transformation associated with genomic rearrangements at the PITX1 locus. (PMID: 23022097) Spielmann M … Mundlos S (American journal of human genetics 2012) 3 4 58
Products for PITX1 Gene
- Browse R&D Systems for Antibodies
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Custom Antibody ServicesOriGene Antibodies for PITX1
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for PITX1
- Search Origene for MassSpec and Protein Over-expression Lysates for PITX1
- Origene Custom Protein Services for PITX1
- Origene shrna, sirna, and RNAi products in human, mouse, rat for PITX1
- Browse OriGene Inhibitory RNA Products For PITX1
- OriGene qPCR primer pairs and template standards for PITX1
- OriGene qPCR primer pairs for PITX1
- OriGene CRISPR knockouts for PITX1
- OriGene ORF clones in human for PITX1
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For PITX1
- GenScript: Next-day shipping of latest version cDNA ORF clones for PITX1 in any vector
- GenScript Custom Purified and Recombinant Proteins Services for PITX1
- GenScript Custom Assay Services for PITX1
- GenScript Custom overexpressing Cell Line Services for PITX1
- GenScript: Design CRISPR guide RNA sequences for PITX1
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for PITX1
- Sino Biological Human cDNA Clone for PITX1
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse Sino Biological ELISA Kits
- Browse Sino Biological ELISA Pair Sets
- Browse Sino Biological CRO Services
- Browse Sino Biological Control Vectors
- Sino Biological Transfection Reagent
- Sino Biological Anti-His Tag Antibody
- Novus Biologicals Antibodies for PITX1
- Novus Biologicals proteins and lysates for PITX1
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Abcam antibodies for PITX1
- Abcam proteins for PITX1
- Find your target
- Browse Primary Antibodies
- Browse Conjugated Primary Antibodies
- Browse Secondary Antibodies
- Browse ELISA Kits
- Browse Matched Antibody Pairs
- Browse Proteins and Peptides
- Search Knockout (KO) Validated Antibodies
- Browse Monoclonal Antibodies
- Browse Recombinant Antibodies
- Browse Antibodies at Cloud-Clone Corp.
- Browse Proteins at Cloud-Clone Corp.
- Browse Assay Kits at Cloud-Clone Corp.
- Browse Knockouts at Cloud-Clone Corp.
- Browse Knockins at Cloud-Clone Corp.
- Cloud-Clone Corp. disease models service
- Browse cDNA clones at Cloud-Clone Corp.
- Browse primers at Cloud-Clone Corp.
- Cloud-Clone Corp. primary cells service
- Invitrogen Antibodies for PITX1
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- antibodies-online: Search results for 54 available PITX1 Antibodies ranked by validation data
- Compare Top PITX1 Antibodies
- antibodies-online: Search results for 6 available PITX1 Elisa Kits ranked by validation data
- Compare Top PITX1 Elisa Kits
- Quality Products:
- antibodies-online: Search results for 7 available PITX1 Proteins ranked by validation data
- Compare Top PITX1 Proteins
- Quality Products:
- Search GeneTex for Antibodies for PITX1
- Search GeneTex for Proteins for PITX1
- ViGene Biosciences adenoviral particle packaged cDNA for PITX1 gene
- ViGene Biosciences lentiviral particle packaged cDNA for PITX1 gene
- ViGene Biosciences ready-to-package AAV shRNAs for PITX1 gene
- Search ViGene Biosciences for PITX1
- Santa Cruz Biotechnology (SCBT) Antibodies for PITX1
- Search Santa Cruz Biotechnology (SCBT) for PITX1 siRNA/shRNA
- Santa Cruz Biotechnology (SCBT) CRISPR for PITX1
- Horizon Cell Lines for PITX1
- genomics-online: cdna clones - Search results for 121 available PITX1 gene related products
- Overview of 121 available PITX1 gene related products
- orf clones - Search results for 121 available PITX1 gene related products
- Overview of 121 available PITX1 gene related products
- genomics-online: gRNA clones - Search results for 121 available PITX1 gene related products
- Overview of 121 available PITX1 gene related products
- genomics-online: primer clones - Search results for 121 available PITX1 gene related products
- Overview of 121 available PITX1 gene related products
- genomics-online: shRNA clones - Search results for 121 available PITX1 gene related products
- Overview of 121 available PITX1 gene related products
Sources for PITX1 Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) GeneAnnot
- (31) CGAP SAGE
- (32) SOURCE
- (33) HomoloGene
- (34) PanEnsembl
- (35) euGenes
- (36) SGD
- (37) FlyBase
- (38) WormBase
- (39) Pseudogene
- (40) DGV
- (41) dbSNP
- (42) GenAtlas
- (43) HGMD
- (44) GAD
- (45) BGMUT
- (46) HuGE
- (47) Atlas
- (48) Cell Signaling Technology
- (49) GenBank
- (50) H-invDB
- (51) HORDE
- (52) HUGE
- (53) IMGT
- (54) Leiden
- (55) miRBase
- (56) DME
- (57) OriGene
- (58) PubMed
- (59) R&D Systems
- (60) TGDB
- (61) Tocris
- (62) Abcam
- (63) Novus Biologicals
- (64) ProSpec
- (65) Sino Biological
- (66) GenScript
- (67) Qiagen
- (68) Cloud-Clone Corp.
- (69) OCA
- (70) Proteopedia
- (71) MOPED
- (72) neXtProt
- (73) Reactome
- (74) GeneGo (Thomson Reuters)
- (75) fRNAdb
- (76) DISEASES
- (77) SIMAP
- (78) GenomeRNAi
- (79) LifeMap
- (80) miRTarBase
- (81) MalaCards
- (82) Invitrogen
- (83) BitterDB
- (84) Vector BioLabs
- (85) ESI-BIO
- (86) RefSeq
- (87) BioSystems
- (88) MaxQB
- (89) IUPHAR
- (90) BioGPS
- (91) Illumina
- (92) COMPARTMENTS
- (93) HOMER
- (94) PaxDb
- (95) ApexBio
- (96) Addgene
- (97) antibodies-online
- (98) CYP
- (99) NONCODE
- (100) SwitchGear Genomics
- (101) TreeFam
- (102) PathCards
- (103) GeneReviews
- (104) GeneTex
- (105) Taconic Biosciences
- (106) GTEx
- (107) ProteomicsDB
- (108) SCBT
- (109) DGIdb
- (110) ClinicalTrials
- (111) FDA Approved Drugs
- (112) RVIS
- (113) SIGNOR
- (114) diseasecard
- (115) NIH Rare Diseases
- (116) Orphanet
- (117) UMLS
- (118) GTR
- (119) Disease Ontology
- (120) Genetics Home Reference
- (121) MeSH
- (122) MedlinePlus
- (123) CDC
- (124) NINDS
- (125) NCBI Bookshelf
- (126) ClinVar
- (127) Gene Damage Index
- (128) ViGene Biosciences
- (129) HPO
- (130) UDN
- (131) VISTA
- (132) FANTOM5
- (133) ENCODE
- (134) ProSci
- (135) Horizon
- (136) NURSA
- (137) IID
- (138) Cyagen
- (139) VectorBuilder
- (140) SNPedia
- (141) BRCA Exchange
- (142) St John's Lab
- (143) CIViC
- (144) ProteoGenix
- (145) dbSUPER
- (146) TISSUES
- (147) Gene ORGANizer
- (148) abm
- (149) CrownBio
- (150) Human Protein Atlas
- (151) GWAS Catalog
- (152) Monarch Initiative
- (153) DataMed
- (154) HumanCyc
- (155) genomics-online
- (156) UCNEbase
- (157) EPDnew