Free for academic non-profit institutions. Other users need a Commercial license

PITX1 Gene(Protein Coding)

Paired Like Homeodomain 1

GCID:
GC05M135027
GIFtS:
62
Genes Participants
UDN Logo

Aliases for PITX1 Gene

Aliases for PITX1 Gene

  • Paired Like Homeodomain 1 2 3 5
  • Paired-Like Homeodomain Transcription Factor 1 2 3 4
  • Homeobox Protein PITX1 3 4
  • PTX1 3 4
  • BFT 3 4
  • Hindlimb Expressed Homeobox Protein Backfoot 3
  • Hindlimb-Expressed Homeobox Protein Backfoot 4
  • Pituitary Otx-Related Factor 3
  • Paired-Like Homeodomain 1 2
  • Pituitary Homeo Box 1 3
  • Pituitary Homeobox 1 3
  • LBNBG 3
  • POTX 3
  • CCF 3

External Ids for PITX1 Gene

Previous HGNC Symbols for PITX1 Gene

  • BFT

Previous GeneCards Identifiers for PITX1 Gene

  • GC05M134015
  • GC05M134930
  • GC05M134394
  • GC05M134439
  • GC05M134391
  • GC05M129551
  • GC05M134363

Summaries for PITX1 Gene

Entrez Gene Summary for PITX1 Gene

  • This gene encodes a member of the RIEG/PITX homeobox family, which is in the bicoid class of homeodomain proteins. Members of this family are involved in organ development and left-right asymmetry. This protein acts as a transcriptional regulator involved in basal and hormone-regulated activity of prolactin. [provided by RefSeq, Jul 2008]

GeneCards Summary for PITX1 Gene

PITX1 (Paired Like Homeodomain 1) is a Protein Coding gene. Diseases associated with PITX1 include Clubfoot, Congenital, With Or Without Deficiency Of Long Bones And/Or Mirror-Image Polydactyly and Liebenberg Syndrome. Among its related pathways are DAG and IP3 signaling. GO annotations related to this gene include transcription factor activity, sequence-specific DNA binding and transcriptional activator activity, RNA polymerase II core promoter proximal region sequence-specific binding. An important paralog of this gene is PITX2.

UniProtKB/Swiss-Prot for PITX1 Gene

  • Sequence-specific transcription factor that binds gene promoters and activates their transcription. May play a role in the development of anterior structures, and in particular, the brain and facies and in specifying the identity or structure of hindlimb.

Gene Wiki entry for PITX1 Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for PITX1 Gene

Genomics for PITX1 Gene

Products:

  1. Regulatory Element

Regulatory Elements for PITX1 Gene

Enhancers for PITX1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH05F135137 1.6 FANTOM5 Ensembl ENCODE 16.1 -105.2 -105229 5.9 PKNOX1 BRCA1 GLIS2 FOS SP5 SMARCB1 SSRP1 SMARCA4 RFX3 GLIS1 PITX1 CATSPER3 LOC105379188 C5orf66-AS2
GH05F135014 0.8 Ensembl ENCODE 20.7 +20.4 20413 0.4 ZFHX2 NFIA RAD21 EGR2 PITX1 C5orf66-AS1 C5orf66 CATSPER3
GH05F135026 1.2 ENCODE 13.2 +3.8 3806 9.3 MLX CREB3L1 ZFP64 DMAP1 FEZF1 YY1 SLC30A9 ZNF143 ZNF263 SP3 SEC24A C5orf66-AS1 PITX1 C5orf66 CATSPER3
GH05F135024 0.7 ENCODE 12 +9.4 9385 1.5 TFAP4 PKNOX1 JUN THRB RAD21 ZIC2 GATA3 SCRT2 FOS CREM C5orf66-AS1 PITX1 C5orf66 CATSPER3
GH05F135037 0.7 Ensembl 11.8 -4.8 -4790 3.8 SCRT1 ZNF146 ZNF362 ZNF280D RNF2 SUZ12 TEAD4 CBX2 REST ZNF384 C5orf66-AS1 PITX1 ENSG00000270021
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around PITX1 on UCSC Golden Path with GeneCards custom track

Promoters for PITX1 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00001697790 1613 3201 PKNOX1 CREB3L1 ZFP64 ARID4B SIN3A DMAP1 FEZF1 ZNF2 YY1 ZNF766

Transcription factor binding sites by QIAGEN in the PITX1 gene promoter:

Genomic Location for PITX1 Gene

Chromosome:
5
Start:
135,027,734 bp from pter
End:
135,034,813 bp from pter
Size:
7,080 bases
Orientation:
Minus strand

Genomic View for PITX1 Gene

Genes around PITX1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
PITX1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for PITX1 Gene
GeneLoc Logo Genomic Neighborhood • Exon Structure • Gene Density

RefSeq DNA sequence for PITX1 Gene

Proteins for PITX1 Gene

Products:

  1. Antibody
  2. Protein
  3. Assay

  • Protein details for PITX1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P78337-PITX1_HUMAN
    Recommended name:
    Pituitary homeobox 1
    Protein Accession:
    P78337
    Secondary Accessions:
    • A8K3M0
    • D3DQB0
    • O14677
    • O60425
    • Q9BTI5

    Protein attributes for PITX1 Gene

    Size:
    314 amino acids
    Molecular mass:
    34128 Da
    Quaternary structure:
    • Interacts with POU1F1 (PubMed:26612202).

neXtProt entry for PITX1 Gene

Protein Expression for PITX1 Gene

See protein expression from ProteomicsDB, MOPED, PaxDb, and MaxQB

Post-translational modifications for PITX1 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for PITX1 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for PITX1 Gene

Domains & Families for PITX1 Gene

Gene Families for PITX1 Gene

HGNC:

Protein Domains for PITX1 Gene

InterPro:
Blocks:
ProtoNet:

Suggested Antigen Peptide Sequences for PITX1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

P78337

UniProtKB/Swiss-Prot:

PITX1_HUMAN :
  • Contains 1 homeobox DNA-binding domain.
  • Belongs to the paired homeobox family. Bicoid subfamily.
Domain:
  • Contains 1 homeobox DNA-binding domain.
Family:
  • Belongs to the paired homeobox family. Bicoid subfamily.
genes like me logo Genes that share domains with PITX1: view

Function for PITX1 Gene

Products:

  1. Animal Model
  2. CRISPR
  3. miRNA
  4. Inhibitory RNA
  5. Clone
  6. Cell Line
  7. Flow Cytometry

Molecular function for PITX1 Gene

GENATLAS Biochemistry:
POU domain,class 1,transcription factor 3,mammalian homeo box backfoot,Drosophila bicoid related,mapping in TCOF1 region and possibly involved in the syndrome,expressed in Rathke pouch at an early stage of pituitary development in a subset of adult anterior pituitary cells that express POMC,and in craniofacial development
UniProtKB/Swiss-Prot Function:
Sequence-specific transcription factor that binds gene promoters and activates their transcription. May play a role in the development of anterior structures, and in particular, the brain and facies and in specifying the identity or structure of hindlimb.

Gene Ontology (GO) - Molecular Function for PITX1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000978 RNA polymerase II core promoter proximal region sequence-specific DNA binding IEA --
GO:0001077 transcriptional activator activity, RNA polymerase II core promoter proximal region sequence-specific binding IEA --
GO:0001085 RNA polymerase II transcription factor binding IPI 26612202
GO:0001190 transcriptional activator activity, RNA polymerase II transcription factor binding IEA --
GO:0003677 DNA binding IEA --
genes like me logo Genes that share ontologies with PITX1: view
genes like me logo Genes that share phenotypes with PITX1: view

Human Phenotype Ontology for PITX1 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for PITX1 Gene

MGI Knock Outs for PITX1:

Animal Model Products

Targeted motifs for PITX1 Gene
HOMER Transcription Factor Regulatory Elements motif PITX1
  • Consensus sequence: TAATCCCN Submotif: canonical Cell Type: Chicken GEO ID: GSE38910

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) and Transcription Factor Targets for PITX1 Gene

Localization for PITX1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for PITX1 Gene

Nucleus.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for PITX1 gene
Compartment Confidence
nucleus 5
extracellular 1

Gene Ontology (GO) - Cellular Components for PITX1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IEA,IDA 17984056
GO:0005667 transcription factor complex IEA --
GO:0005730 nucleolus IDA --
GO:0005737 cytoplasm IEA --
genes like me logo Genes that share ontologies with PITX1: view

Pathways & Interactions for PITX1 Gene

genes like me logo Genes that share pathways with PITX1: view

Pathways by source for PITX1 Gene

1 GeneGo (Thomson Reuters) pathway for PITX1 Gene

Gene Ontology (GO) - Biological Process for PITX1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001501 skeletal system development TAS 9070926
GO:0006351 transcription, DNA-templated IEA --
GO:0006355 regulation of transcription, DNA-templated IEA --
GO:0006366 transcription from RNA polymerase II promoter IEA --
GO:0007275 multicellular organism development IEA --
genes like me logo Genes that share ontologies with PITX1: view

No data available for SIGNOR curated interactions for PITX1 Gene

Drugs & Compounds for PITX1 Gene

Products:

  1. Drug

(3) Additional Compounds for PITX1 Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with PITX1: view

Transcripts for PITX1 Gene

Products:

  1. CRISPR
  2. miRNA
  3. Inhibitory RNA
  4. Clone
  5. Flow Cytometry

mRNA/cDNA for PITX1 Gene

(1) REFSEQ mRNAs :
(4) Additional mRNA sequences :
(162) Selected AceView cDNA sequences:
(6) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for PITX1 Gene

Paired-like homeodomain 1:
Representative Sequences:

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for PITX1 Gene

No ASD Table

Relevant External Links for PITX1 Gene

GeneLoc Exon Structure for
PITX1
ECgene alternative splicing isoforms for
PITX1

Expression for PITX1 Gene

Products:

  1. Primer

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and SAGE for PITX1 Gene

mRNA expression in normal human tissues for PITX1 Gene
mRNA expression by BioGPS for PITX1 GenemRNA expression by GTEx for PITX1 Gene

mRNA differential expression in normal tissues according to GTEx for PITX1 Gene

This gene is overexpressed in Esophagus - Mucosa (x23.8), Pituitary (x6.5), Vagina (x5.9), and Minor Salivary Gland (x4.7).

Protein differential expression in normal tissues from HIPED for PITX1 Gene

This gene is overexpressed in Pancreatic juice (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for PITX1 Gene



Protein tissue co-expression partners for PITX1 Gene

NURSA nuclear receptor signaling pathways regulating expression of PITX1 Gene:

PITX1

SOURCE GeneReport for Unigene cluster for PITX1 Gene:

Hs.84136
genes like me logo Genes that share expression patterns with PITX1: view

No data available for mRNA Expression by UniProt/SwissProt for PITX1 Gene

Orthologs for PITX1 Gene

This gene was present in the common ancestor of animals.

Orthologs for PITX1 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
 Mammalia PITX1 34 35
  • 99.79 (n)
dog
(Canis familiaris)
 Mammalia PITX1 34 35
  • 95.53 (n)
cow
(Bos Taurus)
 Mammalia PITX1 34 35
  • 94.16 (n)
mouse
(Mus musculus)
 Mammalia Pitx1 34 16 35
  • 91.3 (n)
rat
(Rattus norvegicus)
 Mammalia Pitx1 34
  • 90.76 (n)
oppossum
(Monodelphis domestica)
 Mammalia PITX1 35
  • 88 (a)
 OneToOne
platypus
(Ornithorhynchus anatinus)
 Mammalia PITX1 35
  • 82 (a)
 OneToOne
chicken
(Gallus gallus)
 Aves PITX1 34 35
  • 80.02 (n)
lizard
(Anolis carolinensis)
 Reptilia PITX1 35
  • 64 (a)
 OneToOne
tropical clawed frog
(Silurana tropicalis)
 Amphibia pitx1 34
  • 77.81 (n)
African clawed frog
(Xenopus laevis)
 Amphibia pitx1 34
zebrafish
(Danio rerio)
 Actinopterygii pitx1 34 35
  • 76.86 (n)
rainbow trout
(Oncorhynchus mykiss)
 Actinopterygii Omy.5257 34
fruit fly
(Drosophila melanogaster)
 Insecta Ptx1 36 35
  • 44 (a)
worm
(Caenorhabditis elegans)
 Secernentea unc-30 35
  • 29 (a)
 OneToMany
sea squirt
(Ciona savignyi)
 Ascidiacea -- 35
  • 27 (a)
 OneToMany
Species where no ortholog for PITX1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for PITX1 Gene

ENSEMBL:
Gene Tree for PITX1 (if available)
TreeFam:
Gene Tree for PITX1 (if available)

Paralogs for PITX1 Gene

Paralogs for PITX1 Gene

(14) SIMAP similar genes for PITX1 Gene using alignment to 4 proteins:

genes like me logo Genes that share paralogs with PITX1: view

Variants for PITX1 Gene

Sequence variations from dbSNP and Humsavar for PITX1 Gene

SNP ID Clin Chr 05 pos Sequence Context AA Info Type
rs121909109 Clubfoot, congenital, with or without deficiency of long bones and/or mirror-image polydactyly (CCF) [MIM:119800], Pathogenic 135,031,290(-) TCACC(A/G)AGCCG upstream-variant-2KB, reference, missense
rs730882191 Pathogenic 135,028,925(-) AACTC(-/GGCCATGTCGCCGGGCGCTTGCCCGTACGGCACTC)CCGCC reference, frameshift-variant
rs794727495 Uncertain significance 135,029,308(-) CAAGA(A/C)CCGGC reference, missense
rs10041469 -- 135,031,183(+) TGAAG(G/T)TCTGC intron-variant
rs10056994 -- 135,029,380(+) CACCC(C/T)CTTCC intron-variant

Structural Variations from Database of Genomic Variants (DGV) for PITX1 Gene

Variant ID Type Subtype PubMed ID
nsv830495 CNV loss 17160897
nsv823243 CNV gain 20364138
nsv823240 CNV gain 20364138
nsv823239 CNV gain 20364138
nsv599744 CNV loss 21841781
nsv462458 CNV loss 19166990
nsv1073498 CNV deletion 25765185
dgv969n67 CNV gain 20364138

Variation tolerance for PITX1 Gene

Residual Variation Intolerance Score: 36% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 10.64; 91.36% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for PITX1 Gene

Human Gene Mutation Database (HGMD)
PITX1
SNPedia medical, phenotypic, and genealogical associations of SNPs for
PITX1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for PITX1 Gene

Disorders for PITX1 Gene

MalaCards: The human disease database

(12) MalaCards diseases for PITX1 Gene - From: OMIM, ClinVar, GeneTests, Orphanet, Swiss-Prot, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
clubfoot, congenital, with or without deficiency of long bones and/or mirror-image polydactyly
  • congestive heart failure
liebenberg syndrome
  • brachydactyly with joint dysplasia
pitx1-related congenital clubfoot
  • pitx1-related talipes equinovarus
clubfoot
  • congenital clubfoot
acute diarrhea
- elite association - COSMIC cancer census association via MalaCards
Search PITX1 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

PITX1_HUMAN
  • Clubfoot, congenital, with or without deficiency of long bones and/or mirror-image polydactyly (CCF) [MIM:119800]: A congenital limb deformity defined as fixation of the foot in cavus, adductus, varus, and equinus (i.e., inclined inwards, axially rotated outwards, and pointing downwards) with concomitant soft tissue abnormalities. Clubfoot may occur in isolation or as part of a syndrome. Some patients present tibial hemimelia, bilateral patellar hypoplasia, and preaxial mirror-image polydactyly. {ECO:0000269 PubMed:18950742, ECO:0000269 PubMed:22258522}. Note=The disease is caused by mutations affecting the gene represented in this entry.
  • Liebenberg syndrome (LBNBG) [MIM:186550]: An upper limb-malformation syndrome characterized by the combination of dysplastic elbow joints and the fusion of wrist bones with consequent radial deviation. {ECO:0000269 PubMed:23022097}. Note=The gene represented in this entry is involved in disease pathogenesis. A chromosomal aberration involving the PITX1 locus results in LBNBG. Translocation t(5;18)(q31.1;q12.3). Additionally, two chromosome 5 deletions located 5of PITX1 have been found in LBNBG patients. These structural variations cause altered expression of PITX1 in the forelimb via the activation of ectopic enhancers (PubMed:23022097). {ECO:0000269 PubMed:23022097}.

Relevant External Links for PITX1

Genetic Association Database (GAD)
PITX1
Human Genome Epidemiology (HuGE) Navigator
PITX1
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
PITX1
genes like me logo Genes that share disorders with PITX1: view

No data available for Genatlas for PITX1 Gene

Publications for PITX1 Gene

  1. Human and murine PTX1/Ptx1 gene maps to the region for Treacher Collins syndrome. (PMID: 9337397) Crawford M.J. … Drouin J. (Mamm. Genome 1997) 2 3 4 22 64
  2. Backfoot, a novel homeobox gene, maps to human chromosome 5 (BFT) and mouse chromosome 13 (Bft). (PMID: 9070926) Shang J. … Francke U. (Genomics 1997) 2 3 4 64
  3. Functional characterization of a human POU1F1 mutation associated with isolated growth hormone deficiency: a novel etiology for IGHD. (PMID: 26612202) Sobrier M.L. … Amselem S. (Hum. Mol. Genet. 2015) 3 4 64
  4. Homeotic arm-to-leg transformation associated with genomic rearrangements at the PITX1 locus. (PMID: 23022097) Spielmann M. … Mundlos S. (Am. J. Hum. Genet. 2012) 3 4 64
  5. Deletions in PITX1 cause a spectrum of lower-limb malformations including mirror-image polydactyly. (PMID: 22258522) Klopocki E. … Kurth I. (Eur. J. Hum. Genet. 2012) 3 4 64

Products for PITX1 Gene

Sources for PITX1 Gene

Content
Loading form....