Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

PHOX2B Gene

protein-coding   GIFtS: 59
GCID: GC04M041746

paired-like homeobox 2b

(Previous name: paired mesoderm homeobox 2b )
(Previous symbol: PMX2B)
 Explore 23 diseases affiliated with
PHOX2B via our new
 Human Malady Compendium 
Biological research products
for PHOX2B
    

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section

This gene clusters with an RNA gene
Subcategory (RNA class): lncRNA

Quality score for the ORGUL clustered with this gene is 3

Aliases
Paired-Like Homeobox 2b1 2 3     NBLST22 5
PMX2B1 2 3 5     Phox2b1
NBPhox1 2 3     Neuroblastoma Paired-Type Homeobox Protein2
Paired Mesoderm Homeobox 2b1 2     Paired Mesoderm Homeobox Protein 2B2
Neuroblastoma Phox2 3     NBPHOX5
PHOX2B Homeodomain Protein2 3     

External Ids:    HGNC: 91431   Entrez Gene: 89292   Ensembl: ENSG000001091327   OMIM: 6038515   UniProtKB: Q994533   
ORGUL members:         
NONCODE:n339964    

Export aliases for PHOX2B gene to outside databases

Previous GC identifers: GC04M042029 GC04M041596 GC04M041661 GC04M041587 GC04M041440 GC04M041068


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for PHOX2B:
The DNA-associated protein encoded by this gene is a member of the paired family of homeobox proteins localized to the
nucleus. The protein functions as a transcription factor involved in the development of several major noradrenergic
neuron populations and the determination of neurotransmitter phenotype. The gene product is linked to enhancement of
second messenger-mediated activation of the dopamine beta-hydroylase, c-fos promoters and several enhancers, including
cyclic amp-response element and serum-response element. (provided by RefSeq, Jul 2008)

UniProtKB/Swiss-Prot: PHX2B_HUMAN, Q99453
Function: Involved in the development of several major noradrenergic neuron populations, including the locus coeruleus.
Transcription factor which could determine a neurotransmitter phenotype in vertebrates. Enhances
second-messenger-mediated activation of the dopamine beta-hydrolase and c-fos promoters, and of several enhancers
including cAMP-response element and serum-response element

Gene Wiki entry for PHOX2B


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000004.11  NC_018915.1  NT_006238.11  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the PHOX2B gene promoter:
         E2F-4   E2F-3a   E2F-5   CUTL1   E2F-2   SRY   E2F   E2F-1   SEF-1 (1)   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidPHOX2B promoter sequence
   Search SABiosciences Chromatin IP Primers for PHOX2B

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat PHOX2B


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 4p12   Ensembl cytogenetic band:  4p13   HGNC cytogenetic band: 4p13

PHOX2B Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
PHOX2B gene location

GeneLoc information about chromosome 4         GeneLoc Exon Structure

GeneLoc location for GC04M041746:  view genomic region     (about GC identifiers)

Start:
41,746,099 bp from pter      End:
41,750,987 bp from pter
Size:
4,889 bases      Orientation:
minus strand

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: PHX2B_HUMAN, Q99453 (See protein sequence)
Recommended Name: Paired mesoderm homeobox protein 2B  
Size: 314 amino acids; 31621 Da
Subunit: Interacts with TRIM11 (By similarity)
Subcellular location: Nucleus (By similarity)
Secondary accessions: Q6PJD9

Explore the universe of human proteins at neXtProt for PHOX2B: NX_Q99453

Post-translational modifications:

  • View modification sites using PhosphoSitePlus2
  • View neXtProt modification sites for NX_Q99453

  • PHOX2B Protein expression data from MOPED and PaxDb:    About this image 
    PHOX2B Protein Expression
    REFSEQ proteins: NP_003915.2  
    ENSEMBL proteins: 
     ENSP00000226382   ENSP00000426733  

    Human Recombinant Protein Products for PHOX2B: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    OriGene Protein Over-expression Lysate: PHOX2B
    OriGene Custom Protein Services for PHOX2B 
    GenScript Custom Purified and Recombinant Proteins Services for PHOX2B
    Browse Sino Biological Recombinant Proteins
    Browse ProSpec Recombinant Proteins
    Uscn Proteins for PHOX2B

    Gene Ontology (GO): 2 cellular component terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000790nuclear chromatin IDA16280598
    GO:0005634nucleus ----

    PHOX2B for ontologies           About GeneDecksing



    PHOX2B Antibody Products: 
    EMD Millipore Mono- and Polyclonal Antibodies for the study of PHOX2B
    R&D Systems Antibodies for PHOX2B
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for PHOX2B 
    GenScript Custom Superior Antibodies Services for PHOX2B
    Abcam antibodies for PHOX2B 
    Uscn Antibodies for PHOX2B
    ThermoFisher Antibodies for PHOX2B

    Assay Products for PHOX2B: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Immunoassay Development
    Browse OriGene Fluorogenic Cell Assay Kits
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for PHOX2B
    Browse Enzo Life Sciences for kits & assays
    Uscn ELISAs and CLIAs for PHOX2B


    (According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    PHOX2B for domains           About GeneDecksing

    3 InterPro domains/families:
     IPR017970 Homeobox_CS
     IPR001356 Homeodomain
     IPR009057 Homeodomain-like

    Graphical View of Domain Structure for InterPro Entry Q99453

    ProtoNet protein and cluster: Q99453

    UniProtKB/Swiss-Prot: PHX2B_HUMAN, Q99453
    Similarity: Belongs to the paired homeobox family
    Similarity: Contains 1 homeobox DNA-binding domain


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, Sirion Biotech, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, Sirion Biotech, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
    About This Section

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: PHX2B_HUMAN, Q99453
    Function: Involved in the development of several major noradrenergic neuron populations, including the locus coeruleus.
    Transcription factor which could determine a neurotransmitter phenotype in vertebrates. Enhances
    second-messenger-mediated activation of the dopamine beta-hydrolase and c-fos promoters, and of several enhancers
    including cAMP-response element and serum-response element

         Gene Ontology (GO): 4 molecular function terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000977RNA polymerase II regulatory region sequence-specific DNA binding IDA16280598
    GO:0000978RNA polymerase II core promoter proximal region sequence-specific DNA binding IDA16144830
    GO:0003700sequence-specific DNA binding transcription factor activity IEA--
    GO:0003712transcription cofactor activity ----
         
    PHOX2B for ontologies           About GeneDecksing


    Phenotypes:
         11 MGI mutant phenotypes (inferred from 8 alleles(MGI details for Phox2b):
     behavior/neurological  cardiovascular system  cellular  embryogenesis  growth/size 
     homeostasis/metabolism  mortality/aging  nervous system  normal  respiratory system 
     vision/eye 

    PHOX2B for phenotypes           About GeneDecksing

    Animal Models:
       inGenious Targeting Laboratory - Customizable classic, inducible, and humanized mouse model solutions for PHOX2B 

    miRNA
    Products:
        
    Browse 3'-UTR reporter clones for miRNA target validation
    Browse MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat PHOX2B
    8/66 QIAGEN miScript miRNA Assays for microRNAs that regulate PHOX2B (see all 66):
    hsa-miR-146a hsa-miR-4272 hsa-miR-502-3p hsa-miR-3622b-3p hsa-miR-3150b-3p hsa-miR-3148 hsa-miR-2113 hsa-miR-4324
    SwitchGear 3'UTR luciferase reporter plasmidPHOX2B 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for PHOX2B (see all 4)
    OriGene shRNA RFP: PHOX2B
    OriGene siRNA: PHOX2B
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat PHOX2B
    Sirion Biotech Custom design and validation of potent shRNA sequences against PHOX2B 

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for PHOX2B
    Sirion Biotech Customized adenovirus for overexpression of PHOX2B 
    Sirion Biotech Customized adenovirus for potent knockdown of PHOX2B

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for PHOX2B (see all 2)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for PHOX2B
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: PHOX2B (NM_003924)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for PHOX2B
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat PHOX2B 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for PHOX2B
    Search LifeMap BioReagents cell lines for PHOX2B
    Sirion Biotech Customized stable knockdown cell line services for PHOX2B 
    Sirion Biotech Customized inducible knockdown cell line services for PHOX2B
    Sirion Biotech Customized stable overexpressing cell line services for PHOX2B
    Sirion Biotech Customized inducible overexpressing cell line services for PHOX2B

    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for PHOX2B


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
    About This Section

    Unified GeneCards pathways  About this table 
    See pathways by source

    Super-pathwaycontained gene-specific pathways
    1Transcription factors in neurogenesis
    Transcription factors in neurogenesis1.00
    2Neural Crest Differentiation
    Neural Crest Differentiation1.00
    3SIDS Susceptibility Pathways
    SIDS Susceptibility Pathways1.00

    Pathway sources
    See GeneCards unified pathways
    Show all pathways

    1 EMD Millipore Pathway for PHOX2B
        Transcription factors in neurogenesis


    2 BioSystems Pathways for PHOX2B 
        SIDS Susceptibility Pathways
    Neural Crest Differentiation



    PHOX2B for pathways           About GeneDecksing

    Interactions:

        SABiosciences Gene Network CentralTM Interacting Genes and Proteins Network for PHOX2B

    STRING Interaction Network Preview (showing 1 interactants - click image to see more details)

    1 Interacting protein for PHOX2B (ENSP000002263824) via UniProtKB, MINT, STRING, and/or I2D
    InteractantInteraction Details
    GeneCardExternal ID(s)
    UBCENSP000003448184STRING: ENSP00000344818
    About this table

    Gene Ontology (GO): 5/28 biological process terms (GO ID links to tree view) (see all 28):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0001764neuron migration ISS--
    GO:0002087regulation of respiratory gaseous exchange by neurological system process ISS--
    GO:0003357noradrenergic neuron differentiation ISS--
    GO:0003360brainstem development IEP12640453
    GO:0006351transcription, DNA-dependent IEA--

    PHOX2B for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section

    PHOX2B for compounds           About GeneDecksing

    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for PHOX2B

    1 HMDB Compound for PHOX2B    About this table
    CompoundSynonyms CAS #PubMed Ids
    Cyclic AMPCyclic AMP (see all 19)60-92-4--
    5 Novoseek chemical compound relationships for PHOX2B gene    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    alanine 62.7 37 17045833 (5), 17300129 (3), 19191321 (2), 14566559 (2) (see all 14)
    dopamine 21.2 5 16249188 (1), 16280598 (1), 16021468 (1), 18572378 (1)
    tyrosine 8.07 6 10230790 (1), 16021468 (1), 10736201 (1), 11861481 (1)
    norepinephrine 7.54 2 16280598 (1), 15516980 (1)
    glutamine 0 1 16021468 (1)

    Search CenterWatch for drugs/clinical trials and news about PHOX2B / PHX2B 

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, Sirion Biotech, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for PHOX2B gene: 
    NM_003924.3  

    Unigene Cluster for PHOX2B:

    Paired-like homeobox 2b
    Hs.87202  [show with all ESTs]
    Unigene Representative Sequence: NM_003924
    2 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000226382(uc003gwf.4) ENST00000510424

    miRNA
    Products:
         
    Browse 3'-UTR reporter clones for miRNA target validation
    Browse OriGene MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat PHOX2B
    8/66 QIAGEN miScript miRNA Assays for microRNAs that regulate PHOX2B (see all 66):
    hsa-miR-146a hsa-miR-4272 hsa-miR-502-3p hsa-miR-3622b-3p hsa-miR-3150b-3p hsa-miR-3148 hsa-miR-2113 hsa-miR-4324
    SwitchGear 3'UTR luciferase reporter plasmidPHOX2B 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for PHOX2B (see all 4)
    OriGene shRNA RFP: PHOX2B
    OriGene siRNA: PHOX2B
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat PHOX2B
    Sirion Biotech Custom design and validation of potent shRNA sequences against PHOX2B 
    Clone
    Products:
         
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for PHOX2B (see all 2)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for PHOX2B
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: PHOX2B (NM_003924)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for PHOX2B
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat PHOX2B 
    Primer
    Products:
        
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for PHOX2B
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat PHOX2B
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat PHOX2B
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat PHOX2B

    Additional cDNA sequence: 

    AK311082.1 BC017199.2 D82344.1 

    1 DOTS entry:

    DT.40117788 

    18 AceView cDNA sequences:

    BC017199 CR603200 BX348259 CR592141 BX324379 CR615256 NM_003924 AL529004 
    BQ069075 D82344 BX282258 AL519054 BX394111 AI266171 BX324378 BX334182 
    BE314442 BE312054 

    GeneLoc Exon Structure


    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    PHOX2B expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS
    CGAP TAG: TGCTTATAGT
    PHOX2B Expression
    About this image

    PHOX2B expression in embryonic tissues and stem cells
    Expression by the Database of Embryonic development, Stem cell research, and Regenerative medicine    About this table

    2 LifeMap In Vivo Development Anatomical Compartments/Cells 
    Tissue Anatomical Compartment CellCategory (developmental path)
    Neural CrestTrunk Neural CrestSympathetic NeuronsNeural Crest
    SomiteThoracic Ventrolateral Dermomyotome LipMuscle Progenitor CellsSkeletal Muscle
    Expression: Positive    Negative     Selective marker
    Experimental details: Curated     Microarrays     In-situ hybridization
    Stem Cell Differentiation: 1 LifeMap Cell 
    NameCategory
    Beating cell clusters (Spontaneous differen...)

    See PHOX2B Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for PHOX2B

    SOURCE GeneReport for Unigene cluster: Hs.87202

    UniProtKB/Swiss-Prot: PHX2B_HUMAN, Q99453
    Tissue specificity: Expressed in neuroblastoma, brain and adrenal gland

        SABiosciences Expression via Pathway-Focused PCR Array including PHOX2B: 
              Homeobox (HOX) Genes in human mouse rat

    Primer
    Products:
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for PHOX2B
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat PHOX2B
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat PHOX2B
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat PHOX2B
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for PHOX2B

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of animals.

    Orthologs for PHOX2B gene from 6/18 species (see all 18)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    chicken
    (Gallus gallus)
    Aves PHOX2B1 paired-like homeobox 2b 80.45(n)
    85.23(a)
      395548  XM_001234150.2  XP_001234151.2 
    lizard
    (Anolis carolinensis)
    Reptilia PHOX2B6
    --
    90(a)
    possible ortholog
    5(100920164-100920370)
    African clawed frog
    (Xenopus laevis)
    Amphibia Xl.322312 Xenopus laevis transcribed sequence with strong similarity more 80.77(n)    CA987053.1 
    zebrafish
    (Danio rerio)
    Actinopterygii phox2bb1 paired-like homeobox 2bb 78.17(n)
    88.03(a)
      544654  NM_001014818.1  NP_001014818.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta PHDP6
    Putative homeodomain protein
    29(a)
    1 → many
    2R(19770708-19771835)
    worm
    (Caenorhabditis elegans)
    Secernentea ceh-176
    alr-16
    Homeobox family member (ceh-17)
    AristaLess (Drosophila homeodomain) Related family...
    27(a)
    16(a)
    1 ↔ many
    possible ortholog
    I(4568963-4570028)
    X(11122531-11125549)


    ENSEMBL Gene Tree for PHOX2B (if available)
    TreeFam Gene Tree for PHOX2B (if available) 

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for PHOX2B gene
    ALX12  RAX2  VSX12  DRGX2  PITX22  PRRX22  PITX12  ARX2  
    PRRX12  PHOX2A2  ALX42  ISX2  VSX22  PITX32  RAX22  ALX32  
    17 SIMAP similar genes for PHOX2B using alignment to 2 protein entries:     PHX2B_HUMAN (see all proteins):
    PITX2    PAX6    PITX1    PHOX2A    MNX1    SHOX2
    NKX2-5    OTX2    PRRX1    DUX2    MEOX1    PRRX2
    HOXB1    DRGX    RAX2    NOBOX    HOXA4

    PHOX2B for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    118 NCBI SNPs in PHOX2B are shown (see top 10    About this table
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 4 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs289397161,2
    Cpathogenic41071772(-) AGGCGC/GGAGTC 2 R G mis1 ese30--------
    rs1048938561,2
    Cother41070577(-) TGGGGA/GCCCAG 2 D G mis10--------
    rs1048938551,2
    Cother41071894(-) GCGGCG/TCATCC 2 R L mis10--------
    rs76618541,2
    C,F--41068092(+) TCACTG/AGTCTT 1 -- ds50015Minor allele frequency- A:0.15NA WA 244
    rs125073841,2
    H--41068237(+) TGCTTC/TTGGGG 1 -- ds50010--------
    rs10636111,2
    F--41068560(-) TGTGCA/TTATAG 1 -- ut31 ese31Minor allele frequency- T:0.07NA 120
    rs592604531,2
    F--41068841(+) GTCACG/ATAGAG 1 -- ut311Minor allele frequency- A:0.05WA 118
    rs624121801,2
    C,F--41068875(+) CACGAT/CACAAT 1 -- ut313Minor allele frequency- C:0.08NA 124
    rs731391161,2
    C--41069622(+) GATCGA/CGCCTT 1 -- ut313Minor allele frequency- C:0.04WA NA 240
    rs738103411,2
    C--41069944(+) TCAGCA/TGGCGG 1 -- ut312Minor allele frequency- T:0.04WA 120
    rs759139381,2
    F--41070142(+) TTGGGC/TCTACC 1 -- ut311Minor allele frequency- T:0.03WA 118
    rs178823351,2
    C--41070417(-) GCAGCA/GGCGGC 2 A syn10--------
    rs178792581,2
    C,F--41070528(-) GGAGGC/GGGCGG 2 G syn11Minor allele frequency- G:0.00NA 2574
    rs790362011,2
    --41070958(+) CCAGGA/GACATG 1 -- int10--------
    rs770638471,2
    F--41071106(+) AAAGTT/CAAACT 1 -- int11Minor allele frequency- C:0.03WA 118
    rs732337301,2
    --41072181(+) GCCTTC/TGGGTG 1 -- int10--------
    rs738103671,2
    C--41074120(+) CTCCTC/TTTTCA 1 -- us2k12Minor allele frequency- T:0.04WA 120
    rs738103691,2
    C--41074230(+) TGCGGG/ACTGTA 1 -- us2k11Minor allele frequency- A:0.50WA 2
    rs117245131,2
    H--41074487(+) GCTTAG/TCTGAA 1 -- us2k10--------
    rs787291821,2
    F--41074788(+) GGTCCC/TCCAGC 1 -- us2k11Minor allele frequency- T:0.04WA 118
    rs1138326111,2
    --41074965(+) CAATGC/TGTATT 1 -- us2k11Minor allele frequency- T:0.50CSA 2
    rs1420001111,2
    --41745681(+) CTTGCC/TGGATA 1 -- ds50010--------
    rs1838606481,2
    --41745723(+) TCCACA/GCTGTC 1 -- ds50010--------
    rs1884254231,2
    --41745729(+) CTGTCA/GTTTTA 1 -- ds50010--------
    rs1457756141,2
    --41745780(+) GCCACG/TTAGTC 1 -- ds50010--------
    rs1477850211,2
    --41745852(+) GAAAAA/GCATGG 1 -- ds50010--------
    rs1503402941,2
    --41745937(+) CCAACC/TCACCT 1 -- ds50010--------
    rs1380505721,2
    --41745940(+) ACCCAC/GCTGGA 1 -- ds50010--------
    rs1495364571,2
    --41745958(+) AGCCCA/GGTGAG 1 -- ds50010--------
    rs610949151,2
    C--41746025(+) AAAAA-/AACAATG 1 -- ds50011Minor allele frequency- AA:0.00NA 2
    rs2016827171,2
    --41746036(+) AAAAA-/AACAATGA 1 -- ds50010--------
    rs117238601,2
    C,F,H--41746437(+) TATACG/AGTCAC 1 -- ut31 ese311Minor allele frequency- A:0.33NA WA CSA EA 551
    rs68263731,2
    C,F,A,H--41746460(+) GTCTGC/TACTGA 1 -- ut31 ese325Minor allele frequency- T:0.49NS EA NA WA CSA 2433
    rs1807954071,2
    --41746514(+) GACACA/CGAAAA 1 -- ut310--------
    rs1180461311,2
    F--41746698(+) AAACCG/CAGACA 1 -- ut311Minor allele frequency- C:0.03EA 120
    rs1849522301,2
    --41746782(+) TGACCA/CCAATC 1 -- ut310--------
    rs1897978971,2
    --41747005(+) GCGCTA/GATGGC 1 -- ut310--------
    rs1121784891,2
    C--41747149(+) TCCCT-/AACTCT 1 -- ut311Minor allele frequency- A:0.50CSA 2
    rs2016542701,2
    --41747274(+) TTGTC-/TTTTTT 1 -- ut310--------
    rs1817437621,2
    --41747332(+) TTAATC/GGTTTC 1 -- ut310--------
    rs1867781061,2
    --41747630(+) GGAAGG/TGGGTA 1 -- ut310--------
    rs1142904931,2
    F--41747663(+) GACGCC/TGTTTT 1 -- ut311Minor allele frequency- T:0.03NA 120
    rs178858641,2
    C,F--41747899(-) GGTCCC/ATTCGC 2 /P syn1 ese32Minor allele frequency- A:0.03NA EU 5237
    rs1385457721,2
    C,F--41747937(+) GGGGCC/TGGGGC 2 S G mis11Minor allele frequency- T:0.00NA 2816
    rs1909733081,2
    C--41748127(+) CCGCCA/GCCGCC 2 G syn10--------
    rs178852161,2
    C,F--41748217(-) GAGAGC/TAAAGA 2 S syn12Minor allele frequency- T:0.01NA EU 5845
    rs178814861,2
    C,F--41748319(-) CGCCGC/GGCCAA 2 R syn1 ese31Minor allele frequency- G:0.01NA 3540
    rs21968221,2
    C,F,A--41748511(-) ACAGCA/CATAAG 1 -- int17Minor allele frequency- C:0.43WA NA CSA EA 366
    rs1861905671,2
    --41748530(+) GGAGAA/GACTTT 1 -- int10--------
    rs1899045671,2
    --41748538(+) TTTCTC/TAGGGG 1 -- int10--------
    rs1828122981,2
    --41748576(+) TTGCGG/TCAGAG 1 -- int10--------
    rs30386921,2
    C--41748739(+) CCTCTCT/-GGGTT 1 -- int11Minor allele frequency- -:0.50CSA 2
    rs2021283841,2
    --41748744(+) CTCTC-/TGGGTTT 1 -- int10--------
    rs1880215281,2
    --41748752(+) GTTTGC/TTCCGC 1 -- int10--------
    rs1427173841,2
    --41748806(+) CGCACA/CGCTTC 1 -- int10--------
    rs1460668031,2
    --41749068(+) GCACAC/TCTTCC 1 -- int10--------
    rs1483161141,2
    --41749184(+) CAAGAG/TCGTGC 1 -- int10--------
    rs286475821,2
    C,F--41749265(+) CCTTCT/CCACTC 1 -- int110Minor allele frequency- C:0.43NA WA CSA EA 373
    rs1141587431,2
    F--41749286(+) GACTTC/AGAATT 1 -- int11Minor allele frequency- A:0.02WA 118
    rs2007564671,2
    --41749335(+) TGCGGC/TGGAGC 1 -- int10--------
    rs1996112601,2
    --41749486(+) AAAGTC/GGTGCG 2 T syn10--------
    rs2018921501,2
    --41749507(+) TGCTTC/GCGCTT 2 R syn10--------
    rs1912399941,2
    --41749629(+) TGAGGA/GCTCCA 1 -- int10--------
    rs1835365651,2
    --41749636(+) TCCAAA/GGTCAG 1 -- int10--------
    rs68113251,2
    C,F--41749668(+) ACACCC/TGCGCG 1 -- int111Minor allele frequency- T:0.44NA WA CSA EA 374
    rs1414872051,2
    --41749694(+) GAAGCC/TGCGGG 1 -- int10--------
    rs46088401,2
    C,F,A,H--41749938(+) ATTCTC/TAGAAA 1 -- int112Minor allele frequency- T:0.40NS EA NA WA CSA 785
    rs722667791,2
    C--41749971(+) GAAAG-/AGCTGCA 1 -- int10--------
    rs1996131301,2
    --41750053(+) TTCTT-/AAAAAA 1 -- int10--------
    rs2010732511,2
    --41750372(+) AGAAAA/GCTGAA 1 -- int10--------
    rs738103661,2
    C,F--41750394(+) GCGGCG/ATACGG 2 /Y syn13Minor allele frequency- A:0.00WA NA 4578
    rs2000383271,2
    --41750538(+) TCAGCA/GTAGGC 2 Y syn10--------
    rs1508719591,2
    --41751015(+) CCCCTA/GATCCT 1 -- us2k10--------
    rs603025161,2
    C,F--41751204(+) TTTTTC/ACCCCT 1 -- us2k11Minor allele frequency- A:0.11EA 120
    rs284621741,2
    C,F--41751211(+) CCCTCG/AGTTAG 1 -- us2k15Minor allele frequency- A:0.13NA WA 244
    rs1874080571,2
    --41751285(+) AACAAA/GCCTAC 1 -- us2k10--------
    rs287274731,2
    C,F--41751323(+) GGACTG/AGGACA 1 -- us2k15Minor allele frequency- A:0.11NA WA 244
    rs1393826721,2
    --41751345(+) CAGGCA/GCCCTG 1 -- us2k10--------
    rs1500590321,2
    --41751355(+) GTAACA/GTAGAG 1 -- us2k10--------
    rs1921034351,2
    --41751484(+) TTGCAA/GCTAAA 1 -- us2k10--------
    rs1850303281,2
    --41751706(+) GTGTAC/TCCAAA 1 -- us2k10--------
    rs1878750631,2
    --41751716(+) ATGTAG/TCTCCT 1 -- us2k10--------
    rs38348071,2
    C--41751761(+) GCCTCT/-TTTTT 1 -- us2k1 trp32Minor allele frequency- -:0.25NA CSA 4
    rs1842738481,2
    --41752046(+) ACTATA/TTCATT 1 -- us2k10--------
    rs1895835881,2
    --41752078(+) AAGAGG/TGGGAA 1 -- us2k10--------
    rs1811750351,2
    --41752233(+) TCTTTA/TTAGGG 1 -- us2k10--------
    rs1843865341,2
    --41752292(+) TAGTGC/TCGGGG 1 -- us2k10--------
    rs1473144431,2
    --41752354(+) CTGCCC/GCGGAC 1 -- us2k10--------
    rs1890664701,2
    --41752774(+) CAAAGA/GCGGAT 1 -- us2k10--------
    rs1441699741,2
    --41752940(+) GGTGGC/GGGATA 1 -- us2k10--------
    rs347946191,2
    ----41070979(+) CAGAG-/TTTTAA 1 -- int10--------
    rs1127146311,2
    ----41069957(+) CCCTGC/GCCCCG 1 -- ut310--------
    rs38336221,2
    ----41069548(+) CCCTA-/ACTCTT 1 -- ut310--------
    rs1474970961,2
    ----41749390(+) AGGTCG/AATCTT 2 /I syn11Minor allele frequency- A:0.00NA 4504
    rs1444148061,2
    ----41748178(+) CCTGGG/CCCCCC 2 /G syn11Minor allele frequency- C:0.00NA 4476
    rs359206351,2
    ----41072370(+) GGAAA-/GAGCTG 1 -- int10--------
    rs178847241,2
    ----41070405(-) GCGGCA/CGCGGC 2 A syn10--------
    rs797536201,2
    ----41073811(+) AAATAC/TACCTG 1 -- us2k11Minor allele frequency- T:0.50NA 2
    rs1448310321,2
    ----41746025(+) AACTT-/AAAAAAA 1 -- ds50010--------
    rs1118418021,2
    ----41068330(+) AGATGG/TCCCAA 1 -- ds50011Minor allele frequency- T:0.50CSA 2
    rs1131480061,2
    ----41068144(+) CACCTC/TAAAGA 1 -- ds50011Minor allele frequency- T:0.50CSA 2
    rs361258271,2
    ----41074832(+) TTTCA-/GGGTGG 1 -- us2k10--------
    rs178791891,2
    ----41070391(-) GCGGC-/GGCGGCAGC
    GGCAGCGGCGGC
    AGCTG
    1 A cds10--------
    rs359772991,2
    ----41068767(+) ATTGAA/CCCCGT 1 -- ut310--------
    rs2009710681,2
    ----41750558(+) GCTCGA/GGGTGT 2 P S mis11Minor allele frequency- G:0.00EU 1217
    rs350337661,2
    ----41072281(+) TATCA-/GGGGAG 1 -- int10--------
    rs1400023461,2
    ----41749489(+) GTGGTG/CCGGAT 2 /R syn11Minor allele frequency- C:0.00NA 4500
    rs1129875411,2
    ----41070494(+) CGCCCC/TCGGAG 2 R G mis10--------
    rs178864701,2
    ----41070390(-) GCGGC-/GGCCGCGGCAGCGGCGGC
    GGCGGCAGCGGCAGCGGCGGC
    AGCTG
    1 AAAAAAAAAAAAAA cds10--------
    rs353504591,2
    ----41068818(+) CAAGAA/CGAGAA 1 -- ut310--------
    rs558548091,2
    ----41068421(+) AAAAAA/GCTTAA 1 -- ds50010--------
    rs342714391,2
    ----41072367(+) GGGGG-/AAAGAG 1 -- int10--------
    rs106144801,2
    ----41071026(+) CCTTA-/CTTTTTG 1 -- int10--------
    rs1116902281,2
    ----41073051(+) CAGCCG/AAGTGG 1 -- ut511Minor allele frequency- A:0.50CSA 2
    rs1127186331,2
    ----41071851(+) ACCCTG/TTCCAG 2 E D mis11Minor allele frequency- T:0.00CSA 1
    rs567104201,2
    ----41075244(+) ATTTGC/TATTTG 1 -- us2k10--------
    rs10636121,2
    ----41068510(-) AAAACA/CAAAAG 1 -- ut310--------
    rs593018471,2
    ----41746050(+) AAAAA-/AAAAAAA 1 -- ds50010--------

    HapMap Linkage Disequilibrium report for PHOX2B (41746099 - 41750987 bp)
    Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
    Database of Genomic Variants (DGV): 1 variation for PHOX2B
         1 CNV: 7445
    Human Gene Mutation Database (HGMD): PHOX2B

    SABiosciences Cancer Mutation PCR Assays
    QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing PHOX2B
    DNA2.0 Custom Variant and Variant Library Synthesis for PHOX2B

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    PHOX2B for disorders           About GeneDecksing

    OMIM gene information: 603851   
    OMIM disorders: 209880  142623  613013  
    UniProtKB/Swiss-Prot: PHX2B_HUMAN, Q99453
  • Defects in PHOX2B are a cause of congenital central hypoventilation syndrome (CCHS) [MIM:209880]; also known
  • as congenital failure of autonomic control or Ondine curse. Most mutations consist of 5-10 alanine expansions in the
    poly-Ala region from amino acids 241-260. CCHS is a rare disorder characterized by abnormal control of respiration in
    the absence of neuromuscular or lung disease, or an identifiable brain stem lesion. A deficiency in autonomic control
    of respiration results in inadequate or negligible ventilatory and arousal responses to hypercapnia and hypoxemia.
    CCHS is frequently complicated with neurocristopathies such as Hirschsprung disease that occurs in about 16% of CCHS
    cases
  • Defects in PHOX2B are the cause of susceptibility to neuroblastoma type 2 (NBLST2) [MIM:613013]. A common
  • neoplasm of early childhood arising from embryonic cells that form the primitive neural crest and give rise to the
    adrenal medulla and the sympathetic nervous system

    20/23 diseases for PHOX2B (see all 23):    About MalaCards
    hirschsprung disease, short-segment    central hypoventilation syndrome    sudden infant death syndrome    neuroblastoma
    congenital central hypoventilation syndrome    cor pulmonale    hirschsprung's disease    type 1 diabetes mellitus
    learning disability    autonomic dysfunction    haddad syndrome    pediatric crohns disease
    sleep apnea    neuroblastoma, susceptibility    exotropia    diabetes mellitus
    apnea    neuronitis    crohn's disease    hyperinsulinism

    3 diseases from the University of Copenhagen DISEASES database for PHOX2B:
    Hirschsprung's disease     Adrenal neuroblastoma     Neuroblastoma

    5 Novoseek disease relationships for PHOX2B gene    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    central hypoventilation syndrome, congenital 98.3 40 16882781 (5), 17045833 (2), 18407552 (2), 18798833 (2) (see all 29)
    hirschsprung disease 86.8 12 16249188 (1), 15949893 (1), 19735829 (1), 15930201 (1) (see all 11)
    sudden infant death syndrome 37 1 15185974 (1)
    atrophy 0 1 15150159 (1)
    tumors 0 6 15657873 (2), 19212675 (1), 16888290 (1), 20208042 (1)

    GeneTests: PHOX2B
    Congenital Central Hypoventilation Syndrome

    Genetic Association Database (GAD): PHOX2B
    Human Genome Epidemiology (HuGE) Navigator: PHOX2B (18 documents)

    Export disorders for PHOX2B gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for PHOX2B gene, integrated from 9 sources (see all 138):
    (articles sorted by number of sources associating them with PHOX2B)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. PHOX2B genotype allows for prediction of tumor risk in congenital central hypoventilation syndrome. (PubMed id 15657873)1, 2, 4, 9 Trochet D....Amiel J. (2005)
    2. Germline mutations of the paired-like homeobox 2B (PHOX2B) gene in neuroblastoma. (PubMed id 15024693)1, 2, 4, 9 Trochet D.... Amiel J. (2004)
    3. Genomic structure and functional characterization of NBPhox (PMX2B), a homeodomain protein specific to catecholaminergic cells that is involved in second messenger-mediated transcriptional activation. (PubMed id 10395798)1, 2, 3 Yokoyama M.... Nakamura M. (1999)
    4. Identification and cloning of neuroblastoma-specific and nerve tissue-specific genes through compiled expression profiles. (PubMed id 9039501)1, 2, 3 Yokoyama M.... Matsubara K. (1996)
    5. Genetic association analyses of PHOX2B and ASCL1 in neuropsychiatric disorders: evidence for association of ASCL1 with Parkinson's disease. (PubMed id 16021468)1, 4, 9 Ide M....Yoshikawa T. (2005)
    6. Paired-like homeodomain proteins Phox2a/Arix and Phox2b/NBPhox have similar genetic organization and independently regulate dopamine beta- hydroxylase gene transcription. (PubMed id 11034547)1, 2, 9 Adachi M.... Lewis E.J. (2000)
    7. Molecular analysis of congenital central hypoventilation syndrome. (PubMed id 14566559)1, 2, 9 Sasaki A.... Hayasaka K. (2003)
    8. The French Congenital Central Hypoventilation Syndrome Registry: general data, phenotype, and genotype. (PubMed id 15653965)1, 4, 9 Trang H....Gaultier C. (2005)
    9. Association study of PHOX2B as a candidate gene for Hirschsprung's disease. (PubMed id 12631670)1, 4, 9 Garcia-Barcelo M....Tam P.K. (2003)
    10. Sudden infant death syndrome: case-control frequency differences at genes pertinent to early autonomic nervous system embryologic development. (PubMed id 15240857)1, 4, 9 Weese-Mayer D.E....Marazita M.L. (2004)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Disorders
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 8929 HGNC: 9143 AceView: PHOX2B Ensembl:ENSG00000109132 euGenes: HUgn8929
    ECgene: PHOX2B H-InvDB: PHOX2B

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for PHOX2B Pharmacogenomics, SNPs, Pathways
    GeneReviewshttp://www.ncbi.nlm.nih.gov/sites/GeneTests/lab/gene/PHOX2B

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for PHOX2B gene:
    Search GeneIP for patents involving PHOX2B

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript, LifeMap BioReagents, and Sirion Biotech, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory)
    About This Section

     EMD Millipore Mono- and Polyclonal Antibodies for the study of PHOX2B
     Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
     Browse for Gene Knock-down Tools from EMD Millipore
     Browse Small Molecules at EMD Millipore
     Browse Kits and Assays available from EMD Millipore
     Browse Purified and Recombinant Proteins at EMD Millipore
     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Antibodies for PHOX2B (PHOX2B)   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Phosphatase Activity Assays/Reagents   Browse Recombinant/Natural Proteins  
     Browse OriGene Antibodies   OriGene shRNA RFP for PHOX2B  
     OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for PHOX2B   OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for PHOX2B  
     OriGene Protein Over-expression Lysate for PHOX2B   Browse OriGene Fluorogenic Cell Assay Kits  
     OriGene siRNA for PHOX2B   Browse 3'-UTR reporter clones for miRNA target validation  
     OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for PHOX2B   OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for PHOX2B  
     Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
     Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
     Browse OriGene full length recombinant human proteins expressed in human HEK293 cells   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for PHOX2B   OriGene Custom Protein Services for PHOX2B  
     OriGene Custom Immunoassay Development  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat PHOX2B
     QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing PHOX2B
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat PHOX2B
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat PHOX2B
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat PHOX2B
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat PHOX2B
     GenScript Custom Purified and Recombinant Proteins Services for PHOX2B GenScript cDNA clones with any tag delivered in your preferred vector for PHOX2B
     GenScript Custom Assay Services for PHOX2B GenScript Custom Superior Antibodies Services for PHOX2B
     GenScript Custom overexpressing Cell Line Services for PHOX2B CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in PHOX2B promoter
     Search Chromatin IP Primers for PHOX2B
     RT2 qPCR Primer Assay in human, mouse, rat PHOX2B
     GNC Network for PHOX2B
     SABiosciences PCR Arrays including human, mouse, rat PHOX2B
     Search Tocris compounds for PHOX2B
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological cDNA Clones
     Antibodies/Proteins Production Services
     Rabbit Monoclonal Antibody Platform
     Bulk Purchasing
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Biologicals
     Novus Tissue Slides
     Antibodies for PHOX2B
     See all of Abcam's Antibodies, Kits and Proteins for PHOX2B
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     PHOX2B Proteins, Antibodies, CLIAs, and ELISAs
     Search LifeMap BioReagents cell lines for PHOX2B
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for PHOX2B
     SwitchGear 3'UTR luciferase reporter plasmids for PHOX2B
     SwitchGear Promoter luciferase reporter plasmids for PHOX2B
     ThermoFisher Antibodies for PHOX2B
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat PHOX2B
     inGenious Targeting Laboratory - Customizable classic, inducible, and humanized mouse model solutions for PHOX2B
    Sirion Biotech Customized:
     stable knockdown cell line services for PHOX2B
     inducible knockdown cell line services for PHOX2B
     design and validation of potent shRNA sequences against PHOX2B
     adenovirus for potent knockdown of PHOX2B
     adenovirus for overexpression of PHOX2B
     stable overexpressing cell line services for PHOX2B
     inducible overexpressing cell line services for PHOX2B
           
    GeneCards Homepage - Last full update: 19 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013 , 14 May 2013

    View Random Gene

    Category
    VWF
    (GIFTS: 73)
    von Willebrand factor
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      PHOX2B gene at Home site.
    hostname: 356980-web2.xennexinc.com index build: 106 solr: 1.4