Free for academic non-profit institutions. Other users need a Commercial license

Aliases for PHLDB3 Gene

Aliases for PHLDB3 Gene

  • Pleckstrin Homology Like Domain Family B Member 3 2 3 5
  • Pleckstrin Homology-Like Domain, Family B, Member 3 2

External Ids for PHLDB3 Gene

Previous GeneCards Identifiers for PHLDB3 Gene

  • GC19M048694
  • GC19M048677
  • GC19M043983
  • GC19M040410

Summaries for PHLDB3 Gene

GeneCards Summary for PHLDB3 Gene

PHLDB3 (Pleckstrin Homology Like Domain Family B Member 3) is a Protein Coding gene. GO annotations related to this gene include enzyme binding. An important paralog of this gene is PHLDB2.

Additional gene information for PHLDB3 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for PHLDB3 Gene

Genomics for PHLDB3 Gene

Regulatory Elements for PHLDB3 Gene

Enhancers for PHLDB3 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH19H043462 1.5 Ensembl ENCODE dbSUPER 19.4 +40.4 40403 3.6 HDGF PKNOX1 ATF1 ZNF133 SIN3A YY1 GLIS2 ZNF416 FOS KLF7 ZNF223 ZNF225 ZNF235 ZNF226 ZNF227 ZNF45 ZNF284 PINLYP ZNF576 SRRM5
GH19H043474 1.5 Ensembl ENCODE dbSUPER 15.9 +29.1 29066 3 PKNOX1 ATF1 SIN3A FEZF1 ZNF2 YY1 ZNF121 GLIS2 ZNF143 ATF7 ZNF575 ETHE1 PHLDB3 LYPD3
GH19H043524 1.6 FANTOM5 ENCODE dbSUPER 14.6 -21.7 -21692 4.3 PKNOX1 ARID4B SIN3A FEZF1 ZNF2 YY1 ZNF143 ZNF207 SP3 SP5 ZNF180 ZNF45 ZNF155 ZNF224 ZNF230 ZNF284 ZNF225 ETHE1 PHLDB3 ZNF234
GH19H043437 1.7 FANTOM5 Ensembl ENCODE dbSUPER 13 +65.9 65941 3.4 PKNOX1 FOXA2 SIN3A TCF12 ZNF121 SCRT2 FOS RCOR1 ELF1 ZNF592 ZNF45 ZNF224 ZNF155 ZNF234 ZNF225 ZNF284 MRPS15P2 ZNF283 PHLDB3 ZNF112
GH19H043502 1.1 ENCODE 19.8 +0.6 573 3 HDGF PKNOX1 ARID4B SIN3A DMAP1 ZNF2 ZBTB7B YY1 SLC30A9 ZNF143 ZNF575 PHLDB3 ZNF155 ZNF224 ZNF180 ETHE1 ZNF45 CEACAMP10 LOC105372414 CEACAMP1
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around PHLDB3 on UCSC Golden Path with GeneCards custom track

Promoters for PHLDB3 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000109965 735 1601 HDGF PKNOX1 ARID4B SIN3A DMAP1 ZNF2 ZBTB7B YY1 SLC30A9 ZNF143

Genomic Locations for PHLDB3 Gene

Genomic Locations for PHLDB3 Gene
30,595 bases
Minus strand

Genomic View for PHLDB3 Gene

Genes around PHLDB3 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
PHLDB3 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for PHLDB3 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for PHLDB3 Gene

Proteins for PHLDB3 Gene

  • Protein details for PHLDB3 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Pleckstrin homology-like domain family B member 3
    Protein Accession:
    Secondary Accessions:
    • Q8N7Z4

    Protein attributes for PHLDB3 Gene

    640 amino acids
    Molecular mass:
    71912 Da
    Quaternary structure:
    No Data Available
    • Sequence=BAC05082.1; Type=Erroneous termination; Positions=169; Note=Translated as Glu.; Evidence={ECO:0000305};

    Alternative splice isoforms for PHLDB3 Gene

neXtProt entry for PHLDB3 Gene

Post-translational modifications for PHLDB3 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for PHLDB3 Gene

Domains & Families for PHLDB3 Gene

Gene Families for PHLDB3 Gene

Protein Domains for PHLDB3 Gene

Suggested Antigen Peptide Sequences for PHLDB3 Gene

Graphical View of Domain Structure for InterPro Entry

  • The PH domain mediates the binding to phosphoinositides.
  • The PH domain mediates the binding to phosphoinositides.
genes like me logo Genes that share domains with PHLDB3: view

Function for PHLDB3 Gene

Phenotypes From GWAS Catalog for PHLDB3 Gene

Gene Ontology (GO) - Molecular Function for PHLDB3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0019899 enzyme binding IPI 23382074
genes like me logo Genes that share ontologies with PHLDB3: view
genes like me logo Genes that share phenotypes with PHLDB3: view

Animal Model Products

miRNA for PHLDB3 Gene

miRTarBase miRNAs that target PHLDB3

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for PHLDB3 Gene

Localization for PHLDB3 Gene

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for PHLDB3 gene
Compartment Confidence
nucleus 3
cytosol 3
plasma membrane 2
extracellular 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (2)
  • Nuclear speckles (2)
  • Plasma membrane (2)
See all subcellular structures

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for PHLDB3 Gene

Pathways & Interactions for PHLDB3 Gene

SuperPathways for PHLDB3 Gene

No Data Available

Interacting Proteins for PHLDB3 Gene

Gene Ontology (GO) - Biological Process for PHLDB3 Gene

No data available for Pathways by source and SIGNOR curated interactions for PHLDB3 Gene

Drugs & Compounds for PHLDB3 Gene

No Compound Related Data Available

Transcripts for PHLDB3 Gene

mRNA/cDNA for PHLDB3 Gene

(5) REFSEQ mRNAs :
(6) Additional mRNA sequences :
(9) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for PHLDB3 Gene

Pleckstrin homology-like domain, family B, member 3:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for PHLDB3 Gene

ExUns: 1 ^ 2a · 2b ^ 3a · 3b ^ 4a · 4b · 4c ^ 5a · 5b · 5c ^ 6a · 6b ^ 7a · 7b ^ 8 ^ 9
SP1: -
SP2: - -
SP3: - -
SP4: -

Relevant External Links for PHLDB3 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for PHLDB3 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for PHLDB3 Gene

mRNA differential expression in normal tissues according to GTEx for PHLDB3 Gene

This gene is overexpressed in Esophagus - Mucosa (x4.7), Skin - Sun Exposed (Lower leg) (x4.4), and Skin - Not Sun Exposed (Suprapubic) (x4.1).

Protein differential expression in normal tissues from HIPED for PHLDB3 Gene

This gene is overexpressed in Peripheral blood mononuclear cells (31.0), Testis (22.6), and Liver (6.6).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for PHLDB3 Gene

Protein tissue co-expression partners for PHLDB3 Gene

NURSA nuclear receptor signaling pathways regulating expression of PHLDB3 Gene:

SOURCE GeneReport for Unigene cluster for PHLDB3 Gene:

genes like me logo Genes that share expression patterns with PHLDB3: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for PHLDB3 Gene

Orthologs for PHLDB3 Gene

This gene was present in the common ancestor of animals.

Orthologs for PHLDB3 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia PHLDB3 34
  • 96 (a)
(Bos Taurus)
Mammalia PHLDB3 33 34
  • 84.92 (n)
(Canis familiaris)
Mammalia PHLDB3 33 34
  • 84.72 (n)
(Monodelphis domestica)
Mammalia PHLDB3 34
  • 84 (a)
(Mus musculus)
Mammalia Phldb3 33 16 34
  • 80.97 (n)
(Rattus norvegicus)
Mammalia Phldb3 33
  • 80.1 (n)
(Ornithorhynchus anatinus)
Mammalia -- 34
  • 2 (a)
(Anolis carolinensis)
Reptilia PHLDB3 34
  • 40 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia phldb3 33
  • 55.53 (n)
(Danio rerio)
Actinopterygii PHLDB3 34
  • 47 (a)
fruit fly
(Drosophila melanogaster)
Insecta CG5004 34
  • 10 (a)
sea squirt
(Ciona savignyi)
Ascidiacea CSA.5769 34
  • 24 (a)
Species where no ortholog for PHLDB3 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for PHLDB3 Gene

Gene Tree for PHLDB3 (if available)
Gene Tree for PHLDB3 (if available)

Paralogs for PHLDB3 Gene

Paralogs for PHLDB3 Gene

genes like me logo Genes that share paralogs with PHLDB3: view

Variants for PHLDB3 Gene

Sequence variations from dbSNP and Humsavar for PHLDB3 Gene

SNP ID Clin Chr 19 pos Sequence Context AA Info Type
rs201842186 Uncertain significance 43,506,795(+) CCGCC(A/C/T)TCTCC upstream-variant-2KB, utr-variant-3-prime
rs778362220 Uncertain significance 43,506,819(+) ATTAA(C/G/T)AGTGG upstream-variant-2KB, utr-variant-3-prime
rs1000099097 -- 43,484,848(+) GGCAC(-/CAATGCCCTAGAATTATTCTTATAATTCTAG)CAGCT intron-variant
rs1000158147 -- 43,504,193(+) CCGCT(C/T)GCGTC intron-variant, utr-variant-5-prime
rs1000188780 -- 43,485,026(+) ATATT(A/G)AAAAT intron-variant

Structural Variations from Database of Genomic Variants (DGV) for PHLDB3 Gene

Variant ID Type Subtype PubMed ID
nsv509744 CNV insertion 20534489
nsv2502 CNV insertion 18451855
nsv1057657 CNV gain 25217958
esv3644470 CNV loss 21293372
esv2762041 CNV loss 21179565
esv2668877 CNV deletion 23128226
dgv3603n100 CNV gain 25217958

Variation tolerance for PHLDB3 Gene

Residual Variation Intolerance Score: 92.6% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 6.21; 76.07% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for PHLDB3 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for PHLDB3 Gene

Disorders for PHLDB3 Gene

Relevant External Links for PHLDB3

Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for PHLDB3 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for PHLDB3 Gene

Publications for PHLDB3 Gene

  1. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T … Sugano S (Nature genetics 2004) 3 4 60
  2. The DNA sequence and biology of human chromosome 19. (PMID: 15057824) Grimwood J … Lucas SM (Nature 2004) 3 4 60
  3. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 60
  4. Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 60
  5. An organelle-specific protein landscape identifies novel diseases and molecular mechanisms. (PMID: 27173435) Boldt K … UK10K Rare Diseases Group (Nature communications 2016) 3 60

Products for PHLDB3 Gene

Sources for PHLDB3 Gene

Loading form....