Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

PASK Gene

protein-coding   GIFtS: 62
GCID: GC02M242045

PAS domain containing serine/threonine kinase

 Explore 4 diseases affiliated with
PASK via our new
 Human Malady Compendium 
Biological research products
for PASK
    

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section

Aliases
PAS Domain Containing Serine/Threonine Kinase1 2     Per-Arnt-Sim (PAS) Domain Kinase2
PASKIN1 2 3     EC 2.7.11.13
KIAA01351 3 5     PAS-Kinase1
STK371 2     HPASK1
PAS Domain-Containing Serine/Threonine-Protein Kinase2     

External Ids:    HGNC: 172701   Entrez Gene: 231782   Ensembl: ENSG000001156877   OMIM: 6075055   UniProtKB: Q96RG23   

Export aliases for PASK gene to outside databases

Previous GC identifers: GC02P239351 GC02P240214 GC02M242065 GC02M242366 GC02M241765 GC02M233801


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for PASK:
This gene encodes a member of the serine/threonine kinase family that contains two PAS domains. Expression of this gene
is regulated by glucose, and the encoded protein plays a role in the regulation of insulin gene expression.
Downregulation of this gene may play a role in type 2 diabetes. Alternatively spliced transcript variants encoding
multiple isoforms have been observed for this gene. (provided by RefSeq, Nov 2011)

UniProtKB/Swiss-Prot: PASK_HUMAN, Q96RG2
Function: Serine/threonine-protein kinase involved in energy homeostasis and protein translation. Phosphorylates
EEF1A1, GYS1, PDX1 and RPS6. Probably plays a role under changing environmental conditions (oxygen, glucose,
nutrition), rather than under standard conditions. Acts as a sensor involved in energy homeostasis: regulates glycogen
synthase synthesis by mediating phosphorylation of GYS1, leading to GYS1 inactivation. May be involved in
glucose-stimulated insulin production in pancreas and regulation of glucagon secretion by glucose in alpha cells;
however such data require additional evidences. May play a role in regulation of protein translation by
phosphorylating EEF1A1, leading to increase translation efficiency. May also participate to respiratory regulation

Gene Wiki entry for PASK


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000002.11  NC_018913.1  NT_005416.13  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the PASK gene promoter:
         NF-1/L   NF-1   Pax-5   AML1a   CUTL1   AREB6   Egr-2   c-Myb   GCNF-2   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidPASK promoter sequence
   Search SABiosciences Chromatin IP Primers for PASK

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat PASK


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 2q37.3   Ensembl cytogenetic band:  2q37.3   HGNC cytogenetic band: 2q37.3

PASK Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
PASK gene location

GeneLoc information about chromosome 2         GeneLoc Exon Structure

GeneLoc location for GC02M242045:  view genomic region     (about GC identifiers)

Start:
242,045,514 bp from pter      End:
242,089,679 bp from pter
Size:
44,166 bases      Orientation:
minus strand

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: PASK_HUMAN, Q96RG2 (See protein sequence)
Recommended Name: PAS domain-containing serine/threonine-protein kinase  
Size: 1323 amino acids; 142929 Da
Subcellular location: Cytoplasm. Nucleus. Note=Localizes in the nucleus of testis germ cells and in the midpiece of
sperm tails
Sequence caution: Sequence=BAA09484.2; Type=Erroneous initiation; Note=Translation N-terminally shortened;
2 PDB 3D structures from and Proteopedia for PASK:
1LL8 (3D)        3DLS (3D)    
Secondary accessions: G5E9F1 Q05BE4 Q68DY3 Q6GSJ5 Q86XH6 Q99763 Q9UFR7
Alternative splicing: 3 isoforms:  Q96RG2-1   Q96RG2-2   Q96RG2-4   (No experimental confirmation available)

Explore the universe of human proteins at neXtProt for PASK: NX_Q96RG2

Post-translational modifications:

  • Autophosphorylated on Thr-1161 and Thr-1165. Autophosphorylation is activated by phospholipids1
  • View modification sites using PhosphoSitePlus2
  • View neXtProt modification sites for NX_Q96RG2

  • PASK Protein expression data from MOPED and PaxDb:    About this image 
    Estimated protein expression log10 (pmol).

    REFSEQ proteins (5 alternative transcripts): 
    NP_001239048.1  NP_001239049.1  NP_001239051.1  NP_001239053.1  NP_055963.2  

    ENSEMBL proteins: 
     ENSP00000234040   ENSP00000384016   ENSP00000351475   ENSP00000384438   ENSP00000408506  
     ENSP00000395672   ENSP00000400734   ENSP00000397922   ENSP00000441374   ENSP00000443083  

    Human Recombinant Protein Products: 
    EMD Millipore Purified and/or Recombinant PASK Protein
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein: PASK
    OriGene Protein Over-expression Lysate: PASK
    OriGene Custom Protein Services for PASK 
    GenScript Custom Purified and Recombinant Proteins Services for PASK
    Novus Biologicals PASK Protein
    Novus Biologicals PASK Lysate
    Browse Sino Biological Recombinant Proteins
    Browse ProSpec Recombinant Proteins
    Uscn Proteins for PASK

    Gene Ontology (GO): 3 cellular component terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005634nucleus IDA17595531
    GO:0005737cytoplasm IDA--
    GO:0005794Golgi apparatus IDA--


    PASK for ontologies           About GeneDecksing



    PASK Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Cell Signaling Technology (CST) Antibodies for PASK 
    OriGene Antibodies (see all 2): PASK
    OriGene Custom Antibody Services for PASK 
    GenScript Custom Superior Antibodies Services for PASK
    Novus Biologicals PASK Antibodies
    Search for Antibodies for PASK at Abcam  
    Uscn Antibodies for PASK
    ThermoFisher Antibody for PASK

    Assay Products for PASK: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Immunoassay Development
    Browse OriGene Fluorogenic Cell Assay Kits
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for PASK
    Browse Enzo Life Sciences for kits & assays
    Uscn ELISAs and CLIAs for PASK


    (According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    PASK for domains           About GeneDecksing

    5/6 InterPro domains/families (see all 6):
     IPR017441 Protein_kinase_ATP_BS
     IPR002290 Ser/Thr_dual-sp_kinase_dom
     IPR011009 Kinase-like_dom
     IPR008271 Ser/Thr_kinase_AS
     IPR000719 Prot_kinase_cat_dom

    Graphical View of Domain Structure for InterPro Entry Q96RG2

    ProtoNet protein and cluster: Q96RG2

    2 Blocks protein families:
    IPB000014 PAS domain
    IPB013767 PAS fold


    UniProtKB/Swiss-Prot: PASK_HUMAN, Q96RG2
    Domain: The protein kinase domain mediates binding to phosphatidylinositol
    Similarity: Belongs to the protein kinase superfamily. CAMK Ser/Thr protein kinase family
    Similarity: Contains 2 PAS (PER-ARNT-SIM) domains
    Similarity: Contains 1 protein kinase domain


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
    About This Section

    Function Summary:

         UniProtKB/Swiss-Prot: PASK_HUMAN, Q96RG2
    Function: Serine/threonine-protein kinase involved in energy homeostasis and protein translation. Phosphorylates
    EEF1A1, GYS1, PDX1 and RPS6. Probably plays a role under changing environmental conditions (oxygen, glucose,
    nutrition), rather than under standard conditions. Acts as a sensor involved in energy homeostasis: regulates glycogen
    synthase synthesis by mediating phosphorylation of GYS1, leading to GYS1 inactivation. May be involved in
    glucose-stimulated insulin production in pancreas and regulation of glucagon secretion by glucose in alpha cells;
    however such data require additional evidences. May play a role in regulation of protein translation by
    phosphorylating EEF1A1, leading to increase translation efficiency. May also participate to respiratory regulation
    Catalytic activity: ATP + a protein = ADP + a phosphoprotein
    Enzyme regulation: Protein kinase activity is inhibited by the first PAS domain: binding of an unidentified ligand
    desinhibits the protein kinase activity. May be activated by autophosphorylation on Thr-1161 and Thr-1165
    (PubMed:11459942). The activating role of autophosphorylation at Thr-1161 is unclear: according to a report,
    autophosphorylation at Thr-1161 does not play a major role in activation (PubMed:20943661). Autophosphorylation is
    enhanced upon phosphatidylinositol monophosphate (phosphatidylinositol 4-phosphate) binding and inhibited upon
    phosphatidylinositol bi- and tri-phosphate binding. In contrast, phosphorylation of target proteins is inhibited upon
    all phosphatidylinositol-binding (phosphatidylinositol mono- bi- and tri-phosphate)

    Enzyme Number (IUBMB): EC 2.7.11.11

    miRNA
    Products:
        
    OriGene 3'-UTR Clone: PASK
    Browse MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat PASK
    2 QIAGEN miScript miRNA Assays for microRNAs that regulate PASK:
    hsa-miR-129-3p hsa-miR-129*
    SwitchGear 3'UTR luciferase reporter plasmidPASK 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for PASK (see all 6)
    OriGene shRNA RFP: PASK
    OriGene siRNA: PASK
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat PASK

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for PASK

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for PASK (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for PASK
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: PASK (NM_015148)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for PASK
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat PASK 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for PASK
    Search LifeMap BioReagents cell lines for PASK

    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for PASK

    Gene Ontology (GO): 5/6 molecular function terms (GO ID links to tree view) (see all 6):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0004672protein kinase activity ----
    GO:0004674protein serine/threonine kinase activity IDA--
    GO:0004871signal transducer activity IEA--
    GO:0005515protein binding IPI17595531
    GO:0005524ATP binding IEA--


    PASK for ontologies           About GeneDecksing


    3 GenomeRNAi human phenotypes for PASK:
     Decreased substrate adherent c  High actin ratio cells  Increased cell death HMECs cel 

    Animal Models:
         9 MGI mutant phenotypes (inferred from 1 allele(MGI details for Pask):
     behavior/neurological  endocrine/exocrine gland  growth/size  homeostasis/metabolism  liver/biliary system 
     muscle  nervous system  reproductive system  respiratory system 

    PASK for phenotypes           About GeneDecksing


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
    About This Section

    Unified GeneCards pathways  About this table 
    See pathways by source

    Super-pathwaycontained gene-specific pathways
    1Glucose / Energy Metabolism
    Glucose / Energy Metabolism1.00

    Pathway sources
    See GeneCards unified pathways
    Show all pathways


    1 Cell Signaling Technology (CST) Pathway for PASK
        Glucose / Energy Metabolism



    PASK for pathways           About GeneDecksing

    Interactions:

        SABiosciences Gene Network CentralTM Interacting Genes and Proteins Network for PASK

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    5/59 Interacting proteins for PASK (Q96RG22, 3 ENSP000002340404) via UniProtKB, MINT, STRING, and/or I2D (see all 59)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    PHKBQ931002, 3, ENSP000003135044MINT-8145434 MINT-8148568 I2D: score=1 STRING: ENSP00000313504
    EIF4ENIF1Q9NRA82, 3, ENSP000003281034MINT-8145410 I2D: score=1 STRING: ENSP00000328103
    FGAP026712, 3, ENSP000003063614MINT-8149008 I2D: score=1 STRING: ENSP00000306361
    FXNQ165952, 3, ENSP000003664824MINT-8145353 I2D: score=1 STRING: ENSP00000366482
    HSPB1P047922, 3, ENSP000002485534MINT-8148722 I2D: score=1 STRING: ENSP00000248553
    About this table

    Gene Ontology (GO): 5/7 biological process terms (GO ID links to tree view) (see all 7):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006468protein phosphorylation IDA16275910
    GO:0043576regulation of respiratory gaseous exchange ISS--
    GO:0045719negative regulation of glycogen biosynthetic process IDA16275910
    GO:0045727positive regulation of translation TAS17595531
    GO:0046777protein autophosphorylation IDA--


    PASK for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section

    PASK for compounds           About GeneDecksing

    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for PASK

    2 HMDB Compounds for PASK    About this table
    CompoundSynonyms CAS #PubMed Ids
    ADPadenosindiphosphorsaeure (see all 8)58-64-0--
    Adenosine triphosphate5'-(tetrahydrogen triphosphate) Adenosine (see all 24)56-65-5--
    3 Novoseek chemical compound relationships for PASK gene    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    serine 23.8 5 9761740 (2)
    oxygen 14.7 4 15148392 (1), 11688972 (1), 15936961 (1)
    glucose 2.39 8 15148392 (3), 17052199 (1)

    Search CenterWatch for drugs/clinical trials and news about PASK 

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for PASK gene (5 alternative transcripts): 
    NM_001252119.1  NM_001252120.1  NM_001252122.1  NM_001252124.1  NM_015148.3  

    Unigene Cluster for PASK:

    PAS domain containing serine/threonine kinase
    Hs.397891  [show with all ESTs]
    Unigene Representative Sequence: NM_001252124
    16 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000234040(uc010zol.2 uc010zom.2 uc002wao.2 uc010fzl.2 uc010zon.2)
    ENST00000472072 ENST00000405260(uc021vzf.1) ENST00000358649 ENST00000489256
    ENST00000475666 ENST00000403638(uc002waq.3) ENST00000493544(uc002wap.3)
    ENST00000459710 ENST00000437780 ENST00000433589 ENST00000415234 ENST00000485940
    ENST00000452907 ENST00000544142 ENST00000539818

    miRNA
    Products:
         
    OriGene 3'-UTR Clone: PASK
    Browse OriGene MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat PASK
    2 QIAGEN miScript miRNA Assays for microRNAs that regulate PASK:
    hsa-miR-129-3p hsa-miR-129*
    SwitchGear 3'UTR luciferase reporter plasmidPASK 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for PASK (see all 6)
    OriGene shRNA RFP: PASK
    OriGene siRNA: PASK
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat PASK
    Clone
    Products:
         
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for PASK (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for PASK
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: PASK (NM_015148)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for PASK
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat PASK 
    Primer
    Products:
        
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for PASK
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat PASK
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat PASK
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat PASK

    Additional cDNA sequence: 

    AF387103.1 AK026769.1 AK056516.1 AK296945.1 AK302417.1 AK302561.1 BC020054.1 BC043495.1 
    BC050565.1 BC063585.1 CR749231.1 D50925.2 U79240.1 

    10 DOTS entries:

    DT.211779  DT.405306  DT.95331006  DT.97792854  DT.100754303  DT.100846196  DT.40116856  DT.95286285 
    DT.95316064  DT.75102265 

    2 AceView cDNA sequences:

    AL117400 AW512692 

    GeneLoc Exon Structure

    5/14 Alternative Splicing Database (ASD) splice patterns (SP) for PASK (see all 14)    About this scheme

    ExUns: 1a · 1b ^ 2a · 2b ^ 3 ^ 4a · 4b · 4c · 4d ^ 5 ^ 6 ^ 7a · 7b ^ 8 ^ 9a · 9b ^ 10 ^ 11 ^ 12 ^ 13 ^ 14a · 14b · 14c ^ 15 ^ 16a · 16b ·
    SP1:              -     -           -                             -                                               -     -                                       
    SP2:                                                                                                                                                            
    SP3:              -     -           -     -     -     -     -     -                                                                                             
    SP4:                                                                                                                                                            
    SP5:              -     -     -     -     -     -     -     -     -                                                                                             

    ExUns: 16c ^ 17 ^ 18a · 18b ^ 19a · 19b · 19c ^ 20 ^ 21 ^ 22 ^ 23a · 23b ^ 24a · 24b
    SP1:                                                                                    
    SP2:                    -                       -     -                                 
    SP3:                                                                                    
    SP4:                                                                                    
    SP5:                                                                                    


    ECgene alternative splicing isoforms for PASK

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    PASK expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS
    CGAP TAG: GCCAGTCCAG

    Microarray
    RNAseq (Illumina Body Map)
    (100×FPKM)½
    SAGE (Serial Analysis of Gene Expression)

    About this image

    PASK expression in embryonic tissues and stem cells
    Expression by the Database of Embryonic development, Stem cell research, and Regenerative medicine    About this table
    Stem Cell Differentiation: 1 LifeMap Cell 
    NameCategory
    Primitive gut tube-like cells (A scalable, suspensi...)
    Expression: Positive    Negative     Selective marker
    Experimental details: Curated     Microarrays     In-situ hybridization

    See PASK Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for PASK

    SOURCE GeneReport for Unigene cluster: Hs.397891

    UniProtKB/Swiss-Prot: PASK_HUMAN, Q96RG2
    Tissue specificity: Ubiquitously expressed, with slightly higher expression in brain, prostate and testis. Reduced
    expression was found in placenta. Present in germ cells of testis and in the midpiece of sperm tails (at protein
    level)

        SABiosciences Custom PCR Arrays for PASK
    Primer
    Products:
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for PASK
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat PASK
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat PASK
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat PASK
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for PASK

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of animals.

    Orthologs for PASK gene from 5/21 species (see all 21)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    chicken
    (Gallus gallus)
    Aves PASK1 PAS domain containing serine/threonine kinase 61.58(n)
    57.63(a)
      424845  XM_422656.3  XP_422656.3 
    lizard
    (Anolis carolinensis)
    Reptilia PASK6
    --
    47(a)
    1 ↔ 1
    3(30102239-30127485)
    African clawed frog
    (Xenopus laevis)
    Amphibia Xl.323412 Xenopus laevis transcribed sequence with weak similarity more 76.32(n)    BJ631511.1 
    zebrafish
    (Danio rerio)
    Actinopterygii wufb69h072 wufb69h07 72.78(n)   322674  AI544962.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta Pask6
    PAS kinase
    29(a)
    1 ↔ 1
    2R(19876240-19879573)


    ENSEMBL Gene Tree for PASK (if available)
    TreeFam Gene Tree for PASK (if available) 

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for PASK gene
    PIM22  PIM12  PIM32  
    18/36 SIMAP similar genes for PASK using alignment to 7 protein entries:     PASK_HUMAN (see all proteins) (see all similar genes):
    KIAA0135    NUAK1    MARK3    MARK4    HUNK    BRSK2
    PRKAA1    BRAF    RPS6KA1    STK25    ULK1    CAMK1
    KIN27    MARK2    PHKG1    CHEK1    DAPK1    NEK9

    PASK for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/1089 NCBI SNPs in PASK are shown (see all 1089    About this table
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 2 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs1112920971,2
    --242045123(+) CAGCTC/TGGAGG 4 -- ds50011Minor allele frequency- T:0.50CSA 2
    rs1425012191,2
    C,--242045135(+) ATACA-/GGGCTGGAGCCCCTCAC
    ACAGACCAGAGGTGGGGGCT
    GGGCC
    4 -- ds50010--------
    rs1817600791,2
    --242045194(+) ATGTGA/GACAGA 4 -- ds50010--------
    rs1481094581,2
    --242045239(+) CTGCTA/GGCAGT 4 -- ds50010--------
    rs1129433261,2
    C,--242045512(+) GTCAGG/AATAAC 4 -- ds50011Minor allele frequency- A:0.50NA 2
    rs1506371291,2
    --242045560(+) TGAGG-/AAATA 
            
    AATTA
    4 -- ut310--------
    rs32751,2
    C,F,H,--242045589(+) CCATTT/GGACTA 4 -- ut3111Minor allele frequency- G:0.01MN NS EA NA 1654
    rs168432771,2
    C,F,H,--242045631(+) TCAGAT/CGAGCA 4 -- ut3119Minor allele frequency- C:0.08NA NS EA WA 1864
    rs1844709301,2
    --242045649(+) AGTCAA/GAGGAA 4 -- ut310--------
    rs1506079271,2
    --242045671(+) ACATAC/TACAAA 4 -- ut310--------

    HapMap Linkage Disequilibrium report for PASK (242045514 - 242089679 bp)
    Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
    Database of Genomic Variants (DGV): 6 variations for PASK
         6 Indels: 45983 79083 90411 90409 79082 90410
    Human Gene Mutation Database (HGMD): PASK

    SABiosciences Cancer Mutation PCR Assays
    QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing PASK
    DNA2.0 Custom Variant and Variant Library Synthesis for PASK

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    PASK for disorders           About GeneDecksing

    OMIM gene information: 607505    OMIM disorders: --

    4 diseases for PASK:    About MalaCards
    glanders    duodenitis    pancreatitis    prostatitis

    1 disease from the University of Copenhagen DISEASES database for PASK:
    Glanders
    Human Genome Epidemiology (HuGE) Navigator: PASK (14 documents)

    Export disorders for PASK gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for PASK gene, integrated from 9 sources (see all 35):
    (articles sorted by number of sources associating them with PASK)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. PAS kinase: an evolutionarily conserved PAS domain-regulated serine/threonine kinase. (PubMed id 11459942)1, 2, 3 Rutter J.... McKnight S.L. (2001)
    2. Involvement of Per-Arnt-Sim (PAS) kinase in the stimu lation of preproinsulin and pancreatic duodenum homeobox 1 gene expression by g lucose. (PubMed id 15148392)1, 3, 9 da Silva Xavier G....Rutter G.A. (2004)
    3. Male germ cell expression of the PAS domain kinase PA SKIN and its novel target eukaryotic translation elongation factor eEF1A1. (PubMed id 17595531)1, 2, 9 Eckhardt K....Wenger R.H. (2007)
    4. Mammalian PASKIN, a PAS-serine/threonine kinase related to bacterial oxygen sensors. (PubMed id 11688972)1, 3, 9 Hofer T....Wenger R.H. (2001)
    5. Structure and interactions of PAS kinase N-terminal PAS domain: model for intramolecular kinase regulation. (PubMed id 12377121)1, 2, 9 Amezcua C.A.... Gardner K.H. (2002)
    6. Per-arnt-sim (PAS) domain-containing protein kinase is downregulated in human islets in type 2 diabetes and regulates glucagon secretion. (PubMed id 21181396)1, 2 da Silva Xavier G.... Rutter G.A. (2011)
    7. Structural bases of PAS domain-regulated kinase (PASK ) activation in the absence of activation loop phosphorylation. (PubMed id 20943661)1, 2 Kikani C.K....Rutter J. (2010)
    8. Control of mammalian glycogen synthase by PAS kinase. (PubMed id 16275910)1, 2 Wilson W.A....Rutter J. (2005)
    9. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S....Malek J. (2004)
    10. Construction of expression-ready cDNA clones for KIAA genes: manual curation of 330 KIAA cDNA clones. (PubMed id 12168954)1, 2 Nakajima D.... Nagase T. (2002)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 23178 HGNC: 17270 AceView: PASK Ensembl:ENSG00000115687 euGenes: HUgn23178
    ECgene: PASK H-InvDB: PASK

    (According to HUGE)
    About This Section
    HUGE: KIAA0135

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for PASK Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for PASK gene:
    Search GeneIP for patents involving PASK

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences),
    In Situ Hybridization Assays from
    Advanced Cell Diagnostics
    About This Section

     Browse for Gene Knock-down Tools from EMD Millipore
     Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
     Browse Small Molecules at EMD Millipore
     Browse Kits and Assays available from EMD Millipore
     Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
     EMD Millipore Purified and/or Recombinant PASK Protein
     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Phosphatase Activity Assays/Reagents   Browse Recombinant/Natural Proteins  
     OriGene Antibodies for PASK   OriGene shRNA RFP for PASK  
     OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for PASK   OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for PASK  
     OriGene Protein Over-expression Lysate for PASK   Browse OriGene Fluorogenic Cell Assay Kits  
     OriGene siRNA for PASK   OriGene 3'-UTR Clone for PASK  
     OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for PASK   OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for PASK  
     Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
     Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
     OriGene Purified Protein for PASK   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for PASK   OriGene Custom Protein Services for PASK  
     OriGene Custom Immunoassay Development  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat PASK
     QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing PASK
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat PASK
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat PASK
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat PASK
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat PASK
     GenScript Custom Purified and Recombinant Proteins Services for PASK GenScript cDNA clones with any tag delivered in your preferred vector for PASK
     GenScript Custom Assay Services for PASK GenScript Custom Superior Antibodies Services for PASK
     GenScript Custom overexpressing Cell Line Services for PASK CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Antibodies & Assays for PASK 

     Regulatory tfbs in PASK promoter
     Search Chromatin IP Primers for PASK
     RT2 qPCR Primer Assay in human, mouse, rat PASK
     GNC Network for PASK
     SABiosciences Custom PCR Arrays for PASK
     Search Tocris compounds for PASK
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological cDNA Clones
     Antibodies/Proteins Production Services
     Rabbit Monoclonal Antibody Platform
     Bulk Purchasing
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     PASK antibodies
     PASK proteins
     PASK lysates
     Search for Antibodies for PASK at Abcam
     See all of Abcam's Antibodies, Kits and Proteins for PASK
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     PASK Proteins, Antibodies, CLIAs, and ELISAs
     Search LifeMap BioReagents cell lines for PASK
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for PASK
     SwitchGear 3'UTR luciferase reporter plasmids for PASK
     SwitchGear Promoter luciferase reporter plasmids for PASK
     ThermoFisher Antibody for PASK
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat PASK
           
    GeneCards Homepage - Last full update: 18 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013

    View Random Gene

    Category
    VWF
    (GIFTS: 73)
    von Willebrand factor
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      PASK gene at Home site.
    hostname: 356980-web2.xennexinc.com index build: 100 solr: 1.4