Home
GeneCards Guide
Suite
- MalaCards
- GeneALaCart
- GeneDecks
- GeneIP
- GeneLoc
Terms and Conditions
- Terms of Use
- 3rd Party Notice
About Us
User Feedback
Mirror sites

Set Analyses:

Generates a file of GeneCards annotations for your list of genes

Advanced Search

Search By

Section (entire)

for

All GeneCards Within gene subset (to enable gene prioritization):
or upload a file of gene symbols

Category Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21

GIFtS
-

PASK Gene

protein-coding GIFtS: 62
GCID: GC02M242045

PAS domain containing serine/threonine kinase

Explore 4 diseases affiliated with
PASK via

MalaCards

our new
Human Malady Compendium

(According to ¹HGNC, ²Entrez Gene,
³UniProtKB/Swiss-Prot, ⁴UniProtKB/TrEMBL, ⁵OMIM, ⁶GeneLoc, ⁷Ensembl, ⁸DME, ⁹miRBase, and/or ¹⁰fRNAdb)
About This Section

Aliases
PAS Domain Containing Serine/Threonine Kinase¹ ²		Per-Arnt-Sim (PAS) Domain Kinase²
PASKIN¹ ² ³		EC 2.7.11.1³
KIAA0135¹ ³ ⁵		PAS-Kinase¹
STK37¹ ²		HPASK¹
PAS Domain-Containing Serine/Threonine-Protein Kinase²

External Ids:	HGNC: 17270¹	Entrez Gene: 23178²	Ensembl: ENSG00000115687⁷	OMIM: 607505⁵	UniProtKB: Q96RG2³

Export aliases for PASK gene to outside databases

Previous GC identifers: GC02P239351 GC02P240214 GC02M242065 GC02M242366 GC02M241765 GC02M233801

(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for PASK:

This gene encodes a member of the serine/threonine kinase family that contains two PAS domains. Expression of this gene

is regulated by glucose, and the encoded protein plays a role in the regulation of insulin gene expression.

Downregulation of this gene may play a role in type 2 diabetes. Alternatively spliced transcript variants encoding

multiple isoforms have been observed for this gene. (provided by RefSeq, Nov 2011)

UniProtKB/Swiss-Prot: PASK_HUMAN, Q96RG2

Function: Serine/threonine-protein kinase involved in energy homeostasis and protein translation. Phosphorylates

EEF1A1, GYS1, PDX1 and RPS6. Probably plays a role under changing environmental conditions (oxygen, glucose,

nutrition), rather than under standard conditions. Acts as a sensor involved in energy homeostasis: regulates glycogen

synthase synthesis by mediating phosphorylation of GYS1, leading to GYS1 inactivation. May be involved in

glucose-stimulated insulin production in pancreas and regulation of glucagon secretion by glucose in alpha cells;

however such data require additional evidences. May play a role in regulation of protein translation by

phosphorylating EEF1A1, leading to increase translation efficiency. May also participate to respiratory regulation

Gene Wiki entry for PASK

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section

RefSeq DNA sequence:

NC_000002.11 NC_018913.1 NT_005416.13

Regulatory elements:

SABiosciences Regulatory transcription factor binding sites in the PASK gene promoter:
NF-1/L NF-1 Pax-5 AML1a CUTL1 AREB6 Egr-2 c-Myb GCNF-2
Other transcription factors

SwitchGear Promoter luciferase reporter plasmid: PASK promoter sequence

Search SABiosciences Chromatin IP Primers for PASK

Epigenetics:

QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat PASK

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 2q37.3 Ensembl cytogenetic band: 2q37.3 HGNC cytogenetic band: 2q37.3

PASK Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
PASK gene location

GeneLoc information about chromosome 2 GeneLoc Exon Structure

GeneLoc location for GC02M242045: view genomic region (about GC identifiers)

Start:	242,045,514 bp from pter	End:	242,089,679 bp from pter
Size:	44,166 bases	Orientation:	minus strand

(According to ¹UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to ²PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: PASK_HUMAN, Q96RG2 (See protein sequence)

Recommended Name: PAS domain-containing serine/threonine-protein kinase

Size: 1323 amino acids; 142929 Da

Subcellular location: Cytoplasm. Nucleus. Note=Localizes in the nucleus of testis germ cells and in the midpiece of

sperm tails

Sequence caution: Sequence=BAA09484.2; Type=Erroneous initiation; Note=Translation N-terminally shortened;

2 PDB 3D structures from and Proteopedia for PASK:

1LL8 (3D)

3DLS (3D)

Secondary accessions: G5E9F1 Q05BE4 Q68DY3 Q6GSJ5 Q86XH6 Q99763 Q9UFR7

Alternative splicing: 3 isoforms: Q96RG2-1 Q96RG2-2 Q96RG2-4 (No experimental confirmation available)

Explore the universe of human proteins at neXtProt for PASK: NX_Q96RG2

Post-translational modifications:

Autophosphorylated on Thr-1161 and Thr-1165. Autophosphorylation is activated by phospholipids¹

View modification sites using PhosphoSitePlus²

View neXtProt modification sites for NX_Q96RG2

PASK Protein expression data from MOPED and PaxDb: About this image

REFSEQ proteins (5 alternative transcripts):

NP_001239048.1 NP_001239049.1 NP_001239051.1 NP_001239053.1 NP_055963.2

ENSEMBL proteins:

ENSP00000234040 ENSP00000384016 ENSP00000351475 ENSP00000384438 ENSP00000408506

ENSP00000395672 ENSP00000400734 ENSP00000397922 ENSP00000441374 ENSP00000443083

Human Recombinant Protein Products:

	EMD Millipore Purified and/or Recombinant PASK Protein
	Browse R&D Systems for human recombinant proteins
	Browse recombinant and purified proteins available from Enzo Life Sciences
	OriGene Purified Protein: PASK OriGene Protein Over-expression Lysate: PASK OriGene Custom Protein Services for PASK
	GenScript Custom Purified and Recombinant Proteins Services for PASK
	Novus Biologicals PASK Protein Novus Biologicals PASK Lysate
	Browse Sino Biological Recombinant Proteins
	Browse ProSpec Recombinant Proteins
	Uscn Proteins for PASK

Gene Ontology (GO): 3 cellular component terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0005634	nucleus	IDA	17595531
GO:0005737	cytoplasm	IDA	--
GO:0005794	Golgi apparatus	IDA	--

PASK for ontologies About GeneDecksing

PASK Antibody Products:

	Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
	Browse R&D Systems for Antibodies
	Cell Signaling Technology (CST) Antibodies for PASK
	OriGene Antibodies (see all 2): PASK OriGene Custom Antibody Services for PASK
	GenScript Custom Superior Antibodies Services for PASK
	Novus Biologicals PASK Antibodies
	Search for Antibodies for PASK at Abcam
	Uscn Antibodies for PASK
	ThermoFisher Antibody for PASK

Assay Products for PASK:

	Browse Kits and Assays available from EMD Millipore
	OriGene Custom Immunoassay Development Browse OriGene Fluorogenic Cell Assay Kits
	Browse R&D Systems for biochemical assays
	GenScript Custom Assay Services for PASK
	Browse Enzo Life Sciences for kits & assays
	Uscn ELISAs and CLIAs for PASK

(According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section

PASK for domains About GeneDecksing

5/6 InterPro domains/families (see all 6):

IPR017441 Protein_kinase_ATP_BS

IPR002290 Ser/Thr_dual-sp_kinase_dom

IPR011009 Kinase-like_dom

IPR008271 Ser/Thr_kinase_AS

IPR000719 Prot_kinase_cat_dom

Graphical View of Domain Structure for InterPro Entry Q96RG2

ProtoNet protein and cluster: Q96RG2

2 Blocks protein families:

IPB000014 PAS domain

IPB013767 PAS fold

UniProtKB/Swiss-Prot: PASK_HUMAN, Q96RG2

Domain: The protein kinase domain mediates binding to phosphatidylinositol

Similarity: Belongs to the protein kinase superfamily. CAMK Ser/Thr protein kinase family

Similarity: Contains 2 PAS (PER-ARNT-SIM) domains

Similarity: Contains 1 protein kinase domain

(According to ¹UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or ²DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
About This Section

Function Summary:

UniProtKB/Swiss-Prot: PASK_HUMAN, Q96RG2

Function: Serine/threonine-protein kinase involved in energy homeostasis and protein translation. Phosphorylates

EEF1A1, GYS1, PDX1 and RPS6. Probably plays a role under changing environmental conditions (oxygen, glucose,

nutrition), rather than under standard conditions. Acts as a sensor involved in energy homeostasis: regulates glycogen

synthase synthesis by mediating phosphorylation of GYS1, leading to GYS1 inactivation. May be involved in

glucose-stimulated insulin production in pancreas and regulation of glucagon secretion by glucose in alpha cells;

however such data require additional evidences. May play a role in regulation of protein translation by

phosphorylating EEF1A1, leading to increase translation efficiency. May also participate to respiratory regulation

Catalytic activity: ATP + a protein = ADP + a phosphoprotein

Enzyme regulation: Protein kinase activity is inhibited by the first PAS domain: binding of an unidentified ligand

desinhibits the protein kinase activity. May be activated by autophosphorylation on Thr-1161 and Thr-1165

(PubMed:11459942). The activating role of autophosphorylation at Thr-1161 is unclear: according to a report,

autophosphorylation at Thr-1161 does not play a major role in activation (PubMed:20943661). Autophosphorylation is

enhanced upon phosphatidylinositol monophosphate (phosphatidylinositol 4-phosphate) binding and inhibited upon

phosphatidylinositol bi- and tri-phosphate binding. In contrast, phosphorylation of target proteins is inhibited upon

all phosphatidylinositol-binding (phosphatidylinositol mono- bi- and tri-phosphate)

Enzyme Number (IUBMB): EC 2.7.11.1¹

miRNA Products:		OriGene 3'-UTR Clone: PASK Browse MicroRNA Expression Plasmids
		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat PASK
		2 QIAGEN miScript miRNA Assays for microRNAs that regulate PASK:
		hsa-miR-129-3p hsa-miR-129*
		SwitchGear 3'UTR luciferase reporter plasmid: PASK 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for PASK (see all 6) OriGene shRNA RFP: PASK OriGene siRNA: PASK
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat PASK

Gene Editing
Products:

DNA2.0 Custom Protein Engineering Service for PASK

Clone Products:		Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for PASK (see all 3) OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for PASK OriGene custom cloning services � gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector: PASK (NM_015148)
		Browse Sino Biological Human cDNA Clones
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for PASK
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat PASK

Cell Line Products:		GenScript Custom overexpressing Cell Line Services for PASK
		Search LifeMap BioReagents cell lines for PASK

In Situ Assay
Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for PASK

Gene Ontology (GO): 5/6 molecular function terms (GO ID links to tree view) (see all 6): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0004672	protein kinase activity	--	--
GO:0004674	protein serine/threonine kinase activity	IDA	--
GO:0004871	signal transducer activity	IEA	--
GO:0005515	protein binding	IPI	17595531
GO:0005524	ATP binding	IEA	--

PASK for ontologies About GeneDecksing

3 GenomeRNAi human phenotypes for PASK:

Decreased substrate adherent c

High actin ratio cells

Increased cell death HMECs cel

Animal Models:
9 MGI mutant phenotypes (inferred from 1 allele) (MGI details for Pask):

behavior/neurological	endocrine/exocrine gland	growth/size	homeostasis/metabolism	liver/biliary system
muscle	nervous system	reproductive system	respiratory system

PASK for phenotypes About GeneDecksing

(Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to ¹UniProtKB, ²MINT, ³I2D, and/or ⁴STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
About This Section

Unified GeneCards pathways About this table

See pathways by source

Super-pathway

contained gene-specific pathways

Glucose / Energy Metabolism

Glucose / Energy Metabolism

1.00

Pathway sources
See GeneCards unified pathways
Show all pathways

1 Cell Signaling Technology (CST) Pathway for PASK

Glucose / Energy Metabolism

PASK for pathways About GeneDecksing

Interactions:

SABiosciences Gene Network Central^TM Interacting Genes and Proteins Network for PASK

STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

5/59 Interacting proteins for PASK (Q96RG2^{2, 3} ENSP00000234040⁴) via UniProtKB, MINT, STRING, and/or I2D (see all 59)

Interactant		Interaction Details
GeneCard	External ID(s)	Interaction Details
PHKB	Q93100²^,³, ENSP00000313504⁴	MINT-8145434 MINT-8148568 I2D: score=1 STRING: ENSP00000313504
EIF4ENIF1	Q9NRA8²^,³, ENSP00000328103⁴	MINT-8145410 I2D: score=1 STRING: ENSP00000328103
FGA	P02671²^,³, ENSP00000306361⁴	MINT-8149008 I2D: score=1 STRING: ENSP00000306361
FXN	Q16595²^,³, ENSP00000366482⁴	MINT-8145353 I2D: score=1 STRING: ENSP00000366482
HSPB1	P04792²^,³, ENSP00000248553⁴	MINT-8148722 I2D: score=1 STRING: ENSP00000248553

About this table

Gene Ontology (GO): 5/7 biological process terms (GO ID links to tree view) (see all 7): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0006468	protein phosphorylation	IDA	16275910
GO:0043576	regulation of respiratory gaseous exchange	ISS	--
GO:0045719	negative regulation of glycogen biosynthetic process	IDA	16275910
GO:0045727	positive regulation of translation	TAS	17595531
GO:0046777	protein autophosphorylation	IDA	--

PASK for ontologies About GeneDecksing

(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
About This Section

PASK for compounds About GeneDecksing

Browse Small Molecules at EMD Millipore

Browse drugs & compounds from Enzo Life Sciences

Browse Tocris compounds for PASK

2 HMDB Compounds for PASK About this table

Compound	Synonyms	CAS #	PubMed Ids
ADP	adenosindiphosphorsaeure (see all 8)	58-64-0	--
Adenosine triphosphate	5'-(tetrahydrogen triphosphate) Adenosine (see all 24)	56-65-5	--

3 Novoseek chemical compound relationships for PASK gene About this table

Compound	-log (P-Val)	Hits	PubMed IDs for Articles with Shared Sentences (# sentences)
serine	23.8	5	9761740 (2)
oxygen	14.7	4	15148392 (1), 11688972 (1), 15936961 (1)
glucose	2.39	8	15148392 (3), 17052199 (1)

Search CenterWatch for drugs/clinical trials and news about PASK

(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
RNAi Products from EMD Millipore,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
About This Section

REFSEQ mRNAs for PASK gene (5 alternative transcripts):

NM_001252119.1 NM_001252120.1 NM_001252122.1 NM_001252124.1 NM_015148.3

Unigene Cluster for PASK:

PAS domain containing serine/threonine kinase

Hs.397891 [show with all ESTs]

Unigene Representative Sequence: NM_001252124

16 Ensembl transcripts including schematic representations, and UCSC links where relevant:

ENST00000234040(uc010zol.2 uc010zom.2 uc002wao.2 uc010fzl.2 uc010zon.2)

ENST00000472072 ENST00000405260(uc021vzf.1) ENST00000358649 ENST00000489256

ENST00000475666 ENST00000403638(uc002waq.3) ENST00000493544(uc002wap.3)

ENST00000459710 ENST00000437780 ENST00000433589 ENST00000415234 ENST00000485940

ENST00000452907 ENST00000544142 ENST00000539818

miRNA Products:		OriGene 3'-UTR Clone: PASK Browse OriGene MicroRNA Expression Plasmids
		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat PASK
		2 QIAGEN miScript miRNA Assays for microRNAs that regulate PASK:
		hsa-miR-129-3p hsa-miR-129*
		SwitchGear 3'UTR luciferase reporter plasmid: PASK 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for PASK (see all 6) OriGene shRNA RFP: PASK OriGene siRNA: PASK
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat PASK

Clone Products:		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for PASK (see all 3) OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for PASK OriGene custom cloning services � gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector: PASK (NM_015148)
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for PASK
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat PASK

Primer Products:		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for PASK Browse OriGene validated miRNA SYBR primer pairs
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat PASK
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat PASK
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat PASK

Additional cDNA sequence:

AF387103.1 AK026769.1 AK056516.1 AK296945.1 AK302417.1 AK302561.1 BC020054.1 BC043495.1

BC050565.1 BC063585.1 CR749231.1 D50925.2 U79240.1

10 DOTS entries:

DT.211779 DT.405306 DT.95331006 DT.97792854 DT.100754303 DT.100846196 DT.40116856 DT.95286285

DT.95316064 DT.75102265

2 AceView cDNA sequences:

AL117400 AW512692

GeneLoc Exon Structure

5/14 Alternative Splicing Database (ASD) splice patterns (SP) for PASK (see all 14) About this scheme

ExUns:	1a	·	1b	^	2a	·	2b	^	3	^	4a	·	4b	·	4c	·	4d	^	5	^	6	^	7a	·	7b	^	8	^	9a	·	9b	^	10	^	11	^	12	^	13	^	14a	·	14b	·	14c	^	15	^	16a	·	16b	·
SP1:					-		-				-										-																-		-
SP2:
SP3:					-		-				-		-		-		-		-		-
SP4:
SP5:					-		-		-		-		-		-		-		-		-

ExUns:	16c	^	17	^	18a	·	18b	^	19a	·	19b	·	19c	^	20	^	21	^	22	^	23a	·	23b	^	24a	·	24b
SP1:
SP2:							-								-		-
SP3:
SP4:
SP5:

ECgene alternative splicing isoforms for PASK

(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

PASK expression in normal human tissues (normalized intensities)
See probesets specificity/sensitivity at GeneAnnot
About this imageBioGPS
CGAP TAG: GCCAGTCCAG

About this image

PASK expression in embryonic tissues and stem cells

Expression by the Database of Embryonic development, Stem cell research, and Regenerative medicine About this table

Stem Cell Differentiation: 1 LifeMap Cell

Name

Category

Primitive gut tube-like cells (A scalable, suspensi...)

Expression:

Positive

Negative

Selective marker

Experimental details:

Curated

Microarrays

In-situ hybridization

See PASK Protein Expression from SPIRE MOPED and PaxDB
Genevestigator expression for PASK

SOURCE GeneReport for Unigene cluster: Hs.397891

UniProtKB/Swiss-Prot: PASK_HUMAN, Q96RG2

Tissue specificity: Ubiquitously expressed, with slightly higher expression in brain, prostate and testis. Reduced

expression was found in placenta. Present in germ cells of testis and in the midpiece of sperm tails (at protein

level)

SABiosciences Custom PCR Arrays for PASK

Primer Products:		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for PASK Browse OriGene validated miRNA SYBR primer pairs
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat PASK
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat PASK
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat PASK

In Situ
Assay Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for PASK

(Orthologs according to ^1,2HomoloGene (²older version, for species not in ¹newer version), ³euGenes, ⁴SGD , ⁵MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or ⁶Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section

This gene was present in the common ancestor of animals.

Orthologs for PASK gene from 5/21 species (see all 21) About this table

Organism	Taxonomic classification	Gene	Description	Human Similarity	Orthology Type	Details
chicken (Gallus gallus)	Aves	PASK¹	PAS domain containing serine/threonine kinase	61.58(n) 57.63(a)		424845 XM_422656.3 XP_422656.3
lizard (Anolis carolinensis)	Reptilia	PASK⁶	--	47(a)	1 ↔ 1	3(30102239-30127485)
African clawed frog (Xenopus laevis)	Amphibia	Xl.32341²	Xenopus laevis transcribed sequence with weak similarity more	76.32(n)		BJ631511.1
zebrafish (Danio rerio)	Actinopterygii	wufb69h07²	wufb69h07	72.78(n)		322674 AI544962.1
fruit fly (Drosophila melanogaster)	Insecta	Pask⁶	PAS kinase	29(a)	1 ↔ 1	2R(19876240-19879573)

ENSEMBL Gene Tree for PASK (if available)
TreeFam Gene Tree for PASK (if available)

(Paralogs according to ¹HomoloGene,
²Ensembl, and ³SIMAP, Pseudogenes according to ⁴Pseudogene.org Build 68)
About This Section

Paralogs for PASK gene

PIM2² PIM1² PIM3²

18/36 SIMAP similar genes for PASK using alignment to 7 protein entries: PASK_HUMAN (see all proteins) (see all similar genes):

KIAA0135 NUAK1 MARK3 MARK4 HUNK BRSK2

PRKAA1 BRAF RPS6KA1 STK25 ULK1 CAMK1

KIN27 MARK2 PHKG1 CHEK1 DAPK1 NEK9

PASK for paralogs About GeneDecksing

(SNPs/Variants according to the ¹NCBI SNP Database, ²Ensembl, ³PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
About This Section

SNP ID	Valid	Clinical significance	Chr 2 pos	Sequence	#	AA Chg	Type	More	#	Allele freq	Pop	Total sample	More
Genomic Data					Transcription Related Data				Allele Frequencies
				--	--	--		--	--
rs111292097^1,2		--	242045123(+)	`CAGCTC/TGGAGG`	4	--	ds500¹		1		CSA	2
rs142501219^1,2	C,	--	242045135(+)	`ATACA-/GGGCTGGAGCCCCTCAC ACAGACCAGAGGTGGGGGCTGGGCC`	4	--	ds500¹		0	--	--	--	--
rs181760079^1,2		--	242045194(+)	`ATGTGA/GACAGA`	4	--	ds500¹		0	--	--	--	--
rs148109458^1,2		--	242045239(+)	`CTGCTA/GGCAGT`	4	--	ds500¹		0	--	--	--	--
rs112943326^1,2	C,	--	242045512(+)	`GTCAGG/AATAAC`	4	--	ds500¹		1		NA	2
rs150637129^1,2		--	242045560(+)	`TGAGG-/AAATA AATTA`	4	--	ut3¹		0	--	--	--	--
rs3275^1,2	C,F,H,	--	242045589(+)	`CCATTT/GGACTA`	4	--	ut3¹		11		MN NS EA NA	1654
rs16843277^1,2	C,F,H,	--	242045631(+)	`TCAGAT/CGAGCA`	4	--	ut3¹		19		NA NS EA WA	1864
rs184470930^1,2		--	242045649(+)	`AGTCAA/GAGGAA`	4	--	ut3¹		0	--	--	--	--
rs150607927^1,2		--	242045671(+)	`ACATAC/TACAAA`	4	--	ut3¹		0	--	--	--	--

HapMap Linkage Disequilibrium report for PASK (242045514 - 242089679 bp)
Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
Database of Genomic Variants (DGV): 6 variations for PASK
6 Indels: 45983 79083 90411 90409 79082 90410
Human Gene Mutation Database (HGMD): PASK

SABiosciences Cancer Mutation PCR Assays

QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing PASK

DNA2.0 Custom Variant and Variant Library Synthesis for PASK

(in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
About This Section

PASK for disorders           About GeneDecksing

OMIM gene information: 607505    OMIM disorders: --

4 diseases for PASK:    About MalaCards

glanders duodenitis pancreatitis prostatitis

1 disease from the University of Copenhagen DISEASES database for PASK:

Glanders

Human Genome Epidemiology (HuGE) Navigator: PASK (14 documents)

Export disorders for PASK gene to outside databases

(in PubMed. Associations of this gene to articles via ¹Entrez Gene, ²UniProtKB/Swiss-Prot, ³HGNC, ⁴GAD, ⁵PharmGKB, ⁶HMDB, ⁷DrugBank, ⁸UniProtKB/TrEMBL, ⁹ Novoseek, and/or ¹⁰fRNAdb)
About This Section

PubMed articles for PASK gene, integrated from 9 sources (see all 35):
(articles sorted by number of sources associating them with PASK)

Utopia: connect your pdf to the dynamic
world of online information

PAS kinase: an evolutionarily conserved PAS domain-regulated serine/threonine kinase. (PubMed id 11459942)^{1, 2, 3} Rutter J.... McKnight S.L. (2001)
Involvement of Per-Arnt-Sim (PAS) kinase in the stimu lation of preproinsulin and pancreatic duodenum homeobox 1 gene expression by g lucose. (PubMed id 15148392)^{1, 3, 9} da Silva Xavier G....Rutter G.A. (2004)
Male germ cell expression of the PAS domain kinase PA SKIN and its novel target eukaryotic translation elongation factor eEF1A1. (PubMed id 17595531)^{1, 2, 9} Eckhardt K....Wenger R.H. (2007)
Mammalian PASKIN, a PAS-serine/threonine kinase related to bacterial oxygen sensors. (PubMed id 11688972)^{1, 3, 9} Hofer T....Wenger R.H. (2001)
Structure and interactions of PAS kinase N-terminal PAS domain: model for intramolecular kinase regulation. (PubMed id 12377121)^{1, 2, 9} Amezcua C.A.... Gardner K.H. (2002)
Per-arnt-sim (PAS) domain-containing protein kinase is downregulated in human islets in type 2 diabetes and regulates glucagon secretion. (PubMed id 21181396)^{1, 2} da Silva Xavier G.... Rutter G.A. (2011)
Structural bases of PAS domain-regulated kinase (PASK ) activation in the absence of activation loop phosphorylation. (PubMed id 20943661)^{1, 2} Kikani C.K....Rutter J. (2010)
Control of mammalian glycogen synthase by PAS kinase. (PubMed id 16275910)^{1, 2} Wilson W.A....Rutter J. (2005)
The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)^{1, 2} Gerhard D.S....Malek J. (2004)
Construction of expression-ready cDNA clones for KIAA genes: manual curation of 330 KIAA cDNA clones. (PubMed id 12168954)^{1, 2} Nakajima D.... Nagase T. (2002)

(in PubMed, OMIM, and NCBI Bookshelf)
About This Section

		AND	OR
Aliases
Free Text

Query String		PubMed OMIM NCBI Bookshelf
	(Note: In FireFox, select the above section and copy using Ctrl-C)

(According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
About This Section

Entrez Gene: 23178	HGNC: 17270	AceView: PASK	Ensembl:ENSG00000115687	euGenes: HUgn23178
ECgene: PASK	H-InvDB: PASK

(According to HUGE)
About This Section

HUGE: KIAA0135

(According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
About This Section

Name	Description
PharmGKB entry for PASK	Pharmacogenomics, SNPs, Pathways

Intellectual Property for PASK gene
(Patent information from GeneIP, Licensable technologies from WIS Yeda, Salk, Tufts, IP news from LifeMap Sciences, Inc.)

About This Section

Patent Information for PASK gene:
Search GeneIP for patents involving PASK

GeneCards and IP:
Japan Patent Office Licenses GeneCards European Patent Office Licenses GeneCards Improving the IP Search

(Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences),
In Situ Hybridization Assays from
Advanced Cell Diagnostics
About This Section

	Browse for Gene Knock-down Tools from EMD Millipore
	Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
	Browse Small Molecules at EMD Millipore
	Browse Kits and Assays available from EMD Millipore
	Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
	EMD Millipore Purified and/or Recombinant PASK Protein

	EMD Millipore Custom Antibody & Bulk Services
	EMD Millipore Preclinical / Clinical Development Services
	EMD Millipore Immunoassay Services
	EMD Millipore Target Screening & Profiling Services

	Browse Antibodies		Browse Cell Culture Products
	Browse ELISAs		Browse Flow Cytometry Kits
	Browse Primer Pairs		Browse Kinase Activity Assays/Reagents
	Browse ELISpot Kits/Development Modules		Browse TFB/Immunoprecipitation Assays
	Browse Apoptosis Detection Kits/Reagents		Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents
	Browse DNA Damage/Repair Kits/Reagents		Browse Multiplex/Array Assay Kits/Reagents
	Browse Cell Selection/Detection Kits/Reagents		Browse Secondary Antibodies/Controls/Staining Reagents
	Browse Phosphatase Activity Assays/Reagents		Browse Recombinant/Natural Proteins

	OriGene Antibodies for PASK		OriGene shRNA RFP for PASK
	OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for PASK		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for PASK
	OriGene Protein Over-expression Lysate for PASK		Browse OriGene Fluorogenic Cell Assay Kits
	OriGene siRNA for PASK		OriGene 3'-UTR Clone for PASK
	OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for PASK		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for PASK
	Browse OriGene GFP tagged cDNA clones in CMV expression vector		Browse OriGene MicroRNA Expression Plasmids
	Browse OriGene basic RS shRNAs		Browse OriGene validated miRNA SYBR primer pairs
	OriGene Purified Protein for PASK		OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
	OriGene Custom Antibody Services for PASK		OriGene Custom Protein Services for PASK
	OriGene Custom Immunoassay Development

	QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat PASK
	QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing PASK
	QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat PASK
	QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat PASK
	QIAGEN QuantiFast Probe-based Assays in human, mouse, rat PASK
	QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat PASK

	GenScript Custom Purified and Recombinant Proteins Services for PASK		GenScript cDNA clones with any tag delivered in your preferred vector for PASK
	GenScript Custom Assay Services for PASK		GenScript Custom Superior Antibodies Services for PASK
	GenScript Custom overexpressing Cell Line Services for PASK		CloneReady with Over 120,000 Genes
	Gene Synthesis: Any Gene in Any Vector		Vector-based siRNA and miRNA, Ready for Transfection
	Gene Mutant Library, Variants up to 10^11		Plasmid Preparation
	Custom Peptide Services

Antibodies & Assays for PASK

	Regulatory tfbs in PASK promoter
	Search Chromatin IP Primers for PASK
	RT² qPCR Primer Assay in human, mouse, rat PASK
	GNC Network for PASK
	SABiosciences Custom PCR Arrays for PASK

Search Tocris compounds for PASK

	Browse Sino Biological Proteins and Antibodies
	Browse Sino Biological cDNA Clones
	Antibodies/Proteins Production Services
	Rabbit Monoclonal Antibody Platform
	Bulk Purchasing

Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

	Novus Tissue Slides
	PASK antibodies
	PASK proteins
	PASK lysates

	Search for Antibodies for PASK at Abcam
	See all of Abcam's Antibodies, Kits and Proteins for PASK
	Custom Antibody / Protein Production Service
	Bulk Purchasing
	Advantages of Rabbit Monoclonal antibodies
	Abcam protocols and scientific support

Browse ProSpec Recombinant Proteins

PASK Proteins, Antibodies, CLIAs, and ELISAs

Search LifeMap BioReagents cell lines for PASK

	Gene Synthesis
	Protein Engineering
	Variant Library Synthesis
	Codon Optimization
	Protein Production and Purification

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for PASK

	SwitchGear 3'UTR luciferase reporter plasmids for PASK
	SwitchGear Promoter luciferase reporter plasmids for PASK

ThermoFisher Antibody for PASK

Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat PASK

GeneCards Homepage - Last full update: 18 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013

View Random Gene

Category			VWF (GIFTS: 73) von Willebrand factor
GIFtS Group

The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

The GeneCards Human Gene Database

Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

Hot genes Disease genes PASK gene at Home site.

hostname: 356980-web2.xennexinc.com index build: 100 solr: 1.4

Advanced Search

Export list of displayed genes

PASK Gene

PAS domain containing serine/threonine kinase

Aliases
for PASK gene

Summaries
for PASK gene

Genomic Views
for PASK gene

Proteins
for PASK gene

Protein Domains /
Families
for PASK gene

Function
for PASK gene

Pathways & Interactions
for PASK gene

Drugs & Compounds
for PASK gene

Transcripts
for PASK gene

Expression
for PASK gene

Orthologs
for PASK gene

Paralogs
for PASK gene

Genomic Variants
for PASK gene

Disorders / Diseases
for PASK gene

Publications
for PASK gene

External Searches for PASK gene

Genome Databases showing PASK gene

Other Databases showing PASK gene

Specialized Databases showing PASK gene

Intellectual Property
for PASK gene

Products
for PASK gene

View Random Gene

Advanced Search

Export list of displayed genes

PASK Gene

PAS domain containing serine/threonine kinase

Aliasesfor PASK gene

Summariesfor PASK gene

Genomic Viewsfor PASK gene

Proteinsfor PASK gene

Protein Domains /Familiesfor PASK gene

Functionfor PASK gene

Pathways & Interactionsfor PASK gene

Drugs & Compoundsfor PASK gene

Transcriptsfor PASK gene

Expression for PASK gene

Orthologsfor PASK gene

Paralogsfor PASK gene

Genomic Variantsfor PASK gene

Disorders / Diseasesfor PASK gene

Publicationsfor PASK gene

External Searches for PASK gene

Genome Databases showing PASK gene

Other Databases showing PASK gene

Specialized Databases showing PASK gene

Intellectual Propertyfor PASK gene

Productsfor PASK gene

View Random Gene

Aliases
for PASK gene

Summaries
for PASK gene

Genomic Views
for PASK gene

Proteins
for PASK gene

Protein Domains /
Families
for PASK gene

Function
for PASK gene

Pathways & Interactions
for PASK gene

Drugs & Compounds
for PASK gene

Transcripts
for PASK gene

Expression
for PASK gene

Orthologs
for PASK gene

Paralogs
for PASK gene

Genomic Variants
for PASK gene

Disorders / Diseases
for PASK gene

Publications
for PASK gene

Intellectual Property
for PASK gene

Products
for PASK gene