Free for academic non-profit institutions. Other users need a Commercial license

Aliases for P2RX5 Gene

Aliases for P2RX5 Gene

  • Purinergic Receptor P2X, Ligand Gated Ion Channel, 5 2 3
  • Purinergic Receptor P2X, Ligand-Gated Ion Channel, 5 2 3
  • P2X5 3 4
  • Lymphoid-Restricted Histocompatibility Antigen-1 3
  • Ionotropic ATP Receptor P2X5 3
  • ATP Receptor Subunit 3
  • Purinergic Receptor 4
  • ATP Receptor 4
  • LRH-1 3
  • P2X5R 3

External Ids for P2RX5 Gene

Previous GeneCards Identifiers for P2RX5 Gene

  • GC17M003890
  • GC17M003526
  • GC17M003784
  • GC17M003785
  • GC17M003523
  • GC17M003468
  • GC17M003575

Summaries for P2RX5 Gene

Entrez Gene Summary for P2RX5 Gene

  • The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream gene, TAX1BP3 (Tax1 binding protein 3). [provided by RefSeq, Mar 2011]

GeneCards Summary for P2RX5 Gene

P2RX5 (Purinergic Receptor P2X, Ligand Gated Ion Channel, 5) is a Protein Coding gene. Diseases associated with P2RX5 include cystinosis. Among its related pathways are CREB Pathway and Calcium signaling pathway. GO annotations related to this gene include transmembrane signaling receptor activity and purinergic nucleotide receptor activity. An important paralog of this gene is P2RX1.

UniProtKB/Swiss-Prot for P2RX5 Gene

  • Receptor for ATP that acts as a ligand-gated ion channel

Tocris Summary for P2RX5 Gene

  • P2X receptors are members of the ligand-gated ion channel family that open in response to extracellular ATP. Each receptor is made up of a trimer of subunits (P2X1-7) all of which share the common structure of two transmembrane domains.

Gene Wiki entry for P2RX5 Gene

No data available for PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for P2RX5 Gene

Genomics for P2RX5 Gene

Regulatory Elements for P2RX5 Gene

Epigenetics Products

  • DNA Methylation CpG Assay Predesigned for Pyrosequencing in human,mouse,rat

Genomic Location for P2RX5 Gene

Chromosome:
17
Start:
3,672,199 bp from pter
End:
3,696,404 bp from pter
Size:
24,206 bases
Orientation:
Minus strand

Genomic View for P2RX5 Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for P2RX5 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for P2RX5 Gene

Proteins for P2RX5 Gene

  • Protein details for P2RX5 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q93086-P2RX5_HUMAN
    Recommended name:
    P2X purinoceptor 5
    Protein Accession:
    Q93086
    Secondary Accessions:
    • G5E981
    • O43450
    • O75540
    • Q308M5
    • Q59F38
    • Q8IXW4
    • Q93087
    • Q9NZV0

    Protein attributes for P2RX5 Gene

    Size:
    422 amino acids
    Molecular mass:
    47205 Da
    Quaternary structure:
    • Functional P2XRs are organized as homomeric and heteromeric trimers.
    SequenceCaution:
    • Sequence=AAF43106.1; Type=Erroneous gene model prediction; Evidence={ECO:0000305}; Sequence=AK307959; Type=Frameshift; Positions=112; Evidence={ECO:0000305}; Sequence=BAD92860.1; Type=Frameshift; Positions=112; Evidence={ECO:0000305}; Sequence=BC028084; Type=Frameshift; Positions=112; Evidence={ECO:0000305};

    Alternative splice isoforms for P2RX5 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for P2RX5 Gene

Proteomics data for P2RX5 Gene at MOPED

Post-translational modifications for P2RX5 Gene

  • Glycosylation at Asn 77 and Asn 202
  • Modification sites at PhosphoSitePlus

Antibody Products

No data available for DME Specific Peptides for P2RX5 Gene

Domains & Families for P2RX5 Gene

Protein Domains for P2RX5 Gene

Suggested Antigen Peptide Sequences for P2RX5 Gene

Graphical View of Domain Structure for InterPro Entry

Q93086

UniProtKB/Swiss-Prot:

P2RX5_HUMAN :
  • Belongs to the P2X receptor family.
Family:
  • Belongs to the P2X receptor family.
genes like me logo Genes that share domains with P2RX5: view

Function for P2RX5 Gene

Molecular function for P2RX5 Gene

UniProtKB/Swiss-Prot Function:
Receptor for ATP that acts as a ligand-gated ion channel

Gene Ontology (GO) - Molecular Function for P2RX5 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001614 purinergic nucleotide receptor activity NAS 17895406
GO:0004888 transmembrane signaling receptor activity TAS 9414125
GO:0004931 extracellular ATP-gated cation channel activity NAS 17895406
GO:0005216 ion channel activity TAS 9414125
GO:0005524 ATP binding NAS 17895406
genes like me logo Genes that share ontologies with P2RX5: view
genes like me logo Genes that share phenotypes with P2RX5: view

Animal Models for P2RX5 Gene

MGI Knock Outs for P2RX5:

Animal Model Products

CRISPR Products

miRNA for P2RX5 Gene

miRTarBase miRNAs that target P2RX5

miRNA Products

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for P2RX5

In Situ Assay Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for P2RX5 Gene

Localization for P2RX5 Gene

Subcellular locations from UniProtKB/Swiss-Prot for P2RX5 Gene

Membrane; Multi-pass membrane protein.

Subcellular locations from

COMPARTMENTS
Jensen Localization Image for P2RX5 Gene COMPARTMENTS Subcellular localization image for P2RX5 gene
Compartment Confidence
plasma membrane 4
nucleus 3
extracellular 2

Gene Ontology (GO) - Cellular Components for P2RX5 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005639 integral component of nuclear inner membrane IBA --
GO:0005887 integral component of plasma membrane IEA --
genes like me logo Genes that share ontologies with P2RX5: view

Pathways & Interactions for P2RX5 Gene

genes like me logo Genes that share pathways with P2RX5: view

Pathways by source for P2RX5 Gene

1 Qiagen pathway for P2RX5 Gene

Interacting Proteins for P2RX5 Gene

STRING Interaction Network Preview (showing 3 interactants - click image to see details)
http://string-db.org/version_10/api/image/networkList?limit=0&targetmode=proteins&caller_identity=gene_cards&network_flavor=evidence&identifiers=9606.ENSP00000225328%0d%0a9606.ENSP00000344818%0d%0a9606.ENSP00000442349%0d%0a9606.ENSP00000343339%0d%0a
Selected Interacting proteins: ENSP00000225328 for P2RX5 Gene via STRING

Gene Ontology (GO) - Biological Process for P2RX5 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006810 transport TAS 9414125
GO:0006812 cation transport IBA --
GO:0007165 signal transduction TAS 9414125
GO:0007399 nervous system development TAS 9414125
GO:0010524 positive regulation of calcium ion transport into cytosol NAS 17895406
genes like me logo Genes that share ontologies with P2RX5: view

No data available for SIGNOR curated interactions for P2RX5 Gene

Drugs & Compounds for P2RX5 Gene

(6) Drugs for P2RX5 Gene - From: NovoSeek, ApexBio, and Tocris

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Ivermectin Approved Pharma NAChR/purinergic P2X4 receptor modulator, Allosteric modulator of alpha7 nicotinic receptors 45
Suramin Approved Pharma Activator 18
KN-93 Pharma CaMKII inhibitor,selective and cometitive 0
ATP Pharma Activator 0
BzATP Pharma Full agonist, Agonist 0

(4) Additional Compounds for P2RX5 Gene - From: Tocris

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
BzATP triethylammonium salt
112898-15-4
NF 023
104869-31-0
NF 449
627034-85-9
Suramin hexasodium salt
129-46-4
genes like me logo Genes that share compounds with P2RX5: view

Transcripts for P2RX5 Gene

Unigene Clusters for P2RX5 Gene

Purinergic receptor P2X, ligand-gated ion channel, 5:
Representative Sequences:

CRISPR Products

miRNA Products

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for P2RX5

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for P2RX5 Gene

ExUns: 1a · 1b · 1c · 1d ^ 2a · 2b ^ 3 ^ 4 ^ 5 ^ 6a · 6b ^ 7 ^ 8 ^ 9 ^ 10 ^ 11 ^ 12
SP1: -
SP2: - -
SP3: - -
SP4: -
SP5: -

Relevant External Links for P2RX5 Gene

GeneLoc Exon Structure for
P2RX5
ECgene alternative splicing isoforms for
P2RX5

Expression for P2RX5 Gene

mRNA expression in normal human tissues for P2RX5 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for P2RX5 Gene

This gene is overexpressed in Spleen (x16.1), Whole Blood (x5.5), and Small Intestine - Terminal Ileum (x4.6).

SOURCE GeneReport for Unigene cluster for P2RX5 Gene Hs.731607

mRNA Expression by UniProt/SwissProt for P2RX5 Gene

Q93086-P2RX5_HUMAN
Tissue specificity: Expressed at high levels in brain and immune system
genes like me logo Genes that share expression patterns with P2RX5: view

Primer Products

In Situ Assay Products

No data available for Protein differential expression in normal tissues , Protein expression and Protein tissue co-expression partners for P2RX5 Gene

Orthologs for P2RX5 Gene

This gene was present in the common ancestor of chordates.

Orthologs for P2RX5 Gene

Organism Taxonomy Gene Similarity Type Details
cow
(Bos Taurus)
Mammalia P2RX5 35
  • 81.41 (n)
  • 73.71 (a)
-- 36
  • 60 (a)
OneToMany
dog
(Canis familiaris)
Mammalia P2RX5 35
  • 80.84 (n)
  • 76.17 (a)
P2X5 36
  • 75 (a)
OneToMany
mouse
(Mus musculus)
Mammalia P2rx5 35
  • 76.12 (n)
  • 71.15 (a)
P2rx5 16
P2rx5 36
  • 64 (a)
OneToMany
chimpanzee
(Pan troglodytes)
Mammalia P2RX5 35
  • 98.82 (n)
  • 99.53 (a)
-- 36
  • 97 (a)
OneToMany
rat
(Rattus norvegicus)
Mammalia P2rx5 35
  • 75.43 (n)
  • 69.59 (a)
oppossum
(Monodelphis domestica)
Mammalia -- 36
  • 57 (a)
OneToMany
platypus
(Ornithorhynchus anatinus)
Mammalia -- 36
  • 61 (a)
OneToMany
chicken
(Gallus gallus)
Aves P2RX5 35
  • 73.99 (n)
  • 72.96 (a)
P2RX5 36
  • 65 (a)
OneToMany
tropical clawed frog
(Silurana tropicalis)
Amphibia p2rx5 35
  • 68.64 (n)
  • 71.83 (a)
zebrafish
(Danio rerio)
Actinopterygii p2rx5 35
  • 61.06 (n)
  • 56.41 (a)
p2rx5 36
  • 44 (a)
ManyToMany
p2rx8 36
  • 42 (a)
ManyToMany
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.718 35
Species with no ortholog for P2RX5:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for P2RX5 Gene

ENSEMBL:
Gene Tree for P2RX5 (if available)
TreeFam:
Gene Tree for P2RX5 (if available)

Paralogs for P2RX5 Gene

Paralogs for P2RX5 Gene

(7) SIMAP similar genes for P2RX5 Gene using alignment to 5 proteins:

genes like me logo Genes that share paralogs with P2RX5: view

Variants for P2RX5 Gene

Sequence variations from dbSNP and Humsavar for P2RX5 Gene

SNP ID Clin Chr 17 pos Sequence Context AA Info Type MAF
rs758272596 -- 3,688,005(+) AGGCA(-/CACGCACCTTGCCGTTCACCATCACGT)CAAAG intron-variant

Structural Variations from Database of Genomic Variants (DGV) for P2RX5 Gene

Variant ID Type Subtype PubMed ID
nsv907565 CNV Loss 21882294
nsv833342 CNV Loss 17160897
nsv1947 CNV Insertion 18451855
nsv907569 CNV Loss 21882294
nsv1948 CNV Loss 18451855
esv2094472 CNV Deletion 18987734
esv1195616 CNV Deletion 17803354
esv22375 CNV Gain+Loss 19812545
esv2715531 CNV Deletion 23290073
nsv512471 CNV Loss 21212237
nsv111790 CNV Loss 16902084
esv1604795 CNV Deletion 17803354
nsv827860 CNV Loss 20364138
nsv907570 CNV Gain 21882294

Variation tolerance for P2RX5 Gene

Residual Variation Intolerance Score: 78.48% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.66; 45.75% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for P2RX5 Gene

HapMap Linkage Disequilibrium report
P2RX5
Human Gene Mutation Database (HGMD)
P2RX5

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for P2RX5 Gene

Disorders for P2RX5 Gene

MalaCards: The human disease database

(1) MalaCards diseases for P2RX5 Gene - From: DISEASES and GeneCards

Disorder Aliases PubMed IDs
cystinosis
  • cystinosis [ambiguous]
- elite association
Search P2RX5 in MalaCards View complete list of genes associated with diseases

Relevant External Links for P2RX5

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
P2RX5
genes like me logo Genes that share disorders with P2RX5: view

No data available for UniProtKB/Swiss-Prot and Genatlas for P2RX5 Gene

Publications for P2RX5 Gene

  1. Abnormal expression of P2X family receptors in Chinese pediatric acute leukemias. (PMID: 19919827) Chong J.H. … Wu K.F. (Biochem. Biophys. Res. Commun. 2010) 23 67
  2. Moderate exercise increases expression for sensory, adrenergic, and immune genes in chronic fatigue syndrome patients but not in normal subjects. (PMID: 19647494) Light A.R. … Light K.C. (J Pain 2009) 23 67
  3. Purinergic receptors and calcium signalling in human pancreatic duct cell lines. (PMID: 18769042) Hansen M.R. … Novak I. (Cell. Physiol. Biochem. 2008) 23 67
  4. Glutamate release and synapsin-I phosphorylation induced by P2X7 receptors activation in cerebellar granule neurons. (PMID: 18242779) LeA^n D. … Miras-Portugal M.A. (Neurochem. Int. 2008) 23 67
  5. Human rheumatoid synoviocytes express functional P2X7 receptors. (PMID: 18545980) Caporali F. … Laghi Pasini F. (J. Mol. Med. 2008) 23 67

Products for P2RX5 Gene

Sources for P2RX5 Gene

Back to Top

Content