Free for academic non-profit institutions. Other users need a Commercial license

Aliases for P2RX5 Gene

Aliases for P2RX5 Gene

  • Purinergic Receptor P2X 5 2 3 5
  • P2X5 3 4
  • Purinergic Receptor P2X, Ligand-Gated Ion Channel, 5 2
  • Purinergic Receptor P2X, Ligand Gated Ion Channel, 5 3
  • Lymphoid-Restricted Histocompatibility Antigen-1 3
  • Ionotropic ATP Receptor P2X5 3
  • ATP Receptor Subunit 3
  • Purinergic Receptor 4
  • P2X Purinoceptor 5 3
  • ATP Receptor 4
  • LRH-1 3
  • P2X5R 3

External Ids for P2RX5 Gene

Previous GeneCards Identifiers for P2RX5 Gene

  • GC17M003890
  • GC17M003526
  • GC17M003784
  • GC17M003785
  • GC17M003523
  • GC17M003468
  • GC17M003575

Summaries for P2RX5 Gene

Entrez Gene Summary for P2RX5 Gene

  • The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream gene, TAX1BP3 (Tax1 binding protein 3). [provided by RefSeq, Mar 2011]

GeneCards Summary for P2RX5 Gene

P2RX5 (Purinergic Receptor P2X 5) is a Protein Coding gene. Diseases associated with P2RX5 include Cystinosis. Among its related pathways are Peptide ligand-binding receptors and Platelet activation, signaling and aggregation. GO annotations related to this gene include transmembrane signaling receptor activity and purinergic nucleotide receptor activity. An important paralog of this gene is P2RX5-TAX1BP3.

UniProtKB/Swiss-Prot for P2RX5 Gene

  • Receptor for ATP that acts as a ligand-gated ion channel.

Tocris Summary for P2RX5 Gene

  • P2X receptors are members of the ligand-gated ion channel family that open in response to extracellular ATP. Each receptor is made up of a trimer of subunits (P2X1-7) all of which share the common structure of two transmembrane domains.

Gene Wiki entry for P2RX5 Gene

No data available for PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for P2RX5 Gene

Genomics for P2RX5 Gene

Regulatory Elements for P2RX5 Gene

Enhancers for P2RX5 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
- Elite enhancer/Elite enhancer-gene association

Enhancers around P2RX5 on UCSC Golden Path with GeneCards custom track

Promoters for P2RX5 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

ENSRs around P2RX5 on UCSC Golden Path with GeneCards custom track

Genomic Location for P2RX5 Gene

3,672,199 bp from pter
3,696,404 bp from pter
24,206 bases
Minus strand

Genomic View for P2RX5 Gene

Genes around P2RX5 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
P2RX5 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for P2RX5 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for P2RX5 Gene

Proteins for P2RX5 Gene

  • Protein details for P2RX5 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    P2X purinoceptor 5
    Protein Accession:
    Secondary Accessions:
    • G5E981
    • O43450
    • O75540
    • Q308M5
    • Q59F38
    • Q8IXW4
    • Q93087
    • Q9NZV0

    Protein attributes for P2RX5 Gene

    422 amino acids
    Molecular mass:
    47205 Da
    Quaternary structure:
    • Functional P2XRs are organized as homomeric and heteromeric trimers.
    • Sequence=AAF43106.1; Type=Erroneous gene model prediction; Evidence={ECO:0000305}; Sequence=AK307959; Type=Frameshift; Positions=112; Evidence={ECO:0000305}; Sequence=BAD92860.1; Type=Frameshift; Positions=112; Evidence={ECO:0000305}; Sequence=BC028084; Type=Frameshift; Positions=112; Evidence={ECO:0000305};

    Alternative splice isoforms for P2RX5 Gene


neXtProt entry for P2RX5 Gene

Post-translational modifications for P2RX5 Gene

  • Glycosylation at Asn 77 and Asn 202
  • Modification sites at PhosphoSitePlus

Antibody Products

  • Abcam antibodies for P2X5b
  • Abcam antibodies for P2X5

No data available for DME Specific Peptides for P2RX5 Gene

Domains & Families for P2RX5 Gene

Protein Domains for P2RX5 Gene

Suggested Antigen Peptide Sequences for P2RX5 Gene

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the P2X receptor family.
  • Belongs to the P2X receptor family.
genes like me logo Genes that share domains with P2RX5: view

Function for P2RX5 Gene

Molecular function for P2RX5 Gene

UniProtKB/Swiss-Prot Function:
Receptor for ATP that acts as a ligand-gated ion channel.

Gene Ontology (GO) - Molecular Function for P2RX5 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001614 purinergic nucleotide receptor activity NAS 17895406
GO:0004888 transmembrane signaling receptor activity TAS 9414125
GO:0004931 extracellular ATP-gated cation channel activity NAS 17895406
GO:0005216 ion channel activity TAS 9414125
GO:0005524 ATP binding NAS 17895406
genes like me logo Genes that share ontologies with P2RX5: view
genes like me logo Genes that share phenotypes with P2RX5: view

Animal Models for P2RX5 Gene

MGI Knock Outs for P2RX5:

Animal Model Products

  • Taconic Biosciences Mouse Models for P2RX5

CRISPR Products

miRNA for P2RX5 Gene

miRTarBase miRNAs that target P2RX5

Clone Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for P2RX5 Gene

Localization for P2RX5 Gene

Subcellular locations from UniProtKB/Swiss-Prot for P2RX5 Gene

Membrane; Multi-pass membrane protein.

Subcellular locations from

Jensen Localization Image for P2RX5 Gene COMPARTMENTS Subcellular localization image for P2RX5 gene
Compartment Confidence
plasma membrane 5
nucleus 4
cytosol 2
extracellular 2
endoplasmic reticulum 1
mitochondrion 1

Gene Ontology (GO) - Cellular Components for P2RX5 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005639 integral component of nuclear inner membrane IBA --
GO:0005737 cytoplasm IDA --
GO:0005886 plasma membrane TAS --
GO:0005887 integral component of plasma membrane IEA --
genes like me logo Genes that share ontologies with P2RX5: view

Pathways & Interactions for P2RX5 Gene

genes like me logo Genes that share pathways with P2RX5: view

Pathways by source for P2RX5 Gene

Interacting Proteins for P2RX5 Gene

STRING Interaction Network Preview (showing 3 interactants - click image to see details)
Selected Interacting proteins: ENSP00000225328 Q93086-P2RX5_HUMAN for P2RX5 Gene via STRING IID

Gene Ontology (GO) - Biological Process for P2RX5 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006810 transport TAS 9414125
GO:0007165 signal transduction TAS 9414125
GO:0007399 nervous system development TAS 9414125
GO:0007596 blood coagulation TAS --
GO:0010524 positive regulation of calcium ion transport into cytosol NAS 17895406
genes like me logo Genes that share ontologies with P2RX5: view

No data available for SIGNOR curated interactions for P2RX5 Gene

Drugs & Compounds for P2RX5 Gene

(9) Drugs for P2RX5 Gene - From: ApexBio, Tocris, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
KN-93 Pharma CaMKII inhibitor,selective and cometitive 0
A 438079 hydrochloride Pharma P2X7 receptor antagonist,competitive and selective, Competitive P2X7 antagonist 0
A 804598 Pharma P2X7 antagonist,potent and selective, Potent and selective P2X7 antagonist 0
BzATP triethylammonium salt Pharma Photoaffinity label for ATPase; also P2X7 agonist and P2X1/P2Y1 partial agonist 0
NF 449 Pharma purinergic receptor antagonist, Highly selective P2X1 antagonist 0

(1) Additional Compounds for P2RX5 Gene - From: Tocris

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
ATPgammaS tetralithium salt

(5) Tocris Compounds for P2RX5 Gene

Compound Action Cas Number
A 438079 hydrochloride Competitive P2X7 antagonist 899431-18-6
A 804598 Potent and selective P2X7 antagonist 1125758-85-1
ATPgammaS tetralithium salt P2 agonist; ATP (Cat. No. 3245) analog 93839-89-5
BzATP triethylammonium salt Photoaffinity label for ATPase; also P2X7 agonist and P2X1/P2Y1 partial agonist 112898-15-4
NF 449 Highly selective P2X1 antagonist 627034-85-9

(1) ApexBio Compounds for P2RX5 Gene

Compound Action Cas Number
KN-93 CaMKII inhibitor,selective and cometitive 139298-40-1
genes like me logo Genes that share compounds with P2RX5: view

Transcripts for P2RX5 Gene

Unigene Clusters for P2RX5 Gene

Purinergic receptor P2X, ligand-gated ion channel, 5:
Representative Sequences:

CRISPR Products

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for P2RX5 Gene

ExUns: 1a · 1b · 1c · 1d ^ 2a · 2b ^ 3 ^ 4 ^ 5 ^ 6a · 6b ^ 7 ^ 8 ^ 9 ^ 10 ^ 11 ^ 12
SP1: -
SP2: - -
SP3: - -
SP4: -
SP5: -

Relevant External Links for P2RX5 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for P2RX5 Gene

mRNA expression in normal human tissues for P2RX5 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for P2RX5 Gene

This gene is overexpressed in Spleen (x16.1), Whole Blood (x5.5), and Small Intestine - Terminal Ileum (x4.6).

NURSA nuclear receptor signaling pathways regulating expression of P2RX5 Gene:


SOURCE GeneReport for Unigene cluster for P2RX5 Gene:


mRNA Expression by UniProt/SwissProt for P2RX5 Gene:

Tissue specificity: Expressed at high levels in brain and immune system.
genes like me logo Genes that share expression patterns with P2RX5: view

Primer Products

No data available for Protein differential expression in normal tissues , Protein expression and Protein tissue co-expression partners for P2RX5 Gene

Orthologs for P2RX5 Gene

This gene was present in the common ancestor of chordates.

Orthologs for P2RX5 Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia P2RX5 34
  • 81.41 (n)
  • 73.71 (a)
-- 35
  • 60 (a)
(Canis familiaris)
Mammalia P2RX5 34
  • 80.84 (n)
  • 76.17 (a)
P2X5 35
  • 75 (a)
(Mus musculus)
Mammalia P2rx5 34
  • 76.12 (n)
  • 71.15 (a)
P2rx5 16
P2rx5 35
  • 64 (a)
(Pan troglodytes)
Mammalia P2RX5 34
  • 98.82 (n)
  • 99.53 (a)
-- 35
  • 97 (a)
(Rattus norvegicus)
Mammalia P2rx5 34
  • 75.43 (n)
  • 69.59 (a)
(Ornithorhynchus anatinus)
Mammalia -- 35
  • 61 (a)
(Monodelphis domestica)
Mammalia -- 35
  • 57 (a)
(Gallus gallus)
Aves P2RX5 34
  • 73.99 (n)
  • 72.96 (a)
P2RX5 35
  • 65 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia p2rx5 34
  • 68.64 (n)
  • 71.83 (a)
(Danio rerio)
Actinopterygii p2rx5 34
  • 61.06 (n)
  • 56.41 (a)
p2rx5 35
  • 44 (a)
p2rx8 35
  • 42 (a)
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.718 34
Species where no ortholog for P2RX5 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for P2RX5 Gene

Gene Tree for P2RX5 (if available)
Gene Tree for P2RX5 (if available)

Paralogs for P2RX5 Gene

Paralogs for P2RX5 Gene

(7) SIMAP similar genes for P2RX5 Gene using alignment to 5 proteins:

genes like me logo Genes that share paralogs with P2RX5: view

Variants for P2RX5 Gene

Sequence variations from dbSNP and Humsavar for P2RX5 Gene

SNP ID Clin Chr 17 pos Sequence Context AA Info Type
rs758272596 -- 3,688,005(+) AGGCA(-/CACGCACCTTGCCGTTCACCATCACGT)CAAAG intron-variant

Structural Variations from Database of Genomic Variants (DGV) for P2RX5 Gene

Variant ID Type Subtype PubMed ID
dgv1406n106 CNV deletion 24896259
dgv5424n54 CNV gain 21841781
dgv5425n54 CNV loss 21841781
dgv5426n54 CNV gain+loss 21841781
dgv5427n54 CNV gain 21841781
dgv5428n54 CNV loss 21841781
esv1195616 CNV deletion 17803354
esv1604795 CNV deletion 17803354
esv2094472 CNV deletion 18987734
esv22375 CNV gain+loss 19812545
esv2715531 CNV deletion 23290073
esv3447841 CNV duplication 20981092
nsv1055740 CNV gain 25217958
nsv1065489 CNV gain 25217958
nsv1070796 CNV deletion 25765185
nsv111790 CNV deletion 16902084
nsv1947 CNV insertion 18451855
nsv1948 CNV deletion 18451855
nsv512471 CNV loss 21212237
nsv574237 CNV loss 21841781
nsv574244 CNV loss 21841781
nsv574246 CNV gain+loss 21841781
nsv574262 CNV loss 21841781
nsv827860 CNV loss 20364138
nsv833342 CNV loss 17160897
nsv952107 CNV deletion 24416366

Variation tolerance for P2RX5 Gene

Residual Variation Intolerance Score: 78.5% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.66; 45.75% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for P2RX5 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for P2RX5 Gene

Disorders for P2RX5 Gene

MalaCards: The human disease database

(1) MalaCards diseases for P2RX5 Gene - From: DISEASES and GeneCards

Disorder Aliases PubMed IDs
  • cystine storage disease
- elite association - COSMIC cancer census association via MalaCards
Search P2RX5 in MalaCards View complete list of genes associated with diseases

Relevant External Links for P2RX5

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with P2RX5: view

No data available for UniProtKB/Swiss-Prot and Genatlas for P2RX5 Gene

Publications for P2RX5 Gene

  1. Primary structure and expression of a naturally truncated human P2X ATP receptor subunit from brain and immune system. (PMID: 9414125) Le K.-T. … Seguela P. (FEBS Lett. 1997) 2 3 4 65
  2. Purinoceptor expression on keratinocytes reflects their function on the epidermis during chronic venous insufficiency. (PMID: 16967306) Metcalfe M.J. … Burnstock G. (Arch. Dermatol. Res. 2006) 3 22 65
  3. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T. … Sugano S. (Nat. Genet. 2004) 3 4 65
  4. Purinergic receptors are part of a functional signaling system for proliferation and differentiation of human epidermal keratinocytes. (PMID: 12787128) Greig A.V. … Burnstock G. (J. Invest. Dermatol. 2003) 3 22 65
  5. Expression of purinergic receptors in non-melanoma skin cancers and their functional roles in A431 cells. (PMID: 12880424) Greig A.V. … Burnstock G. (J. Invest. Dermatol. 2003) 3 22 65

Products for P2RX5 Gene

Sources for P2RX5 Gene
