Free for academic non-profit institutions. Other users need a Commercial license

Aliases for OVOL2 Gene

Aliases for OVOL2 Gene

  • Ovo Like Zinc Finger 2 2 3 5
  • Zinc Finger Protein 339 2 3 4
  • Corneal Endothelial Dystrophy 1 (Autosomal Dominant) 2 3
  • ZNF339 3 4
  • Transcription Factor Ovo-Like 2 3
  • Ovo-Like 2 (Drosophila) 2
  • EUROIMAGE566589 3
  • CHED2 3
  • PPCD1 3
  • CHED1 3
  • HOvo2 4
  • CHED 3

External Ids for OVOL2 Gene

Previous HGNC Symbols for OVOL2 Gene

  • ZNF339
  • CHED1

Previous GeneCards Identifiers for OVOL2 Gene

  • GC20M017947
  • GC20M017937

Summaries for OVOL2 Gene

Entrez Gene Summary for OVOL2 Gene

  • This gene encodes a member of the evolutionarily conserved ovo-like protein family. Mammalian members of this family contain a single zinc finger domain composed of a tetrad of C2H2 zinc fingers with variable N- and C-terminal extensions that contain intrinsically disordered domains. Members of this family are involved in epithelial development and differentiation. Knockout of this gene in mouse results in early embryonic lethality with phenotypes that include neurectoderm expansion, impaired vascularization, and heart anomalies. In humans, allelic variants of this gene have been associated with posterior polymorphous corneal dystrophy. [provided by RefSeq, Apr 2016]

GeneCards Summary for OVOL2 Gene

OVOL2 (Ovo Like Zinc Finger 2) is a Protein Coding gene. Diseases associated with OVOL2 include Corneal Dystrophy, Posterior Polymorphous, 1 and Corneal Endothelial Dystrophy 1, Autosomal Dominant. GO annotations related to this gene include transcription regulatory region DNA binding and RNA polymerase II transcription factor activity, sequence-specific DNA binding. An important paralog of this gene is OVOL1.

UniProtKB/Swiss-Prot for OVOL2 Gene

  • Zinc-finger transcription repressor factor. Plays a critical role to maintain the identity of epithelial lineages by suppressing epithelial-to mesenchymal transition (EMT) mainly through the repression of ZEB1, an EMT inducer. Positively regulates neuronal differentiation (By similarity). Suppresses cell cycling and terminal differentiation of keratinocytes by directly repressing MYC and NOTCH1 (PubMed:19700410).

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for OVOL2 Gene

Genomics for OVOL2 Gene

Regulatory Elements for OVOL2 Gene

Enhancers for OVOL2 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH20G017996 1.1 Ensembl ENCODE 10.4 +62.9 62888 0.6 ELF3 ATF1 RB1 NFIB ARID4B RAD21 ELK1 SCRT2 ZNF143 CREM MGME1 SNX5 SNORD17 RRBP1 OVOL2 ENSG00000229262 PIR51456 PTMAP3
GH20G018055 1.2 ENCODE dbSUPER 8.6 +1.5 1459 4.0 PKNOX1 SIN3A ZBTB7B GLIS2 ZNF263 ZNF579 MBD2 MAFF ZSCAN16 GLIS1 SNX5 OVOL2 GC20P018011
GH20G018030 0.8 ENCODE 11.3 +26.5 26485 3.5 SOX13 CTCF ARNT YBX1 PLRG1 ZNF7 TEAD3 FOXK2 ZNF366 HES1 MGME1 ENSG00000229262 OVOL2 GC20P018011
GH20G018048 0.2 Ensembl 6.2 +10.8 10788 0.4 OVOL2 GC20P018011
GH20G018056 0.7 ENCODE dbSUPER 0.7 +3.8 3767 0.2 ZNF652 EZH2 SNX5 OVOL2 GC20P018011
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around OVOL2 on UCSC Golden Path with GeneCards custom track

Genomic Location for OVOL2 Gene

Chromosome:
20
Start:
17,956,979 bp from pter
End:
18,059,188 bp from pter
Size:
102,210 bases
Orientation:
Minus strand

Genomic View for OVOL2 Gene

Genes around OVOL2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
OVOL2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for OVOL2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for OVOL2 Gene

Proteins for OVOL2 Gene

  • Protein details for OVOL2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q9BRP0-OVOL2_HUMAN
    Recommended name:
    Transcription factor Ovo-like 2
    Protein Accession:
    Q9BRP0
    Secondary Accessions:
    • Q5T8B4
    • Q9BX22
    • Q9HA54
    • Q9Y4M0

    Protein attributes for OVOL2 Gene

    Size:
    275 amino acids
    Molecular mass:
    30438 Da
    Quaternary structure:
    No Data Available

    Alternative splice isoforms for OVOL2 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for OVOL2 Gene

Post-translational modifications for OVOL2 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for OVOL2 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for OVOL2 Gene

Domains & Families for OVOL2 Gene

Gene Families for OVOL2 Gene

Protein Domains for OVOL2 Gene

Suggested Antigen Peptide Sequences for OVOL2 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q9BRP0

UniProtKB/Swiss-Prot:

OVOL2_HUMAN :
  • Belongs to the krueppel C2H2-type zinc-finger protein family.
Family:
  • Belongs to the krueppel C2H2-type zinc-finger protein family.
genes like me logo Genes that share domains with OVOL2: view

Function for OVOL2 Gene

Molecular function for OVOL2 Gene

UniProtKB/Swiss-Prot Function:
Zinc-finger transcription repressor factor. Plays a critical role to maintain the identity of epithelial lineages by suppressing epithelial-to mesenchymal transition (EMT) mainly through the repression of ZEB1, an EMT inducer. Positively regulates neuronal differentiation (By similarity). Suppresses cell cycling and terminal differentiation of keratinocytes by directly repressing MYC and NOTCH1 (PubMed:19700410).

Gene Ontology (GO) - Molecular Function for OVOL2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000981 RNA polymerase II transcription factor activity, sequence-specific DNA binding IBA --
GO:0001228 transcriptional activator activity, RNA polymerase II transcription regulatory region sequence-specific binding IEA --
GO:0003676 nucleic acid binding IEA --
GO:0003677 DNA binding IEA --
GO:0003682 chromatin binding IEA --
genes like me logo Genes that share ontologies with OVOL2: view
genes like me logo Genes that share phenotypes with OVOL2: view

Human Phenotype Ontology for OVOL2 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for OVOL2 Gene

MGI Knock Outs for OVOL2:

Animal Model Products

CRISPR Products

No data available for Enzyme Numbers (IUBMB) , miRNA , Transcription Factor Targets and HOMER Transcription for OVOL2 Gene

Localization for OVOL2 Gene

Subcellular locations from UniProtKB/Swiss-Prot for OVOL2 Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for OVOL2 gene
Compartment Confidence
nucleus 5
cytosol 3

Gene Ontology (GO) - Cellular Components for OVOL2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus ISS,IBA --
genes like me logo Genes that share ontologies with OVOL2: view

Pathways & Interactions for OVOL2 Gene

SuperPathways for OVOL2 Gene

No Data Available

Gene Ontology (GO) - Biological Process for OVOL2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001525 angiogenesis IEA --
GO:0001755 neural crest cell migration IEA --
GO:0001842 neural fold formation IEA --
GO:0001947 heart looping IEA --
GO:0006351 transcription, DNA-templated IEA --
genes like me logo Genes that share ontologies with OVOL2: view

No data available for Pathways by source and SIGNOR curated interactions for OVOL2 Gene

Transcripts for OVOL2 Gene

Unigene Clusters for OVOL2 Gene

Ovo-like 2 (Drosophila):
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for OVOL2 Gene

No ASD Table

Relevant External Links for OVOL2 Gene

GeneLoc Exon Structure for
OVOL2
ECgene alternative splicing isoforms for
OVOL2

Expression for OVOL2 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for OVOL2 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for OVOL2 Gene

This gene is overexpressed in Minor Salivary Gland (x5.3), Skin - Sun Exposed (Lower leg) (x4.4), and Stomach (x4.0).

Protein differential expression in normal tissues from HIPED for OVOL2 Gene

This gene is overexpressed in Ovary (43.8) and Liver (25.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for OVOL2 Gene



Protein tissue co-expression partners for OVOL2 Gene

NURSA nuclear receptor signaling pathways regulating expression of OVOL2 Gene:

OVOL2

SOURCE GeneReport for Unigene cluster for OVOL2 Gene:

Hs.661013

mRNA Expression by UniProt/SwissProt for OVOL2 Gene:

Q9BRP0-OVOL2_HUMAN
Tissue specificity: Expressed in testis, ovary, heart and skeletal muscle (PubMed:12213202). Expressed in the cornea, but absent from the corneal endothelium (PubMed:26749309).
genes like me logo Genes that share expression patterns with OVOL2: view

Primer Products

No data available for Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for OVOL2 Gene

Orthologs for OVOL2 Gene

This gene was present in the common ancestor of animals.

Orthologs for OVOL2 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia OVOL2 34 35
  • 98.79 (n)
dog
(Canis familiaris)
Mammalia OVOL2 34 35
  • 90.35 (n)
cow
(Bos Taurus)
Mammalia OVOL2 34 35
  • 89.17 (n)
rat
(Rattus norvegicus)
Mammalia Ovol2 34
  • 85.48 (n)
mouse
(Mus musculus)
Mammalia Ovol2 34 16 35
  • 85.04 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia OVOL2 35
  • 85 (a)
OneToOne
oppossum
(Monodelphis domestica)
Mammalia OVOL2 35
  • 72 (a)
OneToOne
chicken
(Gallus gallus)
Aves OVOL2 34 35
  • 72.61 (n)
lizard
(Anolis carolinensis)
Reptilia OVOL2 35
  • 65 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia ovol2 34
  • 66.05 (n)
Str.4531 34
zebrafish
(Danio rerio)
Actinopterygii si:dkey-17e16.13 34
  • 54.71 (n)
zgc:173486 35
  • 15 (a)
ManyToMany
fruit fly
(Drosophila melanogaster)
Insecta ovo 35
  • 8 (a)
OneToMany
worm
(Caenorhabditis elegans)
Secernentea lin-48 35
  • 36 (a)
OneToMany
Species where no ortholog for OVOL2 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for OVOL2 Gene

ENSEMBL:
Gene Tree for OVOL2 (if available)
TreeFam:
Gene Tree for OVOL2 (if available)

Paralogs for OVOL2 Gene

Paralogs for OVOL2 Gene

(6) SIMAP similar genes for OVOL2 Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with OVOL2: view

Variants for OVOL2 Gene

Sequence variations from dbSNP and Humsavar for OVOL2 Gene

SNP ID Clin Chr 20 pos Sequence Context AA Info Type
rs869320627 Pathogenic 18,057,995(+) GGCTG(-/CCGGTTCCGGCGGCCGGGGCTG)CCTGT intron-variant, upstream-variant-2KB
rs869320628 Pathogenic 18,058,004(-) AGGGC(C/T)GGAAC intron-variant, upstream-variant-2KB
rs869320629 Pathogenic 18,057,941(-) CGTTA(C/T)GTTGC intron-variant, upstream-variant-2KB
rs869320630 Pathogenic 18,057,908(-) TTTCC(G/T)GGTGC intron-variant, upstream-variant-2KB
rs1000054647 -- 18,040,161(+) TCAAG(A/C)AATCC intron-variant

Structural Variations from Database of Genomic Variants (DGV) for OVOL2 Gene

Variant ID Type Subtype PubMed ID
esv2660105 CNV deletion 23128226
esv3556904 CNV deletion 23714750
nsv1072526 CNV deletion 25765185
nsv458944 CNV gain 19166990
nsv458945 CNV loss 19166990
nsv470543 CNV gain 18288195
nsv585664 CNV loss 21841781
nsv833933 CNV gain 17160897
nsv952995 CNV deletion 24416366

Variation tolerance for OVOL2 Gene

Residual Variation Intolerance Score: 47.8% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.67; 45.90% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for OVOL2 Gene

Human Gene Mutation Database (HGMD)
OVOL2
SNPedia medical, phenotypic, and genealogical associations of SNPs for
OVOL2

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for OVOL2 Gene

Disorders for OVOL2 Gene

MalaCards: The human disease database

(7) MalaCards diseases for OVOL2 Gene - From: OMIM, ClinVar, GeneTests, Orphanet, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
corneal dystrophy, posterior polymorphous, 1
  • corneal endothelial dystrophy 1, autosomal dominant
corneal endothelial dystrophy 1, autosomal dominant
  • congenital hereditary endothelial dystrophy of cornea
corneal endothelial dystrophy
  • endothelial dystrophy
hair follicle neoplasm
  • hair matrix neoplasm
corneal dystrophy
- elite association - COSMIC cancer census association via MalaCards
Search OVOL2 in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

OVOL2_HUMAN
  • Corneal dystrophy, posterior polymorphous, 1 (PPCD1) [MIM:122000]: A rare corneal disorder characterized by small aggregates of apparent vesicles bordered by a gray haze at the level of Descemet membrane, an altered corneal endothelial cell structure, and an unusual proliferation of endothelial cells. Symptoms can range from very aggressive to asymptomatic and non-progressive, even within the same family. {ECO:0000269 PubMed:26749309}. Note=The disease is caused by mutations affecting the gene represented in this entry. Disease-causing mutations in the OVOL2 promoter alter promoter activity, dysregulate OVOL2 expression, and probably induce OVOL2 ectopic expression in the corneal endothelium. {ECO:0000269 PubMed:26749309}.

Relevant External Links for OVOL2

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
OVOL2
genes like me logo Genes that share disorders with OVOL2: view

No data available for Genatlas for OVOL2 Gene

Publications for OVOL2 Gene

  1. Autosomal-Dominant Corneal Endothelial Dystrophies CHED1 and PPCD1 Are Allelic Disorders Caused by Non-coding Mutations in the Promoter of OVOL2. (PMID: 26749309) Davidson A.E. … Hardcastle A.J. (Am. J. Hum. Genet. 2016) 3 4 64
  2. Ovol2 suppresses cell cycling and terminal differentiation of keratinocytes by directly repressing c-Myc and Notch1. (PMID: 19700410) Wells J. … Dai X. (J. Biol. Chem. 2009) 3 4 64
  3. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T. … Sugano S. (Nat. Genet. 2004) 3 4 64
  4. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4 64
  5. Ovol2, a mammalian homolog of Drosophila ovo: gene structure, chromosomal mapping, and aberrant expression in blind-sterile mice. (PMID: 12213202) Li B. … Dai X. (Genomics 2002) 3 4 64

Products for OVOL2 Gene

Sources for OVOL2 Gene

Content
Loading form....