Free for academic non-profit institutions. Other users need a Commercial license

Aliases for OVGP1 Gene

Aliases for OVGP1 Gene

  • Oviductal Glycoprotein 1 2 3 5
  • Oviductin 2 3 4
  • Estrogen-Dependent Oviduct Protein 3 4
  • Oviductal Glycoprotein 1, 120kDa 2 3
  • Mucin 9 2 3
  • MUC9 3 4
  • OGP 3 4
  • Oviduct-Specific Glycoprotein 3
  • Oviductal Glycoprotein 4
  • Oviduct Glycoprotein 3
  • Mucin-9 4
  • CHIT5 3
  • EGP 3

External Ids for OVGP1 Gene

Previous HGNC Symbols for OVGP1 Gene

  • MUC9

Previous GeneCards Identifiers for OVGP1 Gene

  • GC01M112373
  • GC01M110828
  • GC01M111002
  • GC01M111255
  • GC01M111668
  • GC01M111758
  • GC01M111956
  • GC01M109828

Summaries for OVGP1 Gene

Entrez Gene Summary for OVGP1 Gene

  • This gene encodes a large, carbohydrate-rich, epithelial glycoprotein with numerous O-glycosylation sites located within threonine, serine, and proline-rich tandem repeats. The gene is similar to members of the mucin and the glycosyl hydrolase 18 gene families. Regulation of expression may be estrogen-dependent. Gene expression and protein secretion occur during late follicular development through early cleavage-stage embryonic development. The protein is secreted from non-ciliated oviductal epithelial cells and associates with ovulated oocytes, blastomeres, and spermatozoan acrosomal regions. [provided by RefSeq, Jul 2008]

GeneCards Summary for OVGP1 Gene

OVGP1 (Oviductal Glycoprotein 1) is a Protein Coding gene. Diseases associated with OVGP1 include Chronic Salpingitis and Acute Salpingitis. Among its related pathways are Fertilization. GO annotations related to this gene include hydrolase activity, hydrolyzing O-glycosyl compounds and chitinase activity. An important paralog of this gene is CHIT1.

UniProtKB/Swiss-Prot for OVGP1 Gene

  • Binds to oocyte zona pellucida in vivo. May play a role in the fertilization process and/or early embryonic development.

Gene Wiki entry for OVGP1 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for OVGP1 Gene

Genomics for OVGP1 Gene

Regulatory Elements for OVGP1 Gene

Enhancers for OVGP1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH01G111445 1.2 ENCODE 21 -20.5 -20510 4.9 CREB3L1 FEZF1 DMAP1 YY1 ZNF143 ZNF263 SP3 NFYC GLIS1 NR2C1 ENSG00000260948 OVGP1 KRT18P57 RNU6-151P ENSG00000243960 UBE2FP3 DENND2D PIR44385 ATP5F1
GH01G111212 2.1 FANTOM5 Ensembl ENCODE dbSUPER 10.3 +206.0 206031 19.3 CREB3L1 MLX DMAP1 FEZF1 YBX1 YY1 ZNF143 ZNF263 SP3 TBX21 CHI3L2 DDX20 CEPT1 ENSG00000232240 LOC105378903 PIFO WDR77 ATP5F1 ENSG00000243960 OVGP1
GH01G111473 1.4 FANTOM5 ENCODE dbSUPER 11.6 -48.0 -48037 5.5 HDGF PKNOX1 RELB RCOR1 ETV6 IKZF2 CREM HCFC1 CBFB JUNB ENSG00000260948 OVGP1 RNU6-151P KRT18P57 PGCP1 DDX20 FAM212B C1orf162 RNU6-792P GC01M111493
GH01G111481 1.3 Ensembl ENCODE dbSUPER 12.4 -54.0 -54024 0.4 ELF3 CTCF RB1 TBL1XR1 ARID4B MAX ZNF384 ZNF48 ZBTB40 RAD21 OVGP1 KRT18P57 RNU6-151P DDX20 FAM212B GC01M111493 RNU6-792P C1orf162
GH01G111469 1.3 FANTOM5 ENCODE dbSUPER 10.7 -43.6 -43632 3.0 HDGF PKNOX1 MTA2 HCFC1 SP1 NFIC NFYB TARDBP IKZF1 HMBOX1 ENSG00000260948 RAP1A WDR77 ATP5F1 OVGP1 FAM212B C1orf162 GC01M111493 RNU6-792P
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around OVGP1 on UCSC Golden Path with GeneCards custom track

Genomic Location for OVGP1 Gene

111,414,314 bp from pter
111,427,777 bp from pter
13,464 bases
Minus strand

Genomic View for OVGP1 Gene

Genes around OVGP1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
OVGP1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for OVGP1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for OVGP1 Gene

Proteins for OVGP1 Gene

  • Protein details for OVGP1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Oviduct-specific glycoprotein
    Protein Accession:
    Secondary Accessions:
    • A0AV19
    • B9EGE1
    • Q15841

    Protein attributes for OVGP1 Gene

    678 amino acids
    Molecular mass:
    75421 Da
    Quaternary structure:
    No Data Available

neXtProt entry for OVGP1 Gene

Post-translational modifications for OVGP1 Gene

  • Glycosylation at posLast=402402, Asn441, posLast=580580, Asn596, and posLast=648648
  • Modification sites at PhosphoSitePlus

Other Protein References for OVGP1 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for OVGP1 Gene

Domains & Families for OVGP1 Gene

Gene Families for OVGP1 Gene

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the glycosyl hydrolase 18 family.
  • Belongs to the glycosyl hydrolase 18 family.
genes like me logo Genes that share domains with OVGP1: view

Function for OVGP1 Gene

Molecular function for OVGP1 Gene

UniProtKB/Swiss-Prot Function:
Binds to oocyte zona pellucida in vivo. May play a role in the fertilization process and/or early embryonic development.

Gene Ontology (GO) - Molecular Function for OVGP1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004568 chitinase activity IEA --
GO:0008061 chitin binding IEA --
genes like me logo Genes that share ontologies with OVGP1: view
genes like me logo Genes that share phenotypes with OVGP1: view

Animal Models for OVGP1 Gene

MGI Knock Outs for OVGP1:

Animal Model Products

  • Taconic Biosciences Mouse Models for OVGP1

miRNA for OVGP1 Gene

miRTarBase miRNAs that target OVGP1

Inhibitory RNA Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for OVGP1 Gene

Localization for OVGP1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for OVGP1 Gene

Cytoplasmic vesicle, secretory vesicle. Note=Secretory granules.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for OVGP1 gene
Compartment Confidence
extracellular 4
cytosol 4
mitochondrion 1
nucleus 1
endoplasmic reticulum 1
lysosome 1

Gene Ontology (GO) - Cellular Components for OVGP1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005829 cytosol TAS --
GO:0030133 transport vesicle IEA --
GO:0031410 cytoplasmic vesicle IEA --
GO:0035805 egg coat IEA --
GO:0098595 perivitelline space IEA --
genes like me logo Genes that share ontologies with OVGP1: view

Pathways & Interactions for OVGP1 Gene

SuperPathways for OVGP1 Gene

SuperPathway Contained pathways
1 Fertilization
genes like me logo Genes that share pathways with OVGP1: view

Pathways by source for OVGP1 Gene

Gene Ontology (GO) - Biological Process for OVGP1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005975 carbohydrate metabolic process IEA --
GO:0006032 chitin catabolic process IEA --
GO:0007338 single fertilization IEA --
GO:0007339 binding of sperm to zona pellucida TAS --
GO:0007565 female pregnancy TAS 9341614
genes like me logo Genes that share ontologies with OVGP1: view

No data available for SIGNOR curated interactions for OVGP1 Gene

Drugs & Compounds for OVGP1 Gene

(2) Drugs for OVGP1 Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials

(1) Additional Compounds for OVGP1 Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with OVGP1: view

Transcripts for OVGP1 Gene

mRNA/cDNA for OVGP1 Gene

Unigene Clusters for OVGP1 Gene

Oviductal glycoprotein 1, 120kDa:
Representative Sequences:

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for OVGP1 Gene

ExUns: 1a · 1b ^ 2a · 2b ^ 3a · 3b ^ 4a · 4b ^ 5a · 5b · 5c ^ 6a · 6b ^ 7 ^ 8 ^ 9a · 9b ^ 10a · 10b ^ 11
SP1: - - -
SP2: -
SP3: - - - - -
SP4: - - - -
SP5: -

Relevant External Links for OVGP1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for OVGP1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for OVGP1 Gene

mRNA differential expression in normal tissues according to GTEx for OVGP1 Gene

This gene is overexpressed in Fallopian Tube (x9.6).

Protein differential expression in normal tissues from HIPED for OVGP1 Gene

This gene is overexpressed in Cervix (43.9) and Ovary (23.9).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for OVGP1 Gene

Protein tissue co-expression partners for OVGP1 Gene

NURSA nuclear receptor signaling pathways regulating expression of OVGP1 Gene:


SOURCE GeneReport for Unigene cluster for OVGP1 Gene:


mRNA Expression by UniProt/SwissProt for OVGP1 Gene:

Tissue specificity: Oviduct.
genes like me logo Genes that share expression patterns with OVGP1: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for OVGP1 Gene

Orthologs for OVGP1 Gene

This gene was present in the common ancestor of animals and fungi.

Orthologs for OVGP1 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia OVGP1 34 35
  • 99.25 (n)
(Bos Taurus)
Mammalia -- 35
  • 80 (a)
LOC100138271 34
  • 79.6 (n)
OVGP1 35
  • 71 (a)
(Canis familiaris)
Mammalia OVGP1 34 35
  • 79.37 (n)
(Mus musculus)
Mammalia Ovgp1 34 16 35
  • 74 (n)
(Ornithorhynchus anatinus)
Mammalia OVGP1 35
  • 53 (a)
(Monodelphis domestica)
Mammalia OVGP1 35
  • 46 (a)
(Anolis carolinensis)
Reptilia OVGP1 35
  • 43 (a)
(Danio rerio)
Actinopterygii OVGP1 (3 of 4) 35
  • 45 (a)
chia.3 35
  • 42 (a)
chia.4 35
  • 40 (a)
chia.6 35
  • 40 (a)
fruit fly
(Drosophila melanogaster)
Insecta CG9357 36
  • 38 (a)
CG10531 36
  • 35 (a)
Cht2 36
  • 35 (a)
Cht3 36
  • 35 (a)
CG3044 36
  • 30 (a)
Cht7 35
  • 19 (a)
(Caenorhabditis elegans)
Secernentea cht-1 35
  • 28 (a)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes CTS2 35
  • 20 (a)
sea squirt
(Ciona savignyi)
Ascidiacea CSA.8046 35
  • 23 (a)
Species where no ortholog for OVGP1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)

Evolution for OVGP1 Gene

Gene Tree for OVGP1 (if available)
Gene Tree for OVGP1 (if available)

Paralogs for OVGP1 Gene

Paralogs for OVGP1 Gene

(4) SIMAP similar genes for OVGP1 Gene using alignment to 2 proteins:

genes like me logo Genes that share paralogs with OVGP1: view

Variants for OVGP1 Gene

Sequence variations from dbSNP and Humsavar for OVGP1 Gene

SNP ID Clin Chr 01 pos Sequence Context AA Info Type
VAR_035752 A colorectal cancer sample
rs879255376 Benign 111,414,901(-) TGACC(-/ACTGGACAGAAGACCCTGACC)CCTGT cds-indel
rs1000226065 -- 111,413,947(+) AAGTA(A/C)CTTTT downstream-variant-500B
rs1000553772 -- 111,426,644(+) CACCT(A/G)GTAAG intron-variant
rs1001132132 -- 111,420,367(+) TTGCC(C/T)TTCAA intron-variant

Structural Variations from Database of Genomic Variants (DGV) for OVGP1 Gene

Variant ID Type Subtype PubMed ID
dgv12e215 CNV deletion 23714750
esv2100138 CNV deletion 18987734
esv2716218 CNV deletion 23290073
nsv463250 CNV loss 19166990
nsv547535 CNV loss 21841781
nsv824131 CNV loss 20364138

Variation tolerance for OVGP1 Gene

Residual Variation Intolerance Score: 88.9% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 9.99; 89.97% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for OVGP1 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for OVGP1 Gene

Disorders for OVGP1 Gene

MalaCards: The human disease database

(8) MalaCards diseases for OVGP1 Gene - From: DISEASES and GeneCards

Disorder Aliases PubMed IDs
chronic salpingitis
acute salpingitis
taylor's syndrome
  • congestion-fibrosis syndrome
acrodermatitis chronica atrophicans
  • herxheimer disease
inclusion conjunctivitis
  • adult inclusion conjunctivitis
- elite association - COSMIC cancer census association via MalaCards
Search OVGP1 in MalaCards View complete list of genes associated with diseases

Relevant External Links for OVGP1

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with OVGP1: view

No data available for UniProtKB/Swiss-Prot and Genatlas for OVGP1 Gene

Publications for OVGP1 Gene

  1. Complementary deoxyribonucleic acid cloning and molecular characterization of an estrogen-dependent human oviductal glycoprotein. (PMID: 7819450) Arias E.B. … Jaffe R.C. (Biol. Reprod. 1994) 2 3 4 22 64
  2. Allelic polymorphism and chromosomal localization of the human oviductin gene (MUC9). (PMID: 9341614) LapensAce L. … Bleau G. (Fertil. Steril. 1997) 2 3 22 64
  3. Investigation of genetic susceptibility factors for human longevity - a targeted nonsynonymous SNP study. (PMID: 20800603) Flachsbart F. … Nebel A. (Mutat. Res. 2010) 3 46 64
  4. Oviductal glycoprotein (OVGP1, MUC9): a differentiation-based mucin present in serum of women with ovarian cancer. (PMID: 20130498) Maines-Bandiera S. … Auersperg N. (Int. J. Gynecol. Cancer 2010) 3 22 64
  5. The DNA sequence and biological annotation of human chromosome 1. (PMID: 16710414) Gregory S.G. … Bentley D.R. (Nature 2006) 3 4 64

Products for OVGP1 Gene

Sources for OVGP1 Gene

Loading form....