Free for academic non-profit institutions. Other users need a Commercial license

Aliases for OCLN Gene

Aliases for OCLN Gene

  • Occludin 2 3 3 5
  • Phosphatase 1, Regulatory Subunit 115 2 3
  • Tight Junction Protein Occludin TM4 Minus 2
  • Tight Junction Protein Occludin 3
  • PPP1R115 3
  • PTORCH1 3
  • BLCPMG 3

External Ids for OCLN Gene

Previous GeneCards Identifiers for OCLN Gene

  • GC05P068940
  • GC05P070353
  • GC05P068803
  • GC05P068823
  • GC05P068788
  • GC05P065744

Summaries for OCLN Gene

Entrez Gene Summary for OCLN Gene

  • This gene encodes an integral membrane protein that is required for cytokine-induced regulation of the tight junction paracellular permeability barrier. Mutations in this gene are thought to be a cause of band-like calcification with simplified gyration and polymicrogyria (BLC-PMG), an autosomal recessive neurologic disorder that is also known as pseudo-TORCH syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene is present 1.5 Mb downstream on the q arm of chromosome 5. [provided by RefSeq, Apr 2011]

GeneCards Summary for OCLN Gene

OCLN (Occludin) is a Protein Coding gene. Diseases associated with OCLN include Band-Like Calcification With Simplified Gyration And Polymicrogyria and Torch Syndrome. Among its related pathways are Blood-Brain Barrier and Immune Cell Transmigration: VCAM-1/CD106 Signaling Pathways and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to this gene include structural molecule activity and S-adenosylmethionine-dependent methyltransferase activity.

UniProtKB/Swiss-Prot for OCLN Gene

  • May play a role in the formation and regulation of the tight junction (TJ) paracellular permeability barrier. It is able to induce adhesion when expressed in cells lacking tight junctions.

Gene Wiki entry for OCLN Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for OCLN Gene

Genomics for OCLN Gene

Regulatory Elements for OCLN Gene

Enhancers for OCLN Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH05G069449 1.4 Ensembl ENCODE dbSUPER 23 -39.4 -39435 6.2 PKNOX1 FOXA2 ARID4B YY1 FOS PPARG KAT8 NFIL3 MIER3 KDM1A OCLN CCDC125 RAD17 LOC101928924 MARVELD2 GTF2H2C ENSG00000250138 ENSG00000198237 SMN2 GC05M069454
GH05G069489 1.6 Ensembl ENCODE dbSUPER 12.5 +1.1 1101 8.8 PKNOX1 FOXA2 ARID4B SIN3A DMAP1 ZNF2 YY1 ZNF263 SP3 ZHX2 OCLN MARVELD2 RNU6-724P GUSBP3 ENSG00000179978 LOC101928924
GH05G069516 1.6 Ensembl ENCODE dbSUPER 11.9 +27.0 27003 5.9 PKNOX1 FOXA2 ARNT FEZF1 ZNF2 ZNF302 FOS ZNF263 SP3 REST GUSBP3 OCLN MARVELD2 ENSG00000253333 CDK7 CDH12P2 GTF2H2C ENSG00000250138 SMN2 GC05M069532
GH05G069523 1.3 FANTOM5 ENCODE dbSUPER 11.5 +34.2 34203 5.0 ESRRA FEZF1 CEBPG RAD21 ZKSCAN1 CTBP1 ZNF316 GATA3 HSF1 ZNF547 GUSBP3 LOC101928924 OCLN ENSG00000198237 GTF2H2C GC05M069532 RNU6-724P
GH05G069443 1.2 ENCODE dbSUPER 11.9 -47.4 -47429 3.5 FOXA2 ARID4B DMAP1 YY1 ZNF121 TBX21 KAT8 SSRP1 MIER3 HNF4A CCDC125 MARVELD2 OCLN LOC101928924 RNU6-724P ENSG00000250138 GC05M069454
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around OCLN on UCSC Golden Path with GeneCards custom track

Promoters for OCLN Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000182028 908 2001 FOXA2 ARID4B SIN3A DMAP1 ZNF2 YY1 ZNF263 SP3 MXD4 NFYC

Genomic Location for OCLN Gene

69,492,292 bp from pter
69,558,104 bp from pter
65,813 bases
Plus strand

Genomic View for OCLN Gene

Genes around OCLN on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
OCLN Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for OCLN Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for OCLN Gene

Proteins for OCLN Gene

  • Protein details for OCLN Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Protein Accession:
    Secondary Accessions:
    • B5BU70
    • D2DU64
    • D2DU65
    • D2IGC0
    • D2IGC1
    • E2CYV9
    • Q5U1V4
    • Q8N6K1

    Protein attributes for OCLN Gene

    522 amino acids
    Molecular mass:
    59144 Da
    Quaternary structure:
    • Interacts with TJP1/ZO1 and with VAPA.

    Three dimensional structures from OCA and Proteopedia for OCLN Gene

    Alternative splice isoforms for OCLN Gene

neXtProt entry for OCLN Gene

Post-translational modifications for OCLN Gene

  • Dephosphorylated by PTPRJ. The tyrosine phosphorylation on Tyr-398 and Tyr-402 reduces its ability to interact with TJP1. Phosphorylation at Ser-490 also attenuates the interaction with TJP1.
  • Ubiquitination at Lys276, posLast=283283, and posLast=299299
  • Modification sites at PhosphoSitePlus

Other Protein References for OCLN Gene

No data available for DME Specific Peptides for OCLN Gene

Domains & Families for OCLN Gene

Gene Families for OCLN Gene

Suggested Antigen Peptide Sequences for OCLN Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • The C-terminal is cytoplasmic and is important for interaction with ZO-1. Sufficient for the tight junction localization. Involved in the regulation of the permeability barrier function of the tight junction (By similarity). The first extracellular loop participates in an adhesive interaction.
  • Belongs to the ELL/occludin family.
  • The C-terminal is cytoplasmic and is important for interaction with ZO-1. Sufficient for the tight junction localization. Involved in the regulation of the permeability barrier function of the tight junction (By similarity). The first extracellular loop participates in an adhesive interaction.
  • Belongs to the ELL/occludin family.
genes like me logo Genes that share domains with OCLN: view

Function for OCLN Gene

Molecular function for OCLN Gene

GENATLAS Biochemistry:
occludin,60kDa,integral membrane at tight junctions of epithelial cells,highly expressed in testis,kidney,liver,lung,brain,involved in the barrier and fence function of TJ,accessory protein in TJ strands formation
UniProtKB/Swiss-Prot Function:
May play a role in the formation and regulation of the tight junction (TJ) paracellular permeability barrier. It is able to induce adhesion when expressed in cells lacking tight junctions.

Gene Ontology (GO) - Molecular Function for OCLN Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 16616143
GO:0019904 protein domain specific binding IPI 20164257
genes like me logo Genes that share ontologies with OCLN: view
genes like me logo Genes that share phenotypes with OCLN: view

Human Phenotype Ontology for OCLN Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for OCLN Gene

MGI Knock Outs for OCLN:

Animal Model Products

  • Taconic Biosciences Mouse Models for OCLN

Inhibitory RNA Products

Clone Products

  • Addgene plasmids for OCLN
  • Applied Biological Materials Clones for OCLN

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for OCLN Gene

Localization for OCLN Gene

Subcellular locations from UniProtKB/Swiss-Prot for OCLN Gene

Cell membrane; Multi-pass membrane protein. Cell junction, tight junction.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for OCLN gene
Compartment Confidence
plasma membrane 5
cytoskeleton 3
extracellular 2
peroxisome 2
nucleus 2
cytosol 2
mitochondrion 1
endosome 1

Gene Ontology (GO) - Cellular Components for OCLN Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005886 plasma membrane TAS --
GO:0005911 cell-cell junction IDA 19332538
GO:0005923 bicellular tight junction IDA 20028514
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IEA --
genes like me logo Genes that share ontologies with OCLN: view

Pathways & Interactions for OCLN Gene

genes like me logo Genes that share pathways with OCLN: view

SIGNOR curated interactions for OCLN Gene

Is activated by:

Gene Ontology (GO) - Biological Process for OCLN Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006461 protein complex assembly TAS 10749869
GO:0045216 cell-cell junction organization IMP 20164257
GO:0070673 response to interleukin-18 IEA --
GO:0070830 bicellular tight junction assembly IMP 20164257
GO:0071356 cellular response to tumor necrosis factor IEA --
genes like me logo Genes that share ontologies with OCLN: view

Drugs & Compounds for OCLN Gene

No Compound Related Data Available

Transcripts for OCLN Gene

mRNA/cDNA for OCLN Gene

(5) REFSEQ mRNAs :
(15) Additional mRNA sequences :
(5) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for OCLN Gene

Representative Sequences:

Inhibitory RNA Products

Clone Products

  • Addgene plasmids for OCLN
  • Applied Biological Materials Clones for OCLN

Alternative Splicing Database (ASD) splice patterns (SP) for OCLN Gene

ExUns: 1 ^ 2a · 2b ^ 3 ^ 4 ^ 5 ^ 6a · 6b · 6c ^ 7 ^ 8 ^ 9 ^ 10
SP2: -
SP4: - - - -
SP5: - -

Relevant External Links for OCLN Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for OCLN Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for OCLN Gene

Protein differential expression in normal tissues from HIPED for OCLN Gene

This gene is overexpressed in Liver, secretome (21.9), Cervix (10.4), Pancreas (8.3), and Islet of Langerhans (7.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for OCLN Gene

NURSA nuclear receptor signaling pathways regulating expression of OCLN Gene:


SOURCE GeneReport for Unigene cluster for OCLN Gene:


mRNA Expression by UniProt/SwissProt for OCLN Gene:

Tissue specificity: Localized at tight junctions of both epithelial and endothelial cells. Highly expressed in kidney. Not detected in testis.

Evidence on tissue expression from TISSUES for OCLN Gene

  • Nervous system(4.9)
  • Lung(4.8)
  • Liver(4.5)
  • Kidney(3.9)
  • Skin(3.6)
  • Eye(3.4)
  • Intestine(3.4)
  • Heart(2.7)
  • Blood(2.6)
  • Pancreas(2.2)
  • Stomach(2.1)

Phenotype-based relationships between genes and organs from Gene ORGANizer for OCLN Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
  • cardiovascular
  • digestive
  • integumentary
  • lymphatic
  • nervous
  • skeletal muscle
  • skeleton
Head and neck:
  • brain
  • cerebellum
  • cerebrospinal fluid
  • chin
  • ear
  • eye
  • face
  • forehead
  • head
  • jaw
  • lip
  • mandible
  • meninges
  • mouth
  • neck
  • nose
  • outer ear
  • skull
  • chest wall
  • abdominal wall
  • liver
  • spleen
  • blood
  • blood vessel
  • coagulation system
  • skin
  • spinal cord
genes like me logo Genes that share expression patterns with OCLN: view

Primer Products

No data available for mRNA differential expression in normal tissues and Protein tissue co-expression partners for OCLN Gene

Orthologs for OCLN Gene

This gene was present in the common ancestor of chordates.

Orthologs for OCLN Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia OCLN 34 35
  • 99.55 (n)
(Canis familiaris)
Mammalia OCLN 34 35
  • 87.97 (n)
(Bos Taurus)
Mammalia OCLN 34 35
  • 87.78 (n)
(Mus musculus)
Mammalia Ocln 34 16 35
  • 85.55 (n)
(Ornithorhynchus anatinus)
Mammalia OCLN 35
  • 84 (a)
(Rattus norvegicus)
Mammalia Ocln 34
  • 83.91 (n)
(Monodelphis domestica)
Mammalia OCLN 35
  • 80 (a)
(Gallus gallus)
Aves OCLN 35
  • 42 (a)
(Anolis carolinensis)
Reptilia OCLN 35
  • 64 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia ocln 34
  • 62.95 (n)
(Danio rerio)
Actinopterygii oclna 34 35
  • 54.03 (n)
oclnb 35
  • 44 (a)
Species where no ortholog for OCLN was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for OCLN Gene

Gene Tree for OCLN (if available)
Gene Tree for OCLN (if available)

Paralogs for OCLN Gene Pseudogenes for OCLN Gene

genes like me logo Genes that share paralogs with OCLN: view

No data available for Paralogs for OCLN Gene

Variants for OCLN Gene

Sequence variations from dbSNP and Humsavar for OCLN Gene

SNP ID Clin Chr 05 pos Sequence Context AA Info Type
rs267606926 Band-like calcification with simplified gyration and polymicrogyria (BLCPMG) [MIM:251290]
rs111832736 -- 69,494,186(+) GTGCT(-/TG)TGTGT intron-variant
rs141706396 -- 69,526,554(+) CCTTC(-/CAGAGCTCTAATAACTTATT)CAGAG intron-variant
rs200106961 -- 69,549,369(+) GAACT(-/TAAG)TAACA intron-variant
rs200271483 -- 69,538,010(+) AACTC(-/T)TTTTT intron-variant

Structural Variations from Database of Genomic Variants (DGV) for OCLN Gene

Variant ID Type Subtype PubMed ID
dgv5695n100 CNV gain 25217958
dgv5696n100 CNV loss 25217958
dgv5697n100 CNV gain+loss 25217958
dgv9833n54 CNV loss 21841781
dgv9834n54 CNV gain 21841781
dgv9835n54 CNV loss 21841781
dgv9836n54 CNV loss 21841781
dgv9837n54 CNV loss 21841781
dgv9838n54 CNV loss 21841781
dgv9839n54 CNV loss 21841781
esv1009388 CNV gain 20482838
esv22113 CNV gain+loss 19812545
esv2669461 CNV deletion 23128226
esv32846 CNV loss 17666407
esv3570182 CNV loss 25503493
esv3570183 CNV loss 25503493
esv3894207 CNV loss 25118596
nsv1023116 CNV gain 25217958
nsv1034024 CNV gain 25217958
nsv10707 CNV gain+loss 18304495
nsv329061 CNV insertion 16902084
nsv428117 CNV gain+loss 18775914
nsv471498 CNV gain 19718026
nsv514309 CNV gain+loss 21397061
nsv598426 CNV loss 21841781
nsv598427 CNV loss 21841781
nsv598430 CNV gain 21841781
nsv598439 CNV gain+loss 21841781
nsv598447 CNV loss 21841781
nsv598448 CNV loss 21841781
nsv598452 CNV loss 21841781
nsv598454 CNV loss 21841781
nsv598456 CNV loss 21841781
nsv821643 CNV loss 15273396
nsv968189 CNV duplication 23825009

Variation tolerance for OCLN Gene

Residual Variation Intolerance Score: 70.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.88; 35.09% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for OCLN Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for OCLN Gene

Disorders for OCLN Gene

MalaCards: The human disease database

(9) MalaCards diseases for OCLN Gene - From: OMIM, ClinVar, GeneTests, Orphanet, Swiss-Prot, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
band-like calcification with simplified gyration and polymicrogyria
  • pseudo-torch syndrome 1
torch syndrome
  • pmg
acute vascular insufficiency of intestine
  • acute gastrointestinal tract vascular insuffic.
acute hemorrhagic leukoencephalitis
  • acute haemorrhagic leucoencephalitis of weston hurst
- elite association - COSMIC cancer census association via MalaCards
Search OCLN in MalaCards View complete list of genes associated with diseases


  • Band-like calcification with simplified gyration and polymicrogyria (BLCPMG) [MIM:251290]: A neurologic disorder with characteristic clinical and neuroradiologic features that mimic intrauterine TORCH infection in the absence of evidence of infection. Affected individuals have congenital microcephaly, intracranial calcifications, and severe developmental delay. {ECO:0000269 PubMed:20727516}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Relevant External Links for OCLN

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with OCLN: view

No data available for Genatlas for OCLN Gene

Publications for OCLN Gene

  1. Interspecies diversity of the occludin sequence: cDNA cloning of human, mouse, dog, and rat-kangaroo homologues. (PMID: 8601611) Ando-Akatsuka Y. … Tsukita S. (J. Cell Biol. 1996) 2 3 4 64
  2. Splicing diversity of the human OCLN gene and its biological significance for hepatitis C virus entry. (PMID: 20463075) Kohaar I. … Prokunina-Olsson L. (J. Virol. 2010) 3 4 64
  3. Recessive mutations in the gene encoding the tight junction protein occludin cause band-like calcification with simplified gyration and polymicrogyria. (PMID: 20727516) O'Driscoll M.C. … Crow Y.J. (Am. J. Hum. Genet. 2010) 3 4 64
  4. PKC eta regulates occludin phosphorylation and epithelial tight junction integrity. (PMID: 19114660) Suzuki T. … Rao R. (Proc. Natl. Acad. Sci. U.S.A. 2009) 3 4 64
  5. Phosphorylation of Tyr-398 and Tyr-402 in occludin prevents its interaction with ZO-1 and destabilizes its assembly at the tight junctions. (PMID: 19017651) Elias B.C. … Rao R. (J. Biol. Chem. 2009) 3 4 64

Products for OCLN Gene

Sources for OCLN Gene

Loading form....