Aliases for OCLN Gene
Aliases for OCLN Gene
External Ids for OCLN Gene
- HGNC: 8104
- Entrez Gene: 100506658
- Ensembl: ENSG00000197822
- OMIM: 602876
- UniProtKB: Q16625
Previous GeneCards Identifiers for OCLN Gene
- GC05P068940
- GC05P070353
- GC05P068803
- GC05P068823
- GC05P068788
- GC05P065744
Summaries for OCLN Gene
-
This gene encodes an integral membrane protein that is required for cytokine-induced regulation of the tight junction paracellular permeability barrier. Mutations in this gene are thought to be a cause of band-like calcification with simplified gyration and polymicrogyria (BLC-PMG), an autosomal recessive neurologic disorder that is also known as pseudo-TORCH syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene is present 1.5 Mb downstream on the q arm of chromosome 5. [provided by RefSeq, Apr 2011]
GeneCards Summary for OCLN Gene
OCLN (Occludin) is a Protein Coding gene. Diseases associated with OCLN include Band-Like Calcification With Simplified Gyration And Polymicrogyria and Torch Syndrome. Among its related pathways are Blood-Brain Barrier and Immune Cell Transmigration: VCAM-1/CD106 Signaling Pathways and Cytoskeleton remodeling Regulation of actin cytoskeleton by Rho GTPases. GO annotations related to this gene include structural molecule activity and S-adenosylmethionine-dependent methyltransferase activity.
UniProtKB/Swiss-Prot for OCLN Gene
-
May play a role in the formation and regulation of the tight junction (TJ) paracellular permeability barrier. It is able to induce adhesion when expressed in cells lacking tight junctions.
No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for OCLN Gene
Genomics for OCLN Gene
Regulatory Elements for OCLN Gene
Enhancers for OCLN Gene
- Elite enhancer and/or Elite enhancer-gene association
Download GeneHancer data dump
Enhancers around OCLN on UCSC Golden Path with GeneCards custom track
- Transcription factor binding sites by QIAGEN in the OCLN gene promoter:
Regulatory Element Products
Genomic Location for OCLN Gene
- Chromosome:
- 5
- Start:
- 69,492,292 bp from pter
- End:
- 69,558,104 bp from pter
- Size:
- 65,813 bases
- Orientation:
- Plus strand
Genomic View for OCLN Gene
Genes around OCLN on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 5q13.2 by Ensembl
- 5q13.2 by Entrez Gene
- 5q13.2 by HGNC
OCLN Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for OCLN Gene
Proteins for OCLN Gene
-
Protein details for OCLN Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- Q16625-OCLN_HUMAN
- Recommended name:
- Occludin
- Protein Accession:
- Q16625
- B5BU70
- D2DU64
- D2DU65
- D2IGC0
- D2IGC1
- E2CYV9
- Q5U1V4
- Q8N6K1
Protein attributes for OCLN Gene
- Size:
- 522 amino acids
- Molecular mass:
- 59144 Da
- Quaternary structure:
-
- Interacts with TJP1/ZO1 and with VAPA.
Protein Expression for OCLN Gene
Post-translational modifications for OCLN Gene
- Dephosphorylated by PTPRJ. The tyrosine phosphorylation on Tyr-398 and Tyr-402 reduces its ability to interact with TJP1. Phosphorylation at Ser-490 also attenuates the interaction with TJP1.
- Ubiquitination at Lys276, posLast=283283, and posLast=299299
- Modification sites at PhosphoSitePlus
Other Protein References for OCLN Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
- R&D Systems Antibodies for OCLN (Occludin)
-
Custom Antibody ServicesOriGene Antibodies for OCLN
- Novus Biologicals Antibodies for OCLN
- Invitrogen Antibodies for OCLN
- antibodies-online Antibodies for OCLN: See all 103
- Search GeneTex for Antibodies for OCLN
-
Custom Antibody ServicesProSci Antibodies for OCLN
-
Santa Cruz Biotechnology (SCBT) Antibodies for OCLN
Protein Products
-
OriGene Purified Proteins for OCLN
- Search Origene for MassSpec and Protein Over-expression Lysates for OCLN
- Origene Custom Protein Services for OCLN
- antibodies-online Proteins for OCLN: See all 8
- Search antibodies-online for peptides
- Search GeneTex for Proteins for OCLN
Assay Products
- antibodies-online Kits for OCLN: See all 40
No data available for DME Specific Peptides for OCLN Gene
Domains & Families for OCLN Gene
Gene Families for OCLN Gene
Protein Domains for OCLN Gene
- InterPro:
- Blocks:
- ProtoNet:
Suggested Antigen Peptide Sequences for OCLN Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
Q16625UniProtKB/Swiss-Prot:
OCLN_HUMAN :- The C-terminal is cytoplasmic and is important for interaction with ZO-1. Sufficient for the tight junction localization. Involved in the regulation of the permeability barrier function of the tight junction (By similarity). The first extracellular loop participates in an adhesive interaction.
- Belongs to the ELL/occludin family.
- Domain:
-
- The C-terminal is cytoplasmic and is important for interaction with ZO-1. Sufficient for the tight junction localization. Involved in the regulation of the permeability barrier function of the tight junction (By similarity). The first extracellular loop participates in an adhesive interaction.
- Family:
-
- Belongs to the ELL/occludin family.
Function for OCLN Gene
Molecular function for OCLN Gene
- GENATLAS Biochemistry:
- occludin,60kDa,integral membrane at tight junctions of epithelial cells,highly expressed in testis,kidney,liver,lung,brain,involved in the barrier and fence function of TJ,accessory protein in TJ strands formation
- UniProtKB/Swiss-Prot Function:
- May play a role in the formation and regulation of the tight junction (TJ) paracellular permeability barrier. It is able to induce adhesion when expressed in cells lacking tight junctions.
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005515 | protein binding | IPI | 16616143 |
| GO:0019904 | protein domain specific binding | IPI | 20164257 |
Phenotypes for OCLN Gene
- MGI mutant phenotypes for OCLN:
-
inferred from 4 alleles
- behavior/neurological phenotype
- growth/size/body region phenotype
- immune system phenotype
- muscle phenotype
- nervous system phenotype
- homeostasis/metabolism phenotype
- digestive/alimentary phenotype
- reproductive system phenotype
- endocrine/exocrine gland phenotype
- limbs/digits/tail phenotype
- skeleton phenotype
- GenomeRNAi human phenotypes for OCLN:
Animal Model Products
-
Taconic Biosciences Mouse Models for OCLN
- Cyagen custom Knockout/knockin (KOKI) mouse models for OCLN
-
-
ViGene Biosciences lentiviral particle packaged cDNA for OCLN gene
-
ViGene Biosciences ready-to-package AAV shRNAs for OCLN gene
- Search ViGene Biosciences for OCLN
CRISPR Products
-
OriGene CRISPR knockouts for OCLN
- GenScript: Design CRISPR guide RNA sequences for OCLN
miRNA for OCLN Gene
- miRTarBase miRNAs that target OCLN
-
- hsa-mir-335-5p (MIRT018585)
- hsa-let-7e-5p (MIRT051654)
- hsa-let-7b-5p (MIRT052167)
- hsa-mir-340-5p (MIRT314176)
- hsa-mir-548t-5p (MIRT314178)
- hsa-mir-3148 (MIRT314179)
- hsa-mir-3609 (MIRT314180)
- hsa-mir-548ah-5p (MIRT314181)
- hsa-mir-4491 (MIRT314182)
- hsa-mir-4657 (MIRT314183)
- hsa-mir-548az-5p (MIRT314184)
- hsa-mir-6833-5p (MIRT314185)
- hsa-mir-8062 (MIRT314186)
- hsa-mir-1295a (MIRT540350)
- hsa-mir-5704 (MIRT540351)
- hsa-mir-3941 (MIRT540352)
- hsa-mir-216b-3p (MIRT540353)
- hsa-mir-15a-3p (MIRT540354)
- hsa-mir-4717-5p (MIRT540355)
- hsa-mir-603 (MIRT540356)
- hsa-mir-362-3p (MIRT540357)
- hsa-mir-329-3p (MIRT540358)
- hsa-mir-8485 (MIRT540359)
- hsa-mir-576-3p (MIRT555919)
- hsa-mir-3190-3p (MIRT555920)
- hsa-mir-6124 (MIRT555921)
- hsa-mir-299-3p (MIRT555922)
- hsa-mir-212-3p (MIRT555923)
- hsa-mir-132-3p (MIRT555924)
- hsa-mir-5692a (MIRT555925)
- hsa-mir-4755-3p (MIRT619586)
miRNA Products
- Search ViGene Biosciences for OCLN
Inhibitory RNA Products
- Origene shRNA, siRNA, and RNAi products in human, mouse, rat for OCLN
- Browse OriGene Inhibitory RNA Products For OCLN
-
ViGene Biosciences ready-to-package AAV shRNAs for OCLN gene
Clone Products
- Sino Biological Human cDNA Clone for OCLN
- Addgene plasmids for OCLN
- VectorBuilder custom plasmid, inducible vectors for OCLN
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for OCLN
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- R&D Systems cDNA Clones for OCLN (Occludin)
Cell Line Products
-
Horizon Cell Lines for OCLN
-
ViGene Biosciences adenoviral particle packaged cDNA for OCLN gene
-
ViGene Biosciences lentiviral particle packaged cDNA for OCLN gene
-
ViGene Biosciences ready-to-package AAV shRNAs for OCLN gene
No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for OCLN Gene
Localization for OCLN Gene
Subcellular locations from UniProtKB/Swiss-Prot for OCLN Gene
- Cell membrane; Multi-pass membrane protein. Cell junction, tight junction.
| Compartment | Confidence |
|---|---|
| plasma membrane | 5 |
| cytoskeleton | 3 |
| extracellular | 2 |
| peroxisome | 2 |
| nucleus | 2 |
| cytosol | 2 |
| mitochondrion | 1 |
| endosome | 1 |
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005886 | plasma membrane | TAS | -- |
| GO:0005911 | cell-cell junction | IDA | 19332538 |
| GO:0005923 | bicellular tight junction | IDA | 20028514 |
| GO:0016020 | membrane | IEA | -- |
| GO:0016021 | integral component of membrane | IEA | -- |
Pathways & Interactions for OCLN Gene
Pathways by source for OCLN Gene
2 BioSystems pathways for OCLN Gene
5 Reactome pathways for OCLN Gene
5 KEGG pathways for OCLN Gene
3 GeneGo (Thomson Reuters) pathways for OCLN Gene
6 R&D Systems pathways for OCLN Gene
- Blood-Brain Barrier and Immune Cell Transmigration: CCL2/MCP-1 Signaling Pathways
- Blood-Brain Barrier and Immune Cell Transmigration: ICAM-1/CD54 Signaling Pathways
- Blood-Brain Barrier and Immune Cell Transmigration: Pathways Overview
- Blood-Brain Barrier and Immune Cell Transmigration: VCAM-1/CD106 Signaling Pathways
- Blood-Brain Barrier and Immune Cell Transmigration: VEGF Signaling Pathways
3 Qiagen pathways for OCLN Gene
Interacting Proteins for OCLN Gene
Selected Interacting proteins:
ENSP00000347379
Q16625-OCLN_HUMAN
for OCLN Gene via
STRING
MINT
IID
UniProtKB
| Symbol | External ID(s) | Details |
|---|---|---|
| CSNK1E | ||
| PLSCR1 | ||
| LOC400927-CSNK1E | ||
| CLEC7A | ||
| CSNK1A1 |
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0006461 | protein complex assembly | TAS | 10749869 |
| GO:0045216 | cell-cell junction organization | IMP | 20164257 |
| GO:0070673 | response to interleukin-18 | IEA | -- |
| GO:0070830 | bicellular tight junction assembly | IMP | 20164257 |
| GO:0071356 | cellular response to tumor necrosis factor | IEA | -- |
Transcripts for OCLN Gene
mRNA/cDNA for OCLN Gene
- (5) REFSEQ mRNAs :
- (15) Additional mRNA sequences :
- (5) Ensembl transcripts including schematic representations, and UCSC links where relevant :
CRISPR Products
-
OriGene CRISPR knockouts for OCLN
- GenScript: Design CRISPR guide RNA sequences for OCLN
miRNA Products
- Search ViGene Biosciences for OCLN
Inhibitory RNA Products
- Origene shRNA, siRNA, and RNAi products in human, mouse, rat for OCLN
- Browse OriGene Inhibitory RNA Products For OCLN
-
ViGene Biosciences ready-to-package AAV shRNAs for OCLN gene
Clone Products
- Sino Biological Human cDNA Clone for OCLN
- Addgene plasmids for OCLN
- VectorBuilder custom plasmid, inducible vectors for OCLN
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for OCLN
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- R&D Systems cDNA Clones for OCLN (Occludin)
| ExUns: | 1 | ^ | 2a | · | 2b | ^ | 3 | ^ | 4 | ^ | 5 | ^ | 6a | · | 6b | · | 6c | ^ | 7 | ^ | 8 | ^ | 9 | ^ | 10 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SP1: | |||||||||||||||||||||||||
| SP2: | - | ||||||||||||||||||||||||
| SP3: | |||||||||||||||||||||||||
| SP4: | - | - | - | - | |||||||||||||||||||||
| SP5: | - | - |
Expression for OCLN Gene
mRNA expression in embryonic tissues and stem cells from LifeMap Discovery
-
Tooth (Integumentary System)
- Early Ameloblasts Dental Enamel
- Dental Papilla Cells Dental Papilla
- Inner Enamel Epithelial Cells Dental Enamel
- Stellate Reticulum Cells Dental Core
- Outer Enamel Epithelial Cells Dental Enamel
-
Kidney (Urinary System)
- Ureteric Bud Cells Ureteric Bud
- Ureteric Bud Tip Cells Ureteric Bud
- Renal Collecting Duct System
- Ureteric Bud
- Metanephros
-
Epithelial Cells
- Early Ameloblasts Dental Enamel
- Mature Choroid Plexus Cells Choroid Plexus
- Inner Enamel Epithelial Cells Dental Enamel
- Outer Enamel Epithelial Cells Dental Enamel
- Brain (Nervous System)
- Inner Cell Mass (Early Embryonic Tissues)
-
Skeletal Muscle (Muscoskeletal System)
- Muscle Progenitor Cells Mandibular Arch Muscles
- Muscle Progenitor Cells Hyoid Arch Muscles
- Lung (Respiratory System)
- Endothelium (Cardiovascular System)
-
Epiblast (Early Embryonic Tissues)
- Epiblast Cells Epiblast
- Lower Urinary Tract (Urinary System)
- NULL (Uncategorized)
This gene is overexpressed in Liver, secretome (21.9), Cervix (10.4), Pancreas (8.3), and Islet of Langerhans (7.2).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for OCLN Gene
NURSA nuclear receptor signaling pathways regulating expression of OCLN Gene:
OCLNSOURCE GeneReport for Unigene cluster for OCLN Gene:
Hs.592605mRNA Expression by UniProt/SwissProt for OCLN Gene:
Q16625-OCLN_HUMAN
Tissue specificity:
Localized at tight junctions of both epithelial and endothelial cells. Highly expressed in kidney. Not detected in testis.
Evidence on tissue expression from TISSUES for OCLN Gene
- Nervous system(4.9)
- Lung(4.8)
- Liver(4.5)
- Kidney(3.9)
- Skin(3.6)
- Eye(3.4)
- Intestine(3.4)
- Heart(2.7)
- Blood(2.6)
- Pancreas(2.2)
- Stomach(2.1)
Phenotype-based relationships between genes and organs from Gene ORGANizer for OCLN Gene
Germ Layers:
- ectoderm
- endoderm
- mesoderm
Systems:
- cardiovascular
- digestive
- integumentary
- lymphatic
- nervous
- skeletal muscle
- skeleton
Organs:
Head and neck:
- brain
- cerebellum
- cerebrospinal fluid
- chin
- ear
- eye
- face
- forehead
- head
- jaw
- lip
- mandible
- meninges
- mouth
- neck
- nose
- outer ear
- skull
Thorax:
- chest wall
Abdomen:
- abdominal wall
- liver
- spleen
General:
- blood
- blood vessel
- coagulation system
- skin
- spinal cord
Primer Products
-
OriGene qPCR primer pairs and template standards for OCLN
-
OriGene qPCR primer pairs for OCLN
No data available for mRNA differential expression in normal tissues and Protein tissue co-expression partners for OCLN Gene
Orthologs for OCLN Gene
This gene was present in the common ancestor of chordates.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | OCLN 34 35 |
|
||
| dog (Canis familiaris) |
Mammalia | OCLN 34 35 |
|
||
| cow (Bos Taurus) |
Mammalia | OCLN 34 35 |
|
||
| mouse (Mus musculus) |
Mammalia | Ocln 34 16 35 |
|
||
| platypus (Ornithorhynchus anatinus) |
Mammalia | OCLN 35 |
|
OneToOne | |
| rat (Rattus norvegicus) |
Mammalia | Ocln 34 |
|
||
| oppossum (Monodelphis domestica) |
Mammalia | OCLN 35 |
|
OneToOne | |
| chicken (Gallus gallus) |
Aves | OCLN 35 |
|
OneToOne | |
| lizard (Anolis carolinensis) |
Reptilia | OCLN 35 |
|
OneToOne | |
| tropical clawed frog (Silurana tropicalis) |
Amphibia | ocln 34 |
|
||
| zebrafish (Danio rerio) |
Actinopterygii | oclna 34 35 |
|
||
| oclnb 35 |
|
OneToMany |
- Species where no ortholog for OCLN was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- fruit fly (Drosophila melanogaster)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea squirt (Ciona intestinalis)
- sea squirt (Ciona savignyi)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
- worm (Caenorhabditis elegans)
Paralogs for OCLN Gene
Pseudogenes.org Pseudogenes for OCLN Gene
No data available for Paralogs for OCLN Gene
Variants for OCLN Gene
| SNP ID | Clin | Chr 05 pos | Sequence Context | AA Info | Type |
|---|---|---|---|---|---|
| rs267606926 | Band-like calcification with simplified gyration and polymicrogyria (BLCPMG) [MIM:251290] | ||||
| rs111832736 | -- | 69,494,186(+) | GTGCT(-/TG)TGTGT | intron-variant | |
| rs141706396 | -- | 69,526,554(+) | CCTTC(-/CAGAGCTCTAATAACTTATT)CAGAG | intron-variant | |
| rs200106961 | -- | 69,549,369(+) | GAACT(-/TAAG)TAACA | intron-variant | |
| rs200271483 | -- | 69,538,010(+) | AACTC(-/T)TTTTT | intron-variant |
Residual Variation Intolerance Score:
70.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
1.88;
35.09% of all genes are more intolerant (likely to be disease-causing)
Relevant External Links for OCLN Gene
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for OCLN Gene
Disorders for OCLN Gene
(9) MalaCards diseases for OCLN Gene - From: OMIM, ClinVar, GeneTests, Orphanet, Swiss-Prot, DISEASES, and GeneCards
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| band-like calcification with simplified gyration and polymicrogyria |
|
|
| torch syndrome |
|
|
| polymicrogyria |
|
|
| acute vascular insufficiency of intestine |
|
|
| acute hemorrhagic leukoencephalitis |
|
|
Search OCLN in MalaCards
View complete list of genes associated with diseases
UniProtKB/Swiss-Prot
OCLN_HUMAN- Band-like calcification with simplified gyration and polymicrogyria (BLCPMG) [MIM:251290]: A neurologic disorder with characteristic clinical and neuroradiologic features that mimic intrauterine TORCH infection in the absence of evidence of infection. Affected individuals have congenital microcephaly, intracranial calcifications, and severe developmental delay. {ECO:0000269 PubMed:20727516}. Note=The disease is caused by mutations affecting the gene represented in this entry.
Relevant External Links for OCLN
- Atlas of Genetics and Cytogenetics in Oncology and Haematology:
- OCLN
No data available for Genatlas for OCLN Gene
Publications for OCLN Gene
- Interspecies diversity of the occludin sequence: cDNA cloning of human, mouse, dog, and rat-kangaroo homologues. (PMID: 8601611) Ando-Akatsuka Y. … Tsukita S. (J. Cell Biol. 1996) 2 3 4 64
- Splicing diversity of the human OCLN gene and its biological significance for hepatitis C virus entry. (PMID: 20463075) Kohaar I. … Prokunina-Olsson L. (J. Virol. 2010) 3 4 64
- Recessive mutations in the gene encoding the tight junction protein occludin cause band-like calcification with simplified gyration and polymicrogyria. (PMID: 20727516) O'Driscoll M.C. … Crow Y.J. (Am. J. Hum. Genet. 2010) 3 4 64
- Phosphorylation of Tyr-398 and Tyr-402 in occludin prevents its interaction with ZO-1 and destabilizes its assembly at the tight junctions. (PMID: 19017651) Elias B.C. … Rao R. (J. Biol. Chem. 2009) 3 4 64
- PKC eta regulates occludin phosphorylation and epithelial tight junction integrity. (PMID: 19114660) Suzuki T. … Rao R. (Proc. Natl. Acad. Sci. U.S.A. 2009) 3 4 64
Products for OCLN Gene
- R&D Systems Antibodies for OCLN (Occludin)
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- R&D Systems cDNA Clones for OCLN (Occludin)
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Custom Antibody ServicesOriGene Antibodies for OCLN
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for OCLN
- Search Origene for MassSpec and Protein Over-expression Lysates for OCLN
- Origene Custom Protein Services for OCLN
- Origene shRNA, siRNA, and RNAi products in human, mouse, rat for OCLN
- Browse OriGene Inhibitory RNA Products For OCLN
- OriGene qPCR primer pairs and template standards for OCLN
- OriGene qPCR primer pairs for OCLN
- OriGene CRISPR knockouts for OCLN
- OriGene ORF clones in human for OCLN
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For OCLN
- GenScript: Next-day shipping cDNA ORF clone for OCLN in any vector
- GenScript Custom Purified and Recombinant Proteins Services for OCLN
- GenScript Custom Assay Services for OCLN
- GenScript Custom overexpressing Cell Line Services for OCLN
- GenScript: Design CRISPR guide RNA sequences for OCLN
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for OCLN
- Sino Biological Human cDNA Clone for OCLN
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Proteins
- Sino Biological Antibodies
- Sino Biological ELISA Kits and Pair Sets
- Sino Biological Cell Lysates
- Sino Biological qPCR Primers
- Sino Biological CRO Services for Proteins, Antibodies and Genes
- Sino Biological Transfection Reagents
- Novus Biologicals Antibodies for OCLN
- Novus Biologicals proteins and lysates for OCLN
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Taconic Biosciences Mouse Models for OCLN
- Find your next knockout model in the Taconic Knockout Repository
- Genetically Engineered Models Available Immediately
- Humanized Mice
- Invitrogen Antibodies for OCLN
- Addgene plasmids for OCLN
- antibodies-online Antibodies for OCLN: See all 103
- antibodies-online Kits for OCLN: See all 40
- antibodies-online Proteins for OCLN: See all 8
- Search antibodies-online for peptides
- Search GeneTex for Antibodies for OCLN
- Search GeneTex for Proteins for OCLN
- ViGene Biosciences adenoviral particle packaged cDNA for OCLN gene
- ViGene Biosciences lentiviral particle packaged cDNA for OCLN gene
- ViGene Biosciences ready-to-package AAV shRNAs for OCLN gene
- Search ViGene Biosciences for OCLN
- Santa Cruz Biotechnology (SCBT) Antibodies for OCLN
- Search Santa Cruz Biotechnology (SCBT) for OCLN siRNA/shRNA
- Custom Antibody ServicesProSci Antibodies for OCLN
- Search for OCLN Proteins at ProSci
- Horizon Cell Lines for OCLN
- Cyagen custom Knockout/knockin (KOKI) mouse models for OCLN
- VectorBuilder custom plasmid, inducible vectors for OCLN
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for OCLN
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
Sources for OCLN Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) RNAdb
- (29) ASD
- (30) ECgene
- (31) GeneAnnot
- (32) CGAP SAGE
- (33) SOURCE
- (34) HomoloGene
- (35) PanEnsembl
- (36) euGenes
- (37) SGD
- (38) FlyBase
- (39) WormBase
- (40) Pseudogene
- (41) DGV
- (42) dbSNP
- (43) GenAtlas
- (44) GeneTests
- (45) HGMD
- (46) GAD
- (47) LSDB
- (48) BGMUT
- (49) HuGE
- (50) eBioscience
- (51) Atlas
- (52) Cell Signaling Technology
- (53) GenBank
- (54) H-invDB
- (55) HORDE
- (56) HUGE
- (57) IMGT
- (58) Leiden
- (59) MILLIPORE
- (60) miRBase
- (61) DME
- (62) NCBI
- (63) OriGene
- (64) PubMed
- (65) R&D Systems
- (66) TGDB
- (67) Tocris
- (68) Abcam
- (69) Novus
- (70) ProSpec
- (71) Sino Biological
- (72) GenScript
- (73) Qiagen
- (74) Cloud-Clone Corp.
- (75) Enzo Life Sciences
- (76) OCA
- (77) Proteopedia
- (78) MOPED
- (79) SPIRE
- (80) neXtProt
- (81) Reactome
- (82) GeneGo (Thomson Reuters)
- (83) fRNAdb
- (84) DISEASES
- (85) SIMAP
- (86) GenomeRNAi
- (87) LifeMap
- (88) miRTarBase
- (89) MalaCards
- (90) Invitrogen
- (91) BitterDB
- (92) Vector BioLabs
- (93) ESI-BIO
- (94) RefSeq
- (95) BioSystems
- (96) MaxQB
- (97) IUPHAR
- (98) BioGPS
- (99) Illumina
- (100) COMPARTMENTS
- (101) HOMER
- (102) PaxDb
- (103) ApexBio
- (104) Addgene
- (105) antibodies-online
- (106) CYP
- (107) NONCODE
- (108) SwitchGear Genomics
- (109) TreeFam
- (110) PathCards
- (111) GeneReviews
- (112) GeneTex
- (113) Taconic Biosciences
- (114) GTEx
- (115) ProteomicsDB
- (116) SCBT
- (117) DGIdb
- (118) ClinicalTrials
- (119) FDA Approved Drugs
- (120) RVIS
- (121) SIGNOR
- (122) diseasecard
- (123) NIH Rare Diseases
- (124) Orphanet
- (125) UMLS
- (126) GTR
- (127) Disease Ontology
- (128) Genetics Home Reference
- (129) MeSH
- (130) MedlinePlus
- (131) CDC
- (132) NINDS
- (133) NCBI Bookshelf
- (134) ClinVar
- (135) Gene Damage Index
- (136) ViGene Biosciences
- (137) HPO
- (138) UDN
- (139) VISTA
- (140) FANTOM5
- (141) ENCODE
- (142) ProSci
- (143) Horizon
- (144) NURSA
- (145) IID
- (146) Cyagen
- (147) VectorBuilder
- (148) SNPedia
- (149) BRCA Exchange
- (150) St John's Lab
- (151) CIViC
- (152) ProteoGenix
- (153) dbSUPER
- (154) TISSUES
- (155) Gene ORGANizer