Free for academic non-profit institutions. Other users need a Commercial license

Aliases for NXT2 Gene

Aliases for NXT2 Gene

  • Nuclear Transport Factor 2 Like Export Factor 2 2 3
  • Nuclear Transport Factor 2-Like Export Factor 2 2 3 5
  • Protein P15-2 3 4
  • P15-2 3

External Ids for NXT2 Gene

Previous GeneCards Identifiers for NXT2 Gene

  • GC0XP105925
  • GC0XP106804
  • GC0XP107542
  • GC0XP108585
  • GC0XP108665
  • GC0XP108780
  • GC0XP098400

Summaries for NXT2 Gene

Entrez Gene Summary for NXT2 Gene

  • The protein encoded by this gene contains a nuclear transport factor 2 (NTF2) domain, which plays an important role in the trafficking of macromolecules, ions, and small molecules between the cytoplasm and nucleus. This protein may also have a role in mRNA nuclear export. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jun 2011]

GeneCards Summary for NXT2 Gene

NXT2 (Nuclear Transport Factor 2 Like Export Factor 2) is a Protein Coding gene. Diseases associated with NXT2 include Non-Syndromic X-Linked Intellectual Disability. Among its related pathways are RNA transport and Ribosome biogenesis in eukaryotes. An important paralog of this gene is NXT1.

UniProtKB/Swiss-Prot for NXT2 Gene

  • Regulator of protein export for NES-containing proteins. Also plays a role in mRNA nuclear export.

No data available for Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for NXT2 Gene

Genomics for NXT2 Gene

Regulatory Elements for NXT2 Gene

Enhancers for NXT2 Gene
GeneHancer Identifier Score Enhancer Sources TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Other Gene Targets for Enhancer

Enhancers around NXT2 on UCSC Golden Path with GeneCards custom track

Promoters for NXT2 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

ENSRs around NXT2 on UCSC Golden Path with GeneCards custom track

Genomic Location for NXT2 Gene

109,535,781 bp from pter
109,544,698 bp from pter
8,918 bases
Plus strand

Genomic View for NXT2 Gene

Genes around NXT2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
NXT2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for NXT2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for NXT2 Gene

Proteins for NXT2 Gene

  • Protein details for NXT2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    NTF2-related export protein 2
    Protein Accession:
    Secondary Accessions:
    • D3DUY1
    • Q0VAN8
    • Q5JYV5
    • Q5JYV6
    • Q5JYV7
    • Q9H8U0
    • Q9NQ64
    • Q9NRL7
    • Q9Y3M4
    • Q9Y3M5

    Protein attributes for NXT2 Gene

    142 amino acids
    Molecular mass:
    16228 Da
    Quaternary structure:
    • Associates with NXF1, NXF2, NXF3 and NXF5.
    • Sequence=BAB14511.1; Type=Erroneous initiation; Evidence={ECO:0000305};

    Alternative splice isoforms for NXT2 Gene


neXtProt entry for NXT2 Gene

Proteomics data for NXT2 Gene at MOPED

Post-translational modifications for NXT2 Gene

  • Ubiquitination at Lys 106
  • Modification sites at PhosphoSitePlus

Other Protein References for NXT2 Gene

No data available for DME Specific Peptides for NXT2 Gene

Domains & Families for NXT2 Gene

Protein Domains for NXT2 Gene

Suggested Antigen Peptide Sequences for NXT2 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Contains 1 NTF2 domain.
  • Contains 1 NTF2 domain.
genes like me logo Genes that share domains with NXT2: view

No data available for Gene Families for NXT2 Gene

Function for NXT2 Gene

Molecular function for NXT2 Gene

UniProtKB/Swiss-Prot Function:
Regulator of protein export for NES-containing proteins. Also plays a role in mRNA nuclear export.
genes like me logo Genes that share phenotypes with NXT2: view

Animal Model Products

No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for NXT2 Gene

Localization for NXT2 Gene

Subcellular locations from UniProtKB/Swiss-Prot for NXT2 Gene

Nucleus. Cytoplasm. Note=Shuttles between the nucleus and the cytoplasm.

Subcellular locations from

Jensen Localization Image for NXT2 Gene COMPARTMENTS Subcellular localization image for NXT2 gene
Compartment Confidence
nucleus 5
cytosol 1
extracellular 1

Gene Ontology (GO) - Cellular Components for NXT2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005654 nucleoplasm IDA --
genes like me logo Genes that share ontologies with NXT2: view

Pathways & Interactions for NXT2 Gene

genes like me logo Genes that share pathways with NXT2: view

Pathways by source for NXT2 Gene

Gene Ontology (GO) - Biological Process for NXT2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006810 transport IEA --
genes like me logo Genes that share ontologies with NXT2: view

No data available for SIGNOR curated interactions for NXT2 Gene

Drugs & Compounds for NXT2 Gene

No Compound Related Data Available

Transcripts for NXT2 Gene

Unigene Clusters for NXT2 Gene

Nuclear transport factor 2-like export factor 2:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for NXT2 Gene

ExUns: 1 ^ 2a · 2b ^ 3 ^ 4 ^ 5 ^ 6a · 6b · 6c ^ 7
SP1: - - -
SP2: -
SP3: -

Relevant External Links for NXT2 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for NXT2 Gene

mRNA expression in normal human tissues for NXT2 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for NXT2 Gene

This gene is overexpressed in Ovary (24.1), Bone (21.8), Peripheral blood mononuclear cells (6.2), and Placenta (6.1).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MOPED, and MaxQB for NXT2 Gene

SOURCE GeneReport for Unigene cluster for NXT2 Gene Hs.25010

genes like me logo Genes that share expression patterns with NXT2: view

Primer Products

No data available for mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Protein tissue co-expression partners for NXT2 Gene

Orthologs for NXT2 Gene

This gene was present in the common ancestor of animals.

Orthologs for NXT2 Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia NXT2 35
  • 92.2 (n)
  • 90.07 (a)
NXT2 36
  • 89 (a)
(Canis familiaris)
Mammalia NXT2 35
  • 87.48 (n)
  • 79.19 (a)
NXT2 36
  • 78 (a)
(Mus musculus)
Mammalia Nxt2 35
  • 87.71 (n)
  • 87.94 (a)
Nxt2 16
Nxt2 36
  • 87 (a)
(Pan troglodytes)
Mammalia LOC473728 35
  • 90.31 (n)
  • 86.73 (a)
NXT2 36
  • 99 (a)
(Rattus norvegicus)
Mammalia Nxt2 35
  • 87.23 (n)
  • 87.94 (a)
(Monodelphis domestica)
Mammalia -- 36
  • 82 (a)
-- 36
  • 76 (a)
(Ornithorhynchus anatinus)
Mammalia NXT2 36
  • 80 (a)
(Gallus gallus)
Aves NXT2 35
  • 78.01 (n)
  • 88.65 (a)
NXT2 36
  • 89 (a)
(Anolis carolinensis)
Reptilia NXT2 36
  • 78 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia nxt2 35
  • 70.74 (n)
  • 71.94 (a)
African clawed frog
(Xenopus laevis)
Amphibia MGC68570 35
(Danio rerio)
Actinopterygii nxt2 35
  • 67.86 (n)
  • 72.32 (a)
nxt2 36
  • 73 (a)
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.8809 35
fruit fly
(Drosophila melanogaster)
Insecta Nxt1 36
  • 43 (a)
(Caenorhabditis elegans)
Secernentea nxt-1 36
  • 30 (a)
Species with no ortholog for NXT2:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for NXT2 Gene

Gene Tree for NXT2 (if available)
Gene Tree for NXT2 (if available)

Paralogs for NXT2 Gene

Paralogs for NXT2 Gene

(1) SIMAP similar genes for NXT2 Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with NXT2: view

Variants for NXT2 Gene

Sequence variations from dbSNP and Humsavar for NXT2 Gene

SNP ID Clin Chr 0X pos Sequence Context AA Info Type
rs747679339 -- 109,537,022(+) TCTGG(-/ATTTTAAAACTTATGTAGATCAGGCATGTAGAGCTGC)TGAGT upstream-variant-2KB, splice-donor-variant
rs747719439 -- 109,535,935(+) CCAAA(A/G)AAGAA upstream-variant-2KB, reference, missense
rs747880811 -- 109,535,173(+) GCCAC(C/T)GCACT upstream-variant-2KB
rs747991899 -- 109,539,752(+) AGATT(C/T)GGAAA intron-variant
rs748416888 -- 109,535,047(+) AAAAA(C/G)GAAGA upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for NXT2 Gene

Variant ID Type Subtype PubMed ID
dgv2463e1 CNV Complex 17122850

Variation tolerance for NXT2 Gene

Residual Variation Intolerance Score: 71.7% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.05; 1.16% of all genes are more intolerant (likely to be disease-causing)

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Relevant External Links for NXT2 Gene

Disorders for NXT2 Gene

MalaCards: The human disease database

(1) MalaCards diseases for NXT2 Gene - From: DISEASES

Disorder Aliases PubMed IDs
non-syndromic x-linked intellectual disability
  • mrx
- elite association - COSMIC cancer census association via MalaCards
Search NXT2 in MalaCards View complete list of genes associated with diseases

Relevant External Links for NXT2

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with NXT2: view

No data available for UniProtKB/Swiss-Prot and Genatlas for NXT2 Gene

Publications for NXT2 Gene

  1. TAP (NXF1) belongs to a multigene family of putative RNA export factors with a conserved modular architecture. (PMID: 11073998) Herold A. … Izaurralde E. (Mol. Cell. Biol. 2000) 2 3 4 23 67
  2. Phospho-tyrosine dependent protein-protein interaction network. (PMID: 25814554) Grossmann A. … Stelzl U. (Mol. Syst. Biol. 2015) 3
  3. A human interactome in three quantitative dimensions organized by stoichiometries and abundances. (PMID: 26496610) Hein M.Y. … Mann M. (Cell 2015) 3
  4. A proteome-scale map of the human interactome network. (PMID: 25416956) Rolland T. … Vidal M. (Cell 2014) 3
  5. The protein interaction landscape of the human CMGC kinase group. (PMID: 23602568) Varjosalo M. … Gstaiger M. (Cell Rep 2013) 3

Products for NXT2 Gene

Sources for NXT2 Gene
