Free for academic non-profit institutions. Other users need a Commercial license

Aliases for NUDT15 Gene

Aliases for NUDT15 Gene

  • Nudix Hydrolase 15 2 3 5
  • Nudix (Nucleoside Diphosphate Linked Moiety X)-Type Motif 15 2 3
  • 8-Oxo-DGTPase NUDT15 3 4
  • MutT Homolog 2 3 4
  • MTH2 3 4
  • Probable 7,8-Dihydro-8-Oxoguanine Triphosphatase NUDT15 3
  • Nucleoside Diphosphate-Linked Moiety X Motif 15 4
  • 7,8-Dihydro-8-Oxoguanine-Triphosphatase NUDT15 4
  • Nudix Motif 15 4
  • EC 3.6.1.55 4
  • NUDT15D 3

External Ids for NUDT15 Gene

Previous GeneCards Identifiers for NUDT15 Gene

  • GC13P046409
  • GC13P047509
  • GC13P048611
  • GC13P029404

Summaries for NUDT15 Gene

Entrez Gene Summary for NUDT15 Gene

  • This gene encodes an enzyme that belongs to the Nudix hydrolase superfamily. Members of this superfamily catalyze the hydrolysis of nucleoside diphosphates, including substrates like 8-oxo-dGTP, which are a result of oxidative damage, and can induce base mispairing during DNA replication, causing transversions. The encoded enzyme is a negative regulator of thiopurine activation and toxicity. Mutations in this gene result in poor metabolism of thiopurines, and are associated with thiopurine-induced early leukopenia. Multiple pseudogenes of this gene have been identified. [provided by RefSeq, Apr 2016]

GeneCards Summary for NUDT15 Gene

NUDT15 (Nudix Hydrolase 15) is a Protein Coding gene. Diseases associated with NUDT15 include azathioprine or 6-mercatopurine toxicity or dose selection. Among its related pathways are Metabolism and Purine metabolism. GO annotations related to this gene include hydrolase activity and 8-oxo-7,8-dihydrodeoxyguanosine triphosphate pyrophosphatase activity.

UniProtKB/Swiss-Prot for NUDT15 Gene

  • Mediates the hydrolysis of some nucleoside diphosphate derivatives. Can degrade 8-oxo-dGTP in vitro, suggesting that it may remove an oxidatively damaged form of guanine (7,8-dihydro-8-oxoguanine) from DNA and the nucleotide pool, thereby preventing misincorporation of 8-oxo-dGTP into DNA thus preventing A:T to C:G transversions. Its substrate specificity in vivo however remains unclear (By similarity). May have a role in DNA synthesis and cell cycle progression through the interaction with PCNA.

No data available for Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for NUDT15 Gene

Genomics for NUDT15 Gene

Regulatory Elements for NUDT15 Gene

Promoters for NUDT15 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

ENSRs around NUDT15 on UCSC Golden Path with GeneCards custom track

Genomic Location for NUDT15 Gene

Chromosome:
13
Start:
48,037,567 bp from pter
End:
48,047,222 bp from pter
Size:
9,656 bases
Orientation:
Plus strand

Genomic View for NUDT15 Gene

Genes around NUDT15 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
NUDT15 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for NUDT15 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for NUDT15 Gene

Proteins for NUDT15 Gene

  • Protein details for NUDT15 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q9NV35-NUD15_HUMAN
    Recommended name:
    Probable 8-oxo-dGTP diphosphatase NUDT15
    Protein Accession:
    Q9NV35
    Secondary Accessions:
    • A2RUR6
    • Q32Q27
    • Q6P2C9

    Protein attributes for NUDT15 Gene

    Size:
    164 amino acids
    Molecular mass:
    18609 Da
    Cofactor:
    Name=Mg(2+); Xref=ChEBI:CHEBI:18420; Name=Mn(2+); Xref=ChEBI:CHEBI:29035;
    Quaternary structure:
    • Interacts with PCNA; interaction is disrupted in response to UV irradiation.

    Three dimensional structures from OCA and Proteopedia for NUDT15 Gene

neXtProt entry for NUDT15 Gene

Proteomics data for NUDT15 Gene at MOPED

Post-translational modifications for NUDT15 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for NUDT15 Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

  • Santa Cruz Biotechnology (SCBT) Antibodies for NUDT15

No data available for DME Specific Peptides for NUDT15 Gene

Domains & Families for NUDT15 Gene

Gene Families for NUDT15 Gene

Protein Domains for NUDT15 Gene

Suggested Antigen Peptide Sequences for NUDT15 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q9NV35

UniProtKB/Swiss-Prot:

NUD15_HUMAN :
  • Contains 1 nudix hydrolase domain.
  • Belongs to the Nudix hydrolase family.
Domain:
  • Contains 1 nudix hydrolase domain.
Family:
  • Belongs to the Nudix hydrolase family.
genes like me logo Genes that share domains with NUDT15: view

Function for NUDT15 Gene

Molecular function for NUDT15 Gene

UniProtKB/Swiss-Prot CatalyticActivity:
8-oxo-dGTP + H(2)O = 8-oxo-dGMP + diphosphate.
UniProtKB/Swiss-Prot Function:
Mediates the hydrolysis of some nucleoside diphosphate derivatives. Can degrade 8-oxo-dGTP in vitro, suggesting that it may remove an oxidatively damaged form of guanine (7,8-dihydro-8-oxoguanine) from DNA and the nucleotide pool, thereby preventing misincorporation of 8-oxo-dGTP into DNA thus preventing A:T to C:G transversions. Its substrate specificity in vivo however remains unclear (By similarity). May have a role in DNA synthesis and cell cycle progression through the interaction with PCNA.

Enzyme Numbers (IUBMB) for NUDT15 Gene

Gene Ontology (GO) - Molecular Function for NUDT15 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0008413 8-oxo-7,8-dihydroguanosine triphosphate pyrophosphatase activity IDA 22556419
GO:0035539 8-oxo-7,8-dihydrodeoxyguanosine triphosphate pyrophosphatase activity IDA 22556419
genes like me logo Genes that share ontologies with NUDT15: view

Phenotypes for NUDT15 Gene

GenomeRNAi human phenotypes for NUDT15:
genes like me logo Genes that share phenotypes with NUDT15: view

Animal Model Products

miRNA for NUDT15 Gene

miRTarBase miRNAs that target NUDT15

No data available for Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for NUDT15 Gene

Localization for NUDT15 Gene

Subcellular locations from

COMPARTMENTS
Jensen Localization Image for NUDT15 Gene COMPARTMENTS Subcellular localization image for NUDT15 gene
Compartment Confidence
cytosol 4
nucleus 3
mitochondrion 2
peroxisome 2

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for NUDT15 Gene

Pathways & Interactions for NUDT15 Gene

genes like me logo Genes that share pathways with NUDT15: view

Pathways by source for NUDT15 Gene

Interacting Proteins for NUDT15 Gene

STRING Interaction Network Preview (showing 1 interactants - click image to see details)
http://string-db.org/version_10/api/image/networkList?limit=0&targetmode=proteins&caller_identity=gene_cards&network_flavor=evidence&identifiers=9606.ENSP00000258662%0d%0a9606.ENSP00000264228%0d%0a
Selected Interacting proteins: ENSP00000258662 for NUDT15 Gene via STRING

Symbol External ID(s) Details
SRD5A3

Gene Ontology (GO) - Biological Process for NUDT15 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0044281 small molecule metabolic process TAS --
genes like me logo Genes that share ontologies with NUDT15: view

No data available for SIGNOR curated interactions for NUDT15 Gene

Drugs & Compounds for NUDT15 Gene

(7) Drugs for NUDT15 Gene - From: HMDB and PharmGKB

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Azathioprine Approved Pharma 153
Mercaptopurine Approved Pharma 0
CDP Experimental Pharma 0
Diphosphate Experimental Pharma 0
Guanosine diphosphate Experimental Pharma 0

(5) Additional Compounds for NUDT15 Gene - From: HMDB

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
8-Oxo-dGMP
  • 8-Oxo-7,8-dihydro-2'-deoxyguanosine 5'-triphosphate
  • 8OG
8-Oxo-dgtp
  • 2'-Deoxy-7,8-dihydro-8-oxo-Guanosine 5'-(tetrahydrogen triphosphate)
  • 8-Hydroxy-2'-deoxyguanosine 5'-triphosphate
  • 8-Oxo-2'-deoxyguanosine 5'-triphosphate
  • 8-Oxo-7,8-dihydro-2'-deoxyguanosine 5'-triphosphate
  • 8-Oxo-deoxyguanosine triphosphate
139307-94-1
ADP
  • Adenosindiphosphorsaeure
  • Adenosine 5'-pyrophosphate
  • Adenosine diphosphate
  • Adenosine pyrophosphate
  • Adenosine-5'-diphosphate
Full agonist, Agonist 58-64-0
dTDP
  • Deoxy-TDP
  • Deoxythymidine 5'-diphosphate
  • dTDP
  • TDP
  • Thymidine 5'-diphosphate
491-97-4
Water
  • Dihydrogen oxide
  • Steam
7732-18-5
genes like me logo Genes that share compounds with NUDT15: view

Transcripts for NUDT15 Gene

mRNA/cDNA for NUDT15 Gene

Unigene Clusters for NUDT15 Gene

Nudix (nucleoside diphosphate linked moiety X)-type motif 15:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for NUDT15 Gene

No ASD Table

Relevant External Links for NUDT15 Gene

GeneLoc Exon Structure for
NUDT15
ECgene alternative splicing isoforms for
NUDT15

Expression for NUDT15 Gene

mRNA expression in normal human tissues for NUDT15 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for NUDT15 Gene

This gene is overexpressed in Nasal epithelium (53.8).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MOPED, and MaxQB for NUDT15 Gene



SOURCE GeneReport for Unigene cluster for NUDT15 Gene Hs.144407

genes like me logo Genes that share expression patterns with NUDT15: view

Primer Products

In Situ Assay Products

No data available for mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Protein tissue co-expression partners for NUDT15 Gene

Orthologs for NUDT15 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for NUDT15 Gene

Organism Taxonomy Gene Similarity Type Details
cow
(Bos Taurus)
Mammalia NUDT15 35
  • 90.85 (n)
  • 93.9 (a)
NUDT15 36
  • 90 (a)
OneToOne
dog
(Canis familiaris)
Mammalia NUDT15 35
  • 84.05 (n)
  • 86.5 (a)
NUDT15 36
  • 85 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Nudt15 35
  • 85.08 (n)
  • 90.91 (a)
Nudt15 16
Gm5519 36
  • 84 (a)
OneToMany
Nudt15 36
  • 86 (a)
OneToMany
chimpanzee
(Pan troglodytes)
Mammalia NUDT15 35
  • 99.8 (n)
  • 100 (a)
-- 36
  • 100 (a)
OneToMany
-- 36
  • 100 (a)
OneToMany
rat
(Rattus norvegicus)
Mammalia Nudt15 35
  • 84.85 (n)
  • 89.51 (a)
oppossum
(Monodelphis domestica)
Mammalia -- 36
  • 58 (a)
OneToMany
-- 36
  • 76 (a)
OneToMany
platypus
(Ornithorhynchus anatinus)
Mammalia NUDT15 36
  • 88 (a)
OneToOne
chicken
(Gallus gallus)
Aves NUDT15 35
  • 64.78 (n)
  • 67.38 (a)
NUDT15 36
  • 64 (a)
OneToOne
lizard
(Anolis carolinensis)
Reptilia NUDT15 36
  • 72 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia nudt15 35
  • 67.89 (n)
  • 71.32 (a)
African clawed frog
(Xenopus laevis)
Amphibia LOC398640 35
zebrafish
(Danio rerio)
Actinopterygii nudt15 35
  • 61.87 (n)
  • 58.33 (a)
nudt15 36
  • 55 (a)
OneToOne
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.4285 35
thale cress
(Arabidopsis thaliana)
eudicotyledons NUDX1 35
  • 52.82 (n)
  • 47.46 (a)
bread mold
(Neurospora crassa)
Ascomycetes NCU02895 35
  • 51.52 (n)
  • 45.45 (a)
Species with no ortholog for NUDT15:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for NUDT15 Gene

ENSEMBL:
Gene Tree for NUDT15 (if available)
TreeFam:
Gene Tree for NUDT15 (if available)

Paralogs for NUDT15 Gene

Pseudogenes.org Pseudogenes for NUDT15 Gene

genes like me logo Genes that share paralogs with NUDT15: view

No data available for Paralogs for NUDT15 Gene

Variants for NUDT15 Gene

Sequence variations from dbSNP and Humsavar for NUDT15 Gene

SNP ID Clin Chr 13 pos Sequence Context AA Info Type
rs943066 -- 48,041,299(-) taatc(A/G/T)cctcc intron-variant, utr-variant-3-prime
rs2031775 -- 48,037,407(-) AACCT(C/T)GGCAC upstream-variant-2KB
rs3831098 -- 48,037,956(-) GGCGT(-/GAGATCGTCCCTCTGCGCACGCCCC)GAGTT intron-variant
rs3782979 -- 48,044,971(+) TCATA(A/G)AGAAA intron-variant
rs7320653 -- 48,042,061(+) gaatt(C/T)agagg intron-variant

Structural Variations from Database of Genomic Variants (DGV) for NUDT15 Gene

Variant ID Type Subtype PubMed ID
nsv832601 CNV Gain 17160897

Variation tolerance for NUDT15 Gene

Residual Variation Intolerance Score: 70.1% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 4.54; 64.82% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for NUDT15 Gene

HapMap Linkage Disequilibrium report
NUDT15
Human Gene Mutation Database (HGMD)
NUDT15

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for NUDT15 Gene

Disorders for NUDT15 Gene

MalaCards: The human disease database

(1) MalaCards diseases for NUDT15 Gene - From: Orphanet

- elite association - COSMIC cancer census association via MalaCards

Relevant External Links for NUDT15

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
NUDT15
genes like me logo Genes that share disorders with NUDT15: view

No data available for UniProtKB/Swiss-Prot and Genatlas for NUDT15 Gene

Publications for NUDT15 Gene

  1. Proliferating cell nuclear antigen is protected from degradation by forming a complex with MutT Homolog2. (PMID: 19419956) Yu Y. … Zhu W.-G. (J. Biol. Chem. 2009) 3 4 23 67
  2. Mouse MTH2 protein which prevents mutations caused by 8-oxoguanine nucleotides. (PMID: 12767940) Cai J.P. … Sekiguchi M. (Biochem. Biophys. Res. Commun. 2003) 2 3
  3. Inherited NUDT15 variant is a genetic determinant of mercaptopurine intolerance in children with acute lymphoblastic leukemia. (PMID: 25624441) Yang J.J. … Relling M.V. (J. Clin. Oncol. 2015) 3
  4. The BioPlex Network: A Systematic Exploration of the Human Interactome. (PMID: 26186194) Huttlin E.L. … Gygi S.P. (Cell 2015) 3
  5. A common missense variant in NUDT15 confers susceptibility to thiopurine-induced leukopenia. (PMID: 25108385) Yang S.K. … Song K. (Nat. Genet. 2014) 3

Products for NUDT15 Gene

Sources for NUDT15 Gene

Back to Top

Content