Free for academic non-profit institutions. Other users need a Commercial license

Aliases for NUDT15 Gene

Aliases for NUDT15 Gene

  • Nudix Hydrolase 15 2 3 4 5
  • Nucleoside Diphosphate-Linked To Another Moiety X Hydrolase 15 3 4
  • Nudix (Nucleoside Diphosphate Linked Moiety X)-Type Motif 15 2 3
  • MutT Homolog 2 3 4
  • MTH2 3 4
  • Probable 7,8-Dihydro-8-Oxoguanine Triphosphatase NUDT15 3
  • Nucleoside Diphosphate-Linked Moiety X Motif 15 4
  • Nucleotide Triphosphate Diphosphatase NUDT15 3
  • Probable 8-Oxo-DGTP Diphosphatase NUDT15 3
  • 8-Oxo-DGTPase NUDT15 3
  • Nudix Motif 15 4
  • EC 4
  • NUDT15D 3

External Ids for NUDT15 Gene

Previous GeneCards Identifiers for NUDT15 Gene

  • GC13P046409
  • GC13P047509
  • GC13P048611
  • GC13P029404

Summaries for NUDT15 Gene

Entrez Gene Summary for NUDT15 Gene

  • This gene encodes an enzyme that belongs to the Nudix hydrolase superfamily. Members of this superfamily catalyze the hydrolysis of nucleoside diphosphates, including substrates like 8-oxo-dGTP, which are a result of oxidative damage, and can induce base mispairing during DNA replication, causing transversions. The encoded enzyme is a negative regulator of thiopurine activation and toxicity. Mutations in this gene result in poor metabolism of thiopurines, and are associated with thiopurine-induced early leukopenia. Multiple pseudogenes of this gene have been identified. [provided by RefSeq, Apr 2016]

GeneCards Summary for NUDT15 Gene

NUDT15 (Nudix Hydrolase 15) is a Protein Coding gene. Diseases associated with NUDT15 include Thiopurines, Poor Metabolism Of, 2 and Azathioprine Or 6-Mercatopurine Toxicity Or Dose Selection. Among its related pathways are Purine metabolism and Metabolism. Gene Ontology (GO) annotations related to this gene include hydrolase activity and 8-oxo-7,8-dihydrodeoxyguanosine triphosphate pyrophosphatase activity.

UniProtKB/Swiss-Prot for NUDT15 Gene

  • May catalyze the hydrolysis of nucleoside triphosphates including dGTP, dTTP, dCTP, their oxidized forms like 8-oxo-dGTP and the prodrug thiopurine derivatives 6-thio-dGTP and 6-thio-GTP (PubMed:26238318). Could also catalyze the hydrolysis of some nucleoside diphosphate derivatives (PubMed:22556419, PubMed:26238318). Hydrolyzes oxidized nucleosides triphosphates like 8-oxo-dGTP in vitro, but the specificity and efficiency towards these substrates are low. Therefore, the potential in vivo sanitizing role of this enzyme, that would consist in removing oxidatively damaged forms of nucleosides to prevent their incorporation into DNA, is unclear (PubMed:26238318, PubMed:22556419). Through the hydrolysis of thioguanosine triphosphates may participate in the catabolism of thiopurine drugs (PubMed:26238318, PubMed:25108385). May also have a role in DNA synthesis and cell cycle progression by stabilizing PCNA (PubMed:19419956).

Additional gene information for NUDT15 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for NUDT15 Gene

Genomics for NUDT15 Gene

GeneHancer (GH) Regulatory Elements for NUDT15 Gene

Promoters and enhancers for NUDT15 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH13I048036 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 556.3 +0.9 913 4.5 PKNOX1 MLX ARNT ZFP64 ARID4B SIN3A FEZF1 DMAP1 ZNF2 IRF4 NUDT15 PPP1R26P1 MED4 SUCLA2 SUCLA2-AS1 ENSG00000276968
GH13I048309 Enhancer 0.4 dbSUPER 11.8 +272.9 272908 2.6 ZNF211 ZNF214 NUDT15 RB1 RCBTB2 GC13M048317
GH13I048043 Enhancer 0.4 Ensembl 0.4 +6.2 6234 0.4 JUND JUNB BATF ENSG00000276968 SUCLA2 MED4-AS1 MED4 NUDT15
GH13I048044 Enhancer 0.3 Ensembl 0.4 +5.7 5734 0.2 ZNF121 ENSG00000276968 NUDT15 MED4-AS1
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around NUDT15 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the NUDT15 gene promoter:

Genomic Locations for NUDT15 Gene

Genomic Locations for NUDT15 Gene
9,656 bases
Plus strand

Genomic View for NUDT15 Gene

Genes around NUDT15 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
NUDT15 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for NUDT15 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for NUDT15 Gene

Proteins for NUDT15 Gene

  • Protein details for NUDT15 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Nucleotide triphosphate diphosphatase NUDT15
    Protein Accession:
    Secondary Accessions:
    • A2RUR6
    • Q32Q27
    • Q6P2C9

    Protein attributes for NUDT15 Gene

    164 amino acids
    Molecular mass:
    18609 Da
    Name=Mg(2+); Xref=ChEBI:CHEBI:18420; Name=Mn(2+); Xref=ChEBI:CHEBI:29035;
    Quaternary structure:
    • Homodimer (PubMed:26238318). Interacts with PCNA; interaction is disrupted in response to UV irradiation (PubMed:19419956).

    Three dimensional structures from OCA and Proteopedia for NUDT15 Gene

neXtProt entry for NUDT15 Gene

Post-translational modifications for NUDT15 Gene

No Post-translational modifications

Other Protein References for NUDT15 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for NUDT15 Gene

Domains & Families for NUDT15 Gene

Gene Families for NUDT15 Gene

Human Protein Atlas (HPA):
  • Enzymes
  • Predicted intracellular proteins

Protein Domains for NUDT15 Gene

Suggested Antigen Peptide Sequences for NUDT15 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the Nudix hydrolase family.
  • Belongs to the Nudix hydrolase family.
genes like me logo Genes that share domains with NUDT15: view

Function for NUDT15 Gene

Molecular function for NUDT15 Gene

UniProtKB/Swiss-Prot BiophysicochemicalProperties:
Kinetic parameters: KM=42 uM for dGTP (at pH 7.5) {ECO:0000269 PubMed:26238318}; KM=110 uM for 8-oxo-dGTP (at pH 7.5) {ECO:0000269 PubMed:26238318}; Note=Has a 10-fold higher catalytic efficiency toward dGTP compared to 8-oxo-dGTP. {ECO:0000269 PubMed:26238318};
UniProtKB/Swiss-Prot CatalyticActivity:
A nucleoside triphosphate + H(2)O = a nucleotide + diphosphate.
UniProtKB/Swiss-Prot Function:
May catalyze the hydrolysis of nucleoside triphosphates including dGTP, dTTP, dCTP, their oxidized forms like 8-oxo-dGTP and the prodrug thiopurine derivatives 6-thio-dGTP and 6-thio-GTP (PubMed:26238318). Could also catalyze the hydrolysis of some nucleoside diphosphate derivatives (PubMed:22556419, PubMed:26238318). Hydrolyzes oxidized nucleosides triphosphates like 8-oxo-dGTP in vitro, but the specificity and efficiency towards these substrates are low. Therefore, the potential in vivo sanitizing role of this enzyme, that would consist in removing oxidatively damaged forms of nucleosides to prevent their incorporation into DNA, is unclear (PubMed:26238318, PubMed:22556419). Through the hydrolysis of thioguanosine triphosphates may participate in the catabolism of thiopurine drugs (PubMed:26238318, PubMed:25108385). May also have a role in DNA synthesis and cell cycle progression by stabilizing PCNA (PubMed:19419956).

Enzyme Numbers (IUBMB) for NUDT15 Gene

Phenotypes From GWAS Catalog for NUDT15 Gene

Gene Ontology (GO) - Molecular Function for NUDT15 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004551 nucleotide diphosphatase activity IEA --
GO:0005515 protein binding IPI 19419956
GO:0008413 8-oxo-7,8-dihydroguanosine triphosphate pyrophosphatase activity IDA 22556419
GO:0016787 hydrolase activity IEA --
GO:0017110 nucleoside-diphosphatase activity EXP 22556419
genes like me logo Genes that share ontologies with NUDT15: view

Phenotypes for NUDT15 Gene

GenomeRNAi human phenotypes for NUDT15:
genes like me logo Genes that share phenotypes with NUDT15: view

Animal Model Products

miRNA for NUDT15 Gene

miRTarBase miRNAs that target NUDT15

Clone Products

No data available for Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for NUDT15 Gene

Localization for NUDT15 Gene

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for NUDT15 gene
Compartment Confidence
cytosol 4
nucleus 3
mitochondrion 2
peroxisome 1

Subcellular locations from the

Human Protein Atlas (HPA)

Gene Ontology (GO) - Cellular Components for NUDT15 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005829 cytosol TAS,IBA --
genes like me logo Genes that share ontologies with NUDT15: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot for NUDT15 Gene

Pathways & Interactions for NUDT15 Gene

genes like me logo Genes that share pathways with NUDT15: view

Pathways by source for NUDT15 Gene

Gene Ontology (GO) - Biological Process for NUDT15 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000278 mitotic cell cycle IMP 19419956
GO:0006195 purine nucleotide catabolic process IMP 26878724
GO:0006203 dGTP catabolic process IDA 22556419
GO:0034656 nucleobase-containing small molecule catabolic process TAS --
GO:0042262 NOT DNA protection IMP 26238318
genes like me logo Genes that share ontologies with NUDT15: view

No data available for SIGNOR curated interactions for NUDT15 Gene

Drugs & Compounds for NUDT15 Gene

(7) Drugs for NUDT15 Gene - From: PharmGKB and HMDB

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Azathioprine Approved Pharma 190
Mercaptopurine Approved Pharma 0
Water Approved Pharma 0
Magnesium Approved Nutra 0
Manganese Approved Nutra 37

(5) Additional Compounds for NUDT15 Gene - From: HMDB

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
  • 8-Oxo-7,8-dihydro-2'-deoxyguanosine 5'-triphosphate
  • 8OG
  • 2'-Deoxy-7,8-dihydro-8-oxo-Guanosine 5'-(tetrahydrogen triphosphate)
  • 8-Hydroxy-2'-deoxyguanosine 5'-triphosphate
  • 8-Oxo-2'-deoxyguanosine 5'-triphosphate
  • 8-Oxo-7,8-dihydro-2'-deoxyguanosine 5'-triphosphate
  • 8-Oxo-deoxyguanosine triphosphate
  • Adenosindiphosphorsaeure
  • Adenosine 5'-pyrophosphate
  • Adenosine diphosphate
  • Adenosine pyrophosphate
  • Adenosine-5'-diphosphate
Full agonist, Agonist 58-64-0
  • Deoxy-TDP
  • Deoxythymidine 5'-diphosphate
  • dTDP
  • TDP
  • Thymidine 5'-diphosphate
  • (4-)Diphosphoric acid ion
  • (P2O74-)Diphosphate
  • Diphosphate
  • Diphosphoric acid
  • PPi
genes like me logo Genes that share compounds with NUDT15: view

Transcripts for NUDT15 Gene

mRNA/cDNA for NUDT15 Gene

Unigene Clusters for NUDT15 Gene

Nudix (nucleoside diphosphate linked moiety X)-type motif 15:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for NUDT15 Gene

No ASD Table

Relevant External Links for NUDT15 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for NUDT15 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for NUDT15 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for NUDT15 Gene

This gene is overexpressed in Nasal epithelium (53.8).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for NUDT15 Gene

NURSA nuclear receptor signaling pathways regulating expression of NUDT15 Gene:


SOURCE GeneReport for Unigene cluster for NUDT15 Gene:

genes like me logo Genes that share expression patterns with NUDT15: view

No data available for mRNA differential expression in normal tissues , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for NUDT15 Gene

Orthologs for NUDT15 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for NUDT15 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia -- 34
  • 100 (a)
-- 34
  • 100 (a)
NUDT15 33
  • 99.8 (n)
(Bos Taurus)
Mammalia NUDT15 33 34
  • 90.85 (n)
(Ornithorhynchus anatinus)
Mammalia NUDT15 34
  • 88 (a)
(Mus musculus)
Mammalia Nudt15 33 16 34
  • 85.08 (n)
Gm5519 34
  • 84 (a)
(Rattus norvegicus)
Mammalia Nudt15 33
  • 84.85 (n)
(Canis familiaris)
Mammalia NUDT15 33 34
  • 84.05 (n)
(Monodelphis domestica)
Mammalia -- 34
  • 76 (a)
-- 34
  • 58 (a)
(Gallus gallus)
Aves NUDT15 33 34
  • 64.78 (n)
(Anolis carolinensis)
Reptilia NUDT15 34
  • 72 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia nudt15 33
  • 67.89 (n)
African clawed frog
(Xenopus laevis)
Amphibia LOC398640 33
(Danio rerio)
Actinopterygii nudt15 33 34
  • 61.87 (n)
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.4285 33
thale cress
(Arabidopsis thaliana)
eudicotyledons NUDX1 33
  • 52.82 (n)
bread mold
(Neurospora crassa)
Ascomycetes NCU02895 33
  • 51.52 (n)
Species where no ortholog for NUDT15 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for NUDT15 Gene

Gene Tree for NUDT15 (if available)
Gene Tree for NUDT15 (if available)

Paralogs for NUDT15 Gene Pseudogenes for NUDT15 Gene

genes like me logo Genes that share paralogs with NUDT15: view

No data available for Paralogs for NUDT15 Gene

Variants for NUDT15 Gene

Polymorphic Variants from UniProtKB/Swiss-Prot for NUDT15 Gene

Polymorphic NUDT15 variants define the poor metabolism of thiopurines 2 genetic locus (THPM2) [MIM:616903]. Thiopurines are used as immunosuppressants or cytotoxic drugs and are prescribed for a variety of clinical conditions including leukemia, autoimmune disease and organ transplantation. Patients with low NUDT15 activities have an increased risk for toxic effects after receiving standard doses of thiopurine drugs.

Sequence variations from dbSNP and Humsavar for NUDT15 Gene

SNP ID Clin Chr 13 pos Variation AA Info Type
rs116855232 drug-response, Thiopurines, poor metabolism of, 2, mercaptopurine response - Dosage, Toxicity/ADR, azathioprine response - Dosage, Toxicity/ADR 48,045,719(+) C/T coding_sequence_variant, genic_downstream_transcript_variant, missense_variant, non_coding_transcript_variant
rs147390019 drug-response, Thiopurines, poor metabolism of, 2 48,045,720(+) G/A coding_sequence_variant, genic_downstream_transcript_variant, missense_variant, non_coding_transcript_variant
rs186364861 drug-response, Thiopurines, poor metabolism of, 2 48,037,798(+) G/A coding_sequence_variant, missense_variant, non_coding_transcript_variant
rs746071566 drug-response, Thiopurines, poor metabolism of, 2 48,037,783(+) GGAGTCGGAGTCGGAGTCG/GGAGTCGGAGTCG/GGAGTCGGAGTCGGAGTCGGAGTCG coding_sequence_variant, inframe_deletion, inframe_insertion, non_coding_transcript_variant
rs1000117988 -- 48,036,195(+) C/A/T upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for NUDT15 Gene

Variant ID Type Subtype PubMed ID
nsv832601 CNV gain 17160897

Variation tolerance for NUDT15 Gene

Residual Variation Intolerance Score: 70.1% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 4.54; 64.82% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for NUDT15 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

Disorders for NUDT15 Gene

MalaCards: The human disease database

(3) MalaCards diseases for NUDT15 Gene - From: HGMD, OMIM, ClinVar, Orphanet, and DISEASES

- elite association - COSMIC cancer census association via MalaCards

Additional Disease Information for NUDT15

genes like me logo Genes that share disorders with NUDT15: view

No data available for UniProtKB/Swiss-Prot and Genatlas for NUDT15 Gene

Publications for NUDT15 Gene

  1. Proliferating cell nuclear antigen is protected from degradation by forming a complex with MutT Homolog2. (PMID: 19419956) Yu Y … Zhu WG (The Journal of biological chemistry 2009) 3 4 22 58
  2. NUDT15 polymorphisms alter thiopurine metabolism and hematopoietic toxicity. (PMID: 26878724) Moriyama T … Yang JJ (Nature genetics 2016) 3 4 58
  3. Crystal structure, biochemical and cellular activities demonstrate separate functions of MTH1 and MTH2. (PMID: 26238318) Carter M … Stenmark P (Nature communications 2015) 3 4 58
  4. A common missense variant in NUDT15 confers susceptibility to thiopurine-induced leukopenia. (PMID: 25108385) Yang SK … Song K (Nature genetics 2014) 3 4 58
  5. Human MTH3 (NUDT18) protein hydrolyzes oxidized forms of guanosine and deoxyguanosine diphosphates: comparison with MTH1 and MTH2. (PMID: 22556419) Takagi Y … Sekiguchi M (The Journal of biological chemistry 2012) 3 4 58

Products for NUDT15 Gene

Sources for NUDT15 Gene

Loading form....