Free for academic non-profit institutions. Other users need a Commercial license

Aliases for NUDT15 Gene

Aliases for NUDT15 Gene

  • Nudix (Nucleoside Diphosphate Linked Moiety X)-Type Motif 15 2 3
  • 8-Oxo-DGTPase NUDT15 3 4
  • MutT Homolog 2 3 4
  • MTH2 3 4
  • Probable 7,8-Dihydro-8-Oxoguanine Triphosphatase NUDT15 3
  • Nucleoside Diphosphate-Linked Moiety X Motif 15 4
  • 7,8-Dihydro-8-Oxoguanine-Triphosphatase NUDT15 4
  • Probable 8-Oxo-DGTP Diphosphatase NUDT15 3
  • Nudix Motif 15 4
  • EC 4

External Ids for NUDT15 Gene

Previous GeneCards Identifiers for NUDT15 Gene

  • GC13P046409
  • GC13P047509
  • GC13P048611
  • GC13P029404

Summaries for NUDT15 Gene

GeneCards Summary for NUDT15 Gene

NUDT15 (Nudix (Nucleoside Diphosphate Linked Moiety X)-Type Motif 15) is a Protein Coding gene. Among its related pathways are Metabolism and Purine metabolism (REACTOME). GO annotations related to this gene include 8-oxo-7,8-dihydroguanosine triphosphate pyrophosphatase activity and 8-oxo-7,8-dihydrodeoxyguanosine triphosphate pyrophosphatase activity.

UniProtKB/Swiss-Prot for NUDT15 Gene

  • Mediates the hydrolysis of some nucleoside diphosphate derivatives. Can degrade 8-oxo-dGTP in vitro, suggesting that it may remove an oxidatively damaged form of guanine (7,8-dihydro-8-oxoguanine) from DNA and the nucleotide pool, thereby preventing misincorporation of 8-oxo-dGTP into DNA thus preventing A:T to C:G transversions. Its substrate specificity in vivo however remains unclear (By similarity). May have a role in DNA synthesis and cell cycle progression through the interaction with PCNA.

No data available for Entrez Gene Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for NUDT15 Gene

Genomics for NUDT15 Gene

Regulatory Elements for NUDT15 Gene

Genomic Location for NUDT15 Gene

48,037,567 bp from pter
48,047,222 bp from pter
9,656 bases
Plus strand

Genomic View for NUDT15 Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for NUDT15 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for NUDT15 Gene

Proteins for NUDT15 Gene

  • Protein details for NUDT15 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Probable 8-oxo-dGTP diphosphatase NUDT15
    Protein Accession:
    Secondary Accessions:
    • A2RUR6
    • Q32Q27
    • Q6P2C9

    Protein attributes for NUDT15 Gene

    164 amino acids
    Molecular mass:
    18609 Da
    Name=Mg(2+); Xref=ChEBI:CHEBI:18420; Name=Mn(2+); Xref=ChEBI:CHEBI:29035; Note=Magnesium may be the real cofactor in vivo.;
    Quaternary structure:
    • Interacts with PCNA; interaction is disrupted in response to UV irradiation.

neXtProt entry for NUDT15 Gene

Proteomics data for NUDT15 Gene at MOPED

Post-translational modifications for NUDT15 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for NUDT15 Gene

ENSEMBL proteins:
Reactome Protein details:
REFSEQ proteins:

Antibody Products

  • Santa Cruz Biotechnology (SCBT) Antibodies for NUDT15

No data available for DME Specific Peptides for NUDT15 Gene

Domains for NUDT15 Gene

Gene Families for NUDT15 Gene

Protein Domains for NUDT15 Gene

Suggested Antigen Peptide Sequences for NUDT15 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Contains 1 nudix hydrolase domain.
  • Belongs to the Nudix hydrolase family.
  • Contains 1 nudix hydrolase domain.
  • Belongs to the Nudix hydrolase family.
genes like me logo Genes that share domains with NUDT15: view

Function for NUDT15 Gene

Molecular function for NUDT15 Gene

UniProtKB/Swiss-Prot CatalyticActivity:
8-oxo-dGTP + H(2)O = 8-oxo-dGMP + diphosphate.
UniProtKB/Swiss-Prot Function:
Mediates the hydrolysis of some nucleoside diphosphate derivatives. Can degrade 8-oxo-dGTP in vitro, suggesting that it may remove an oxidatively damaged form of guanine (7,8-dihydro-8-oxoguanine) from DNA and the nucleotide pool, thereby preventing misincorporation of 8-oxo-dGTP into DNA thus preventing A:T to C:G transversions. Its substrate specificity in vivo however remains unclear (By similarity). May have a role in DNA synthesis and cell cycle progression through the interaction with PCNA.

Enzyme Numbers (IUBMB) for NUDT15 Gene

Gene Ontology (GO) - Molecular Function for NUDT15 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0008413 8-oxo-7,8-dihydroguanosine triphosphate pyrophosphatase activity IDA 22556419
GO:0016787 hydrolase activity --
GO:0035539 8-oxo-7,8-dihydrodeoxyguanosine triphosphate pyrophosphatase activity IDA 22556419
GO:0046872 metal ion binding IEA --
genes like me logo Genes that share ontologies with NUDT15: view

Animal Model Products

miRNA for NUDT15 Gene

miRTarBase miRNAs that target NUDT15

miRNA Products

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for NUDT15

In Situ Assay Products

Flow Cytometry Products

No data available for Phenotypes , Animal Models , Transcription Factor Targets and HOMER Transcription for NUDT15 Gene

Localization for NUDT15 Gene

Subcellular locations from

Jensen Localization Image for NUDT15 Gene COMPARTMENTS Subcellular localization image for NUDT15 gene
Compartment Confidence
cytosol 4
mitochondrion 2
nucleus 1
peroxisome 1

Gene Ontology (GO) - Cellular Components for NUDT15 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005829 cytosol TAS --
genes like me logo Genes that share ontologies with NUDT15: view

No data available for Subcellular locations from UniProtKB/Swiss-Prot for NUDT15 Gene

Pathways for NUDT15 Gene

genes like me logo Genes that share pathways with NUDT15: view

Pathways by source for NUDT15 Gene

PCR Array Products

  • Pathway & Disease-focused RT² Profiler PCR Arrays
    • Nitric Oxide Signaling Pathway in human,mouse,rat
    • Molecular Toxicology PathwayFinder 384HT in human,mouse,rat

Interacting Proteins for NUDT15 Gene

STRING Interaction Network Preview (showing 1 interactants - click image to see details)
Selected Interacting proteins: ENSP00000258662 for NUDT15 Gene via STRING

Symbol External ID(s) Details

Gene Ontology (GO) - Biological Process for NUDT15 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006184 obsolete GTP catabolic process --
GO:0006203 dGTP catabolic process IDA 22556419
GO:0034656 nucleobase-containing small molecule catabolic process TAS --
GO:0044281 small molecule metabolic process TAS --
GO:0055086 nucleobase-containing small molecule metabolic process TAS --
genes like me logo Genes that share ontologies with NUDT15: view

Drugs for NUDT15 Gene

(10) HMDB Compounds for NUDT15 Gene

Compound Synonyms Cas Number PubMed IDs
  • 8-Oxo-7,8-dihydro-2'-deoxyguanosine 5'-triphosphate
  • 2'-Deoxy-7,8-dihydro-8-oxo-Guanosine 5'-(tetrahydrogen triphosphate)
  • Adenosindiphosphorsaeure
  • CDP
  • Deoxy-TDP

(2) PharmGKB related drug/compound annotations for NUDT15 Gene

Drug/compound Annotation
azathioprine Clinical Annotation
mercaptopurine Clinical Annotation
genes like me logo Genes that share compounds with NUDT15: view

Transcripts for NUDT15 Gene

mRNA/cDNA for NUDT15 Gene

Unigene Clusters for NUDT15 Gene

Nudix (nucleoside diphosphate linked moiety X)-type motif 15:
Representative Sequences:

miRNA Products

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for NUDT15

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for NUDT15 Gene

No ASD Table

Relevant External Links for NUDT15 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for NUDT15 Gene

mRNA expression in normal human tissues for NUDT15 Gene

Protein differential expression in normal tissues for NUDT15 Gene

This gene is overexpressed in Nasal epithelium (53.8).

Integrated Proteomics: protein expression from ProteomicsDB, PaxDb, MOPED, and MaxQB for NUDT15 Gene

SOURCE GeneReport for Unigene cluster for NUDT15 Gene Hs.144407

genes like me logo Genes that share expressions with NUDT15: view

Primer Products

In Situ Assay Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Expression partners for NUDT15 Gene

Orthologs for NUDT15 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for NUDT15 Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia NUDT15 35
  • 90.85 (n)
  • 93.9 (a)
NUDT15 36
  • 90 (a)
(Canis familiaris)
Mammalia NUDT15 35
  • 84.05 (n)
  • 86.5 (a)
NUDT15 36
  • 85 (a)
(Mus musculus)
Mammalia Nudt15 35
  • 85.08 (n)
  • 90.91 (a)
Nudt15 16
Gm5519 36
  • 84 (a)
Nudt15 36
  • 86 (a)
(Pan troglodytes)
Mammalia NUDT15 35
  • 99.8 (n)
  • 100 (a)
-- 36
  • 100 (a)
-- 36
  • 100 (a)
(Rattus norvegicus)
Mammalia Nudt15 35
  • 84.85 (n)
  • 89.51 (a)
(Monodelphis domestica)
Mammalia -- 36
  • 58 (a)
-- 36
  • 76 (a)
(Ornithorhynchus anatinus)
Mammalia NUDT15 36
  • 88 (a)
(Gallus gallus)
Aves NUDT15 35
  • 64.78 (n)
  • 67.38 (a)
NUDT15 36
  • 64 (a)
(Anolis carolinensis)
Reptilia NUDT15 36
  • 72 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia nudt15 35
  • 67.89 (n)
  • 71.32 (a)
African clawed frog
(Xenopus laevis)
Amphibia LOC398640 35
(Danio rerio)
Actinopterygii nudt15 35
  • 61.87 (n)
  • 58.33 (a)
nudt15 36
  • 55 (a)
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.4285 35
thale cress
(Arabidopsis thaliana)
eudicotyledons NUDX1 35
  • 52.82 (n)
  • 47.46 (a)
bread mold
(Neurospora crassa)
Ascomycetes NCU02895 35
  • 51.52 (n)
  • 45.45 (a)
Species with no ortholog for NUDT15:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for NUDT15 Gene

Gene Tree for NUDT15 (if available)
Gene Tree for NUDT15 (if available)

Paralogs for NUDT15 Gene Pseudogenes for NUDT15 Gene

genes like me logo Genes that share paralogs with NUDT15: view

No data available for Paralogs for NUDT15 Gene

Variants for NUDT15 Gene

Sequence variations from dbSNP and Humsavar for NUDT15 Gene

SNP ID Clin Chr 13 pos Sequence Context AA Info Type MAF
rs943066 -- 48,041,299(-) taatc(A/G)cctcc intron-variant
rs2031775 -- 48,037,407(-) AACCT(C/T)GGCAC upstream-variant-2KB
rs3782979 -- 48,044,971(+) TCATA(A/G)AGAAA intron-variant
rs3831098 -- 48,037,956(-) GGCGT(-/GAGATCGTCCCTCTGCGCACGCCCC)GAGTT intron-variant
rs7319043 -- 48,039,853(+) gtctc(C/G)atctc intron-variant

Structural Variations from Database of Genomic Variants (DGV) for NUDT15 Gene

Variant ID Type Subtype PubMed ID
nsv832601 CNV Gain 17160897

Relevant External Links for NUDT15 Gene

HapMap Linkage Disequilibrium report
Human Gene Mutation Database (HGMD)

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for NUDT15 Gene

Disorders for NUDT15 Gene

No disorders were found for NUDT15 Gene.

No data available for MalaCards , OMIM , UniProtKB/Swiss-Prot , University of Copenhagen DISEASES , Novoseek inferred disease relationships , Genatlas and External Links for NUDT15 Gene

Publications for NUDT15 Gene

  1. Proliferating cell nuclear antigen is protected from degradation by forming a complex with MutT Homolog2. (PMID: 19419956) Yu Y. … Zhu W.-G. (J. Biol. Chem. 2009) 3 4 23
  2. Mouse MTH2 protein which prevents mutations caused by 8-oxoguanine nucleotides. (PMID: 12767940) Cai J.P. … Sekiguchi M. (Biochem. Biophys. Res. Commun. 2003) 2 3
  3. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T. … Sugano S. (Nat. Genet. 2004) 3 4
  4. The DNA sequence and analysis of human chromosome 13. (PMID: 15057823) Dunham A. … Ross M.T. (Nature 2004) 3 4
  5. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4

Products for NUDT15 Gene

Sources for NUDT15 Gene

Back to Top
